Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2020 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2020 Volume 19 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer

  • Authors:
    • Lin Liu
    • Honghong He
    • Dan Xu
    • Yuehua Feng
    • Huijun Zhou
    • Liyan Shi
    • Yanzheng Gu
    • Jian Wang
    • Yibei Zhu
  • View Affiliations / Copyright

    Affiliations: Department of Immunology, School of Biology and Basic Medical Sciences, Soochow University, Suzhou, Jiangsu 215123, P.R. China, Comprehensive Laboratory, The Third Affiliated Hospital of Soochow University, Changzhou, Jiangsu 213003, P.R. China, Jiangsu Key Laboratory of Clinical Immunology, Soochow University, Suzhou, Jiangsu 215006, P.R. China, Institute of Pediatric Research, Children's Hospital of Soochow University, Suzhou, Jiangsu 215025, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2457-2465
    |
    Published online on: January 17, 2020
       https://doi.org/10.3892/ol.2020.11319
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Immunotherapy is effective in improving the survival and prognosis of patients with non‑small cell lung cancer (NSCLC), and identifying effective immunomarkers is important for immunotherapy. Interleukin (IL)‑36γ is a novel immunomarker that has an important function in the antitumor immune response. The present study investigated the association between IL‑36γ and NSCLC to provide novel insight into immunotherapy for patients with NSCLC. Tissue microarrays of lung adenocarcinoma and squamous cell carcinoma were purchased for immunohistochemical analysis of IL‑36γ expression levels and clinical parameters. In addition, fresh clinical NSCLC and adjacent normal tissue samples were collected to analyze IL‑36γ mRNA expression levels using quantitative PCR. IL‑36γ protein was primarily located in the cytoplasm, with a small quantity in the nucleus, and IL‑36γ mRNA and protein expression levels in lung cancer tissues were significantly higher compared with those in adjacent normal tissues. Elevated IL‑36γ protein expression levels were significantly associated with a higher tumor grade of lung adenocarcinoma; however, IL‑36γ mRNA expression levels were inversely associated with the clinical Tumor‑Node‑Metastasis stage in patients with lung squamous cell carcinoma. In addition, patients with adenocarcinoma with high IL‑36γ protein expression levels tended to longer post‑operative survival times. These findings indicate that IL‑36γ may have potential as an immunomarker for prediction of tumor progression and survival in patients with NSCLC.

Introduction

According to the World Health Organization statistics in 2018, lung cancer is the sixth leading cause of cancer-associated mortality worldwide and NSCLC accounts for ~85% of all lung cancer cases (1,2). Although a number of patients with lung cancer may benefit from chemotherapy, radiotherapy or molecular targeted therapy, more effective immunotherapies need to be developed to aid our understanding of the molecular characteristics of lung tumor tissues.

The body is able to recognize and destroy cancer cells through immune surveillance mechanisms (3,4). However, certain characteristics of cancer cells may lead to immune tolerance and can be induced by multiple mechanisms in the tumor microenvironment (TME), including a reduction in the expression of co-stimulatory molecules and cytokines and through the expression of negative immunoregulatory molecules (5,6). Cytokines serve an important role in the antitumor immune response (7,8); therefore, investigation of cytokine expression levels in the TME may provide valuable novel insight into the underlying molecular mechanisms of tumor behavior for cancer immunotherapy.

Interleukin (IL)-36 is a member of the IL-1 family and has several subtypes, including IL-36α, IL-36β, IL-36γ and IL-36 receptor antagonist (9). IL-36γ interacts with the IL-36 receptor/IL-1RAcP, activating the NF-κB and mitogen-activated protein kinase signaling pathways. These pathways result in the production of inflammatory mediators, such as cytokines and chemokines, and regulate autoimmune diseases, inflammatory responses and antitumor immune responses. IL-36γ is primarily expressed in peripheral blood lymphocytes, keratinocytes and bronchial epithelial cells (9). In addition, human macrophages and murine dendritic cells (DCs) express IL-36γ following stimulation by the toll-like receptor or lipopolysaccharides (10,11). Previous studies have demonstrated that IL-36γ induces autoimmune diseases such as psoriasis, allergic rhinitis (11) and allergic asthma (12), and is associated with type-1 immune responses (13–15). High IL-36γ expression levels can stimulate immune differentiation of Th1-type cells, contributing to a positive immune response to infectious diseases (16,17). IL-36γ-transfected DCs can upregulate the expression levels of T-bet, a T-box transcription factor, transforming the TME and promoting the development of lymphoid organs and inhibiting tumor growth (10,18). IL-36γ is a novel antitumor cytokine that can promote proliferation of CD4+ T lymphocytes, CD8+ T lymphocytes, NK cells and γδT cells in vitro and in vivo, promoting tumor eradication in the TME (7).

A previous study demonstrated that a low expression level of IL-33, another member of the IL-1 family, was associated with poor prognosis in patients with lung adenocarcinoma (19). Therefore, the present study aimed to determine if IL-36γ had a similar association with the prognosis of patients with non-small cell lung carcinoma (NSCLC). By reviewing the The National Center for Biotechnology Information Gene Expression Database (NCBI GEO) database (ncbi.nlm.nih.gov/geo), it was identified that IL-36γ was expressed in lung cancer, especially in lung squamous cell carcinoma. A previous study demonstrated that IL-36γ greatly promoted the proliferation and activation of CD8+ cells and enhanced the antitumor immune response using animal models (7). Therefore, the present study retrospectively analyzed clinical tissue specimens to investigate the value of IL-36γ expression levels in the treatment and diagnosis of patients with NSCLC. Immunohistochemistry and quantitative (q)PCR was used to investigate IL-36γ mRNA and protein expression levels during the progression of NSCLC, and to establish the association between IL-36γ and the clinical and pathological parameters of patients with NSCLC.

Materials and methods

Specimens

IL-36γ tissue microarrays of lung adenocarcinoma and squamous cell lung cancer were purchased from the Shanghai Xinchao Biological Technology Co., Ltd. Each chip contained 150 tissues, including 75 tumor tissues and 75 corresponding adjacent normal tissues. Among the 75 lung squamous cell carcinoma tissues, one was classified as large cell carcinoma and was excluded from the follow-up analysis. Immunohistochemistry was performed on the tissue chips by Shanghai Xinchao Biological Technology Co., Ltd., in accordance with standard procedures.

Tumor tissues and adjacent normal tissues were also collected from patients with NSCLC (age range, 38–76 years; median age, 63 years; 40 men, 30 women) following surgery at The Third Affiliated Hospital of Soochow University between March and December 2009, and between January 2014 and February 2015. The samples of lung cancer tissue were confirmed as NSCLC by senior pathologists based on tissue histopathology and morphology, and there were 57 cases of lung adenocarcinoma and 42 cases of lung squamous cell carcinoma. According to the Tumor-Node-Metastasis (TNM) stage criteria for lung cancer by the International Association for the Study of Lung Cancer (20), stages I and IIa were classified as early cases, whereas stages IIb, III and IV were classified as advanced cases (19). The tissues (100 mg) were frozen and stored in nitrogen immediately (−196°C). The present study was approved by The Ethics Committee of Soochow University (Suzhou, China) and all patients provided informed written consent.

Total RNA extraction and qPCR

Total RNA was extracted from patient tumor tissues and adjacent tissues using TRIzol® reagent (Ambion; Thermo Fisher Scientific, Inc.). RNA quality was assessed using 1% agarose gel electrophoresis and absorbance was measured at 260/280 nm using a NanoDrop™ 2000 UV spectrophotometer (Thermo Fisher Scientific, Inc.). RNA was then reverse transcribed into cDNA using a Reverse Transcription kit (Applied Biosystems, Thermo Fisher Scientific, Inc.) on a Bio-Rad T100™ Thermal Cycler (Bio-Rad Laboratories, Inc.), and the reaction conditions were as follows: 25°C for 10 min, 37°C for 120 min and 85°C for 5 min, followed by maintaining at 4°C. The qPCR assay was performed using a QuantiNova SYBR PCR kit (Qiagen China Co., Ltd.) using a CFX96™ Real-Time system (Bio-Rad Laboratories, Inc.). The qPCR cycling conditions were as follows: Preheating at 95°C for 2 min, denaturation at 95°C for 5 sec, annealing at 60°C for 10 sec and a final extension at 60°C for 10 sec, for 40 amplification cycles. The results were quantified using the 2−ΔΔCq method (21). The primers were designed and synthesized by Nanjing GenScript Biotech Corp. GAPDH was used as the internal reference and all primer sequences are shown in Table I.

Table I.

IL-36γ and GAPDH primer sequences.

Table I.

IL-36γ and GAPDH primer sequences.

GenePrimer sequence (5′-3′)Fragment length, bp
IL-36γ 112
  Forward AGGTTGGAGAACAGCCCACATT
  Reverse GTCCTACCAGTCTTGGCACGG
GAPDH 189
  Forward GGAAGGTGAAGGTCGGAGTC
  Reverse CGTTCTCAGCCTTGACGGT

[i] IL, interleukin.

Pathological scoring criteria

All tissue chip staining scores of IL-36γ protein expression levels were independently assessed by two pathologists under a light microscope at ×200 magnification. A positive signal was identified when the cytoplasm or nucleus showed a dark brown color. A total of 10 fields were randomly selected, and the protein positive ratio and color intensity were scored. The staining positive ratio was scored on a 5-point scale based on the percentage of positive staining as follows: 0 points, <5%; 1 point, 6–25%; 2 points, 26–50%; 3 points, 51–75%; and 4 points, >75%. Color intensity was scored on 4 levels as follows: 0 points, no color; 1 point, light yellow; 2 points, brown; and 3 points, dark brown. The final score was calculated by multiplying the positive ratio and color intensity, with four levels as follows: -, 0 points; +, 1–4 points; ++, 5–8 points; and +++, 9–12 points. Low expression levels were denoted as −/+ and high expression levels were denoted as ++/+++ for statistical analysis (22,23).

Bioinformatics

The GEO (https://www.ncbi.nlm.nih.gov/) (dataset no. GDS3966/220322_at/IL-36γ) and Oncomine databases (https://www.oncomine.org/) were used to retrieve IL-36γ expression data from human tumors.

Statistical analysis

Statistical analyses and graphing were performed using GraphPad Prism 5.0 (GraphPad Software, Inc.). The data are presented as the mean ± standard deviation. IL-36γ mRNA results were obtained using the Mann-Whitney U test. Fisher's exact test was used to analyze protein expression levels of IL-36γ or the association between IL-36γ protein expression levels and clinical parameters. A χ2 test was used to analyze the association between IL-36γ protein expression levels and tumor pathological grade. Patient survival was analyzed using the Kaplan-Meier survival analysis and log-rank test, and the Cox hazard ratio model. P<0.05 was considered to indicate a statistically significant difference.

Results

IL-36γ protein is expressed in normal tissues

Immunohistochemical analysis of the tissue microarrays was used to explore the expression patterns of IL-36γ protein in tumor-adjacent normal tissues compared with NSCLC tissues. Positive expression signals of IL-36γ were primarily located in the cytoplasm, with weaker staining identified in the nucleus, shown as brown particles. In tumor-adjacent normal tissues, IL-36γ was expressed in various cell types, including bronchial epithelial cells (Fig. 1A), vascular endothelial cells (Fig. 1B), chondrocytes (Fig. 1C) and alveolar epithelial cells (Fig. 1D).

Figure 1.

Interleukin-36γ protein expression levels in normal lung tissues, shown as marked brown deposits (arrows) in (A) bronchial epithelial cells, (B) vascular endothelial cells, (C) chondrocytes and (D) alveolar epithelial cells. Magnification, ×200.

IL-36γ protein is expressed in tumor cells

Based on the results of the immunohistochemical staining, it was revealed that IL-36γ was expressed in lung cancer cells, including lung adenocarcinoma (Fig. 2A) and lung squamous cell carcinoma (Fig. 2B). Positive expression signals (brown particles) of IL-36γ were also primarily located in the cytoplasm, with weaker staining identified in the nucleus.

Figure 2.

Interleukin-36γ protein expression levels in lung tumor tissues, shown as marked brown deposits (arrows) in (A) lung adenocarcinoma and (B) lung squamous cell carcinoma. Magnification, ×200.

IL-36γ protein and mRNA expression levels in tumor tissues of lung adenocarcinoma and squamous cell carcinoma are significantly higher compared with those in adjacent normal tissues

Based on the pathological scoring criteria, IL-36γ protein expression levels were evaluated in 75 lung adenocarcinoma tumor tissues, 74 squamous cell carcinoma tissues and the corresponding adjacent normal tissues. IL-36γ protein expression levels were higher in the cancer tissues compared with those in the corresponding adjacent normal tissues (Fig. 3). Among the 75 patients with lung adenocarcinoma, 39 (52%) exhibited higher IL-36γ expression levels in tumor tissues, whereas only 2 (3%) exhibited higher IL-36γ expression levels in adjacent normal tissues (P<0.0001; Table II). Among the 74 patients with squamous cell carcinoma, 42 (57%) exhibited significantly higher IL-36γ expression levels in tumor tissues, whereas only 1 (1%) of the adjacent tissue samples exhibited higher IL-36γ expression levels (P<0.0001; Table III).

Figure 3.

IL-36γ protein expression levels are upregulated in non-small cell lung cancer, shown as brown deposits. (A) High IL-36γ expression levels in lung adenocarcinoma tissues. (B) Low IL-36γ expression levels in adenocarcinoma-adjacent tissues. (C) High IL-36γ expression levels in squamous cell carcinoma tissues. (D) Low IL-36γ expression levels in squamous cell carcinoma-adjacent tissues. Magnification, ×200. IL, interleukin.

Table II.

Interleukin-36γ expression levels in lung adenocarcinoma and adjacent normal tissues (n=75).

Table II.

Interleukin-36γ expression levels in lung adenocarcinoma and adjacent normal tissues (n=75).

GroupLow expression, n (%)High expression, n (%)P-value
Adenocarcinoma36 (48.0)39 (52.0)<0.0001
Adjacent tissues73 (97.3)2 (2.7)<0.0001

Table III.

Interleukin-36γ expression levels in lung squamous cell carcinoma and adjacent normal tissues (n=74).

Table III.

Interleukin-36γ expression levels in lung squamous cell carcinoma and adjacent normal tissues (n=74).

GroupLow expression, n (%)High expression, n (%)P-value
Squamous cell carcinoma32 (43.2)42 (56.8)<0.0001
Adjacent tissues73 (98.6)1 (1.4)<0.0001

IL-36γ mRNA expression levels were also analyzed in patients recruited from the Third Affiliated Hospital of Soochow University, including 57 cases of lung adenocarcinoma (29 cases in stage I/IIa and 28 cases in stage IIb/III/IV) and 42 cases of squamous cell carcinoma (22 cases in stage I/IIa and 20 cases in stage IIb/III/IV). IL-36γ mRNA expression levels were significantly increased in both lung adenocarcinoma and squamous cell carcinoma tumor tissues compared with those in normal tissues (P<0.01 and P<0.05, respectively; Fig. 4).

Figure 4.

IL-36γ mRNA expression levels are upregulated in non-small cell lung cancer. IL-36γ mRNA expression levels in (A) adenocarcinoma tissues (n=57) and (B) squamous cell carcinoma (n=42) compared with respective adjacent normal tissues (P<0.05). IL, interleukin.

High IL-36γ protein and mRNA expression levels are associated with tumor pathological grade in lung adenocarcinoma and clinical TNM stage in squamous cell carcinoma

The association between IL-36γ protein expression levels and the clinical pathological parameters of NSCLC were investigated. Higher IL-36γ protein expression levels were significantly associated with a higher tumor pathological grade of lung adenocarcinoma (P<0.05; Table IV). Meanwhile, there was no association between IL-36γ protein expression level and all other assessed clinical pathological parameters in the 74 cases of lung squamous cell carcinoma (Table V). However, IL-36γ mRNA expression level was inversely associated with the clinical TNM stage of the patients with squamous cell carcinoma, which was lower in the late stages (stage IIb/III/IV) than in the early stages (stage I/IIa) (P<0.05; Fig. 5B).

Figure 5.

Association between IL-36γ mRNA expression levels and clinical TNM stage. IL-36γ mRNA expression and clinical TNM stage in (A) adenocarcinoma tissues (n=57) and (B) squamous cell carcinoma (n=42). IL, interleukin; TNM, Tumor-Node-Metastasis.

Table IV.

Association between IL-36γ protein expression levels and clinicopathological features of patients with adenocarcinoma.

Table IV.

Association between IL-36γ protein expression levels and clinicopathological features of patients with adenocarcinoma.

IL-36γ expression levels

Clinicopathological featuren (%)−/+++/+++P-value
Sex 0.6466
  Men40/75 (53.3)1822
  Women35/75 (46.7)1817
Age, years 0.8147
  <6031/73 (42.5)1615
  ≥6042/73 (57.5)2022
Pathological grade 0.0302a
  I13/75 (17.3)85
  II49/75 (65.3)2623
  III13/75 (17.3)211
Tumor size, cm 0.2781
  <5.558/75 (77.3)3028
  ≥5.517/75 (22.7)611
Lymph node metastasis 0.3668
  N0-N143/57 (75.4)1825
  N2-N314/57 (24.6)86
Clinical stage >0.9999
  I/IIa36/58 (62.1)1719
  IIb/III/IV22/58 (37.9)1111

{ label (or @symbol) needed for fn[@id='tfn2-ol-0-0-11319'] } Due to incomplete patient information in the case data, the group sizes for each feature is not the same.

a P<0.05. IL, interleukin.

Table V.

Association between IL-36γ protein expression levels and clinicopathological features of patients with squamous cell carcinoma.

Table V.

Association between IL-36γ protein expression levels and clinicopathological features of patients with squamous cell carcinoma.

IL-36γ expression levels

Clinicopathological featuren (%)−/+++/+++P-value
Sex
  Men68/74 (91.9)31370.2258
  Women6/74 (8.1)15
Age, years
  <6026/73 (35.6)13130.4682
  ≥6047/73 (64.4)1928
Pathological grade 0.1475
  I5/74 (6.7)32
  II61/74 (82.4)2833
  III8/74 (10.8)17
Tumor size, cm 0.3312
  <5.547/74 (63.5)1829
  ≥5.527/74 (36.5)1413
Lymph node metastasis
  N0-N156/62 (90.3)2630>0.9999
  N2-N36/62 (9.7)33
Clinical stage
  I/IIa40/62 (64.5)18220.7929
  IIb/III/IV22/62 (35.5)1111

[i] Due to incomplete patient information in the case data, the group sizes for each feature is not the same. IL, interleukin.

Association between IL-36γ protein expression levels and prognosis in patients with NSCLC

After excluding patients with no clinical stage data and a lack of follow-up data, 38 patients with lung adenocarcinoma were followed for 5 years. The overall 5-year survival rate of patients with NSCLC was 39% (15/38). In addition, 74 patients with squamous cell carcinoma were followed up for 3 years and these patients had a 3-year overall survival rate of 78% (58/74). Kaplan-Meier survival analysis and a log-rank test demonstrated that patients with lung adenocarcinoma and high IL-36γ protein expression levels experienced a longer survival time; however, this difference was not statistically significant (P=0.1343; Fig. 6A). In addition, IL-36γ protein expression levels were not associated with survival in patients with squamous cell carcinoma (P>0.05; Fig. 6B).

Figure 6.

Association between IL-36γ expression levels and the survival of patients with non-small cell lung cancer. (A) The 5-year survival follow-up data for patients with lung adenocarcinoma with low and high IL-36γ expression levels (n=38). (B) The 3-year survival follow-up data for patients with squamous cell carcinoma with low and high IL-36γ expression levels (n=74). IL, interleukin.

Association between clinical parameters and survival of patients with NSCLC

A Cox hazard ratio model was also built. Univariate and multivariate survival analyses were performed on IL-36γ expression level, sex, age, pathological grade, tumor size and T stage in patients with lung adenocarcinoma and squamous cell carcinoma (Tables VI and VII). No correlation was discovered between lung adenocarcinoma survival and any of the above variables (Table VI). There was a significant association between tumor size and survival in patients with lung squamous cell carcinoma in the univariate and multivariate analyses (Table VII). With HR<1 for patients with squamous cell carcinoma, this suggests that the smaller the tumor the longer the survival time (P<0.01; Table VII).

Table VI.

Survival analysis using Cox's regression model in patients with lung adenocarcinoma (n=75).

Table VI.

Survival analysis using Cox's regression model in patients with lung adenocarcinoma (n=75).

Univariate analysisMultivariate analysis


Clinicopathological featureHR (95% CI)P-valueHR (95% CI)P-value
IL36γ expression levels (low:high)1.276 (0.815–1.999)0.28601.402 (0.880–2.234)0.1547
Sex (men:women)0.610 (0.344–1.083)0.09120.563 (0.286–1.108)0.0965
Age (<60:≥60 years)1.163 (0.663–2.041)0.59800.917 (0.499–1.684)0.7797
Pathological grade (I:II:III)0.729 (0.446–1.192)0.20800.737 (0.380–1.429)0.3667
Tumor size (<5.5:≥5.5 cm)0.414 (0.147–1.164)0.09440.385 (0.080–1.849)0.2329
T stage (T1:T2:T3)0.659 (0.319–1.362)0.26001.011 (0.346–2.953)0.9844

[i] IL, interleukin; HR, hazard ratio; CI, confidence interval.

Table VII.

Survival analysis using Cox's regression model in patients with squamous cell carcinoma (n=74).

Table VII.

Survival analysis using Cox's regression model in patients with squamous cell carcinoma (n=74).

Univariate analysisMultivariate analysis


Clinicopathological featureHR (95% CI)P-valueHR (95% CI)P-value
IL36γ protein expression levels (low:high)0.920 (0.535–1.583)0.76301.439 (0.698–2.967)0.3237
Sex (men:women)0.882 (0.372–2.088)0.77501.072 (0.393–2.925)0.8922
Age (<60:≥60 years)0.659 (0.343–1.265)0.21000.526 (0.231–1.195)0.1248
Pathological grade (I:II:III)1.014 (0.570–1.804)0.96100.807 (0.399–1.631)0.5504
Tumor size (<5.5:≥5.5 cm)0.355 (0.172–0.735)0.0053a0.258 (0.104–0.642)0.0036a
T stage (T1:T2:T3)0.902 (0.490–1.663)0.74201.552 (0.778–3.093)0.2122

a P<0.01. IL, interleukin; HR, hazard ratio; CI, confidence interval.

Discussion

In the present study, IL-36γ mRNA and protein expression levels were upregulated in NSCLC. Elevated IL-36γ protein expression levels were significantly associated with a higher tumor grade of lung adenocarcinoma, and IL-36γ mRNA expression levels were inversely associated with clinical TNM stage in patients with squamous cell carcinoma. In addition, higher IL-36γ expression in patients with adenocarcinoma tended to prolong survival, although this was not statistically significant. These data suggest that IL-36γ may have an antitumor role in NSCLC.

IL-33 and IL-36, both members of the cytokine IL-1 family, primarily function as an ‘alarmins’, which are released following tissue injury (9) or during infection (11,24) and are associated with the antitumor immune response (7,25,26). These cytokines can enhance the function of immune cells such as CD8+ T lymphocytes and NK cells by promoting the secretion and expression of effector cytokines, thereby functioning in the antitumor immune response (7,25). In our previous study, IL-33 had an antitumor effect in NSCLC (19). IL-33 expression levels were downregulated in tumor tissues and upregulated IL-33 expression levels were associated with longer survival times in patients with lung adenocarcinoma. Therefore, the present study aimed to determine whether IL-36 had a similar effect.

As a subtype of IL-36, IL-36γ functions in a variety of skin inflammatory reactions and immunopathological processes, such as psoriasis, inflammatory megacolon and infectious diseases (16,27–31). Previous studies have demonstrated the involvement of IL-36γ in the differentiation of Th cells and type-1 immune responses (7,16,17). Our previous study showed that IL-36γ promoted cell activation and expressed IFN-γ, granzyme-B and other type 1 effectors in vitro by stimulating cultured human peripheral blood CD4+ T lymphocytes and CD8+ T lymphocytes (7). Therefore, due to these characteristics of IL-36γ, melanoma tumor cells and breast cancer cells have previously been transfected to overexpress full-length IL-36γ in our laboratory (7). A mouse model demonstrated that IL-36γ overexpression inhibited tumorigenesis and metastasis by promoting the proliferation of CD8+ T and NK cells, and the production of the effector cytokines IFN-γ and TNF-α. Thus, the survival time of tumor-bearing mice was prolonged. In addition, IL-36γ is also used as an adjuvant for tumor vaccines to induce antigen-specific immune responses (7). A recent breast cancer lung metastasis model study indicated that IL-36γ has an important effect in improving the antitumor immune response by enhancing the type-1 immune response, inhibiting lung metastasis (32). Overall, these studies suggest that IL-36γ, as an inflammatory cytokine, may serve an important role in inflammatory diseases and antitumor immunotherapy.

The IL-36γ protein is expressed in keratinocytes, bronchial epithelial cells and brain tissue, and IL-36γ expression levels in macrophages and neutrophils are significantly increased during infection (9,31,33). IL-36γ may affect a variety of cells, including stromal cells, DCs, macrophages and lymphocytes by inducing a series of related inflammatory responses, including the promotion of synthesis and activity of IL-12, IL-8 and IL-6, and the chemokines CXCL1 and CCL20 (31,33–35). In the present study, immunohistochemistry of tissue microarrays showed that IL-36γ is expressed in various cell types, including bronchial epithelial cells, vascular endothelial cells, chondrocytes and alveolar epithelial cells. Positive signals were primarily located in the cytoplasm, with weak staining in the nucleus. According to previous reports and the NCBI GEO and Oncomine databases, IL-36γ is expressed in several other tumor tissues, including melanoma, colorectal cancer, head and neck cancer and lung cancer. The results of the present study also suggest that NSCLC cells express high levels of IL-36γ in a diffuse pattern.

IL-36γ mRNA and protein expression levels were significantly increased in NSCLC tissues compared with those in adjacent normal tissues in the present study. Higher IL-36γ protein expression levels in adenocarcinoma tissues were significantly associated with higher tumor pathological grades, but there was no association observed in squamous cell carcinoma. IL-36γ mRNA expression levels in squamous cell carcinoma were inversely associated with the clinical TNM stage, which is consistent with a previous report investigating melanoma and lung cancer progression that demonstrated that IL-36γ expression levels were higher in the early stage compared with those in the advanced stage (7). It suggestes a potential antitumor effect of IL-36γ in squamous cell carcinoma.

Furthermore, in the present study, survival analysis showed that patients with adenocarcinoma with high IL-36γ protein expression levels had longer survival times (P>0.05); however, the lack of information on patient treatment is a limitation when evaluating the survival time of patients. In addition, the Cox risk model indicated that the survival of patients with squamous cell carcinoma was associated with tumor size.

Prior to the present study, there have been a few studies on the association between IL-36γ and tumors (7,32). Although the underlying mechanism of IL-36γ in the antitumor immune response has been studied in animal models, the role of IL-36γ in human tumors is unclear (7). In the present study, IL-36γ expression patterns in human tumor tissues were investigated, aiming to determine the association between IL-36γ mRNA and protein expression levels and clinical and pathological parameters in NSCLC. The findings of the present study have provided valuable information that may inform later studies of potential mechanisms underlying the function of IL-36γ in NSCLC. The present study may also provide novel insight into the value of IL-36γ as an immunotherapy target for NSCLC treatment. Therefore, further specimens should be collected and the sample size expanded to further study the associations between IL-36γ mRNA and protein expression levels and clinical parameters, and the mechanism underlying IL-36γ function to better determine its value for clinical application. Immunofluorescence co-localization of cellular markers (such as CD4, CD8 and CD56) and IL-36γ in tumor tissues may aid the identification of cell types that secret IL-36γ, facilitating further investigation of the underlying mechanisms of IL-36γ function.

Acknowledgements

Not applicable.

Funding

The present study was funded by The National Natural Science Foundation of China (grant nos. 81273208 and 31607916), The Major Basic Research Project of the Natural Science Foundation of the Jiangsu Higher Education Institutions (grant no. 18KJA180011) and The Suzhou Applied Basic Research-Medical Guidance Program (grant no. SYSD2016106).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

JW and YZ designed and directed the study. LL and HH conducted the experiments and wrote the original manuscript. DX, HZ and LS analyzed the data. YF and YG collected clinical specimens and acquired the data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by The Ethics Committee of Soochow University (Suzhou, China) and all patients provided written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

DCs

dendritic cells

IL-36γ

interleukin-36γ

NSCLC

non-small cell lung cancer

qPCR

quantitative PCR

TME

tumor microenvironment

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA Cancer J Clin. 68:7–30. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Miura Y and Sunaga N: Role of immunotherapy for oncogene-driven non-small cell lung cancer. Cancers (Basel). 10:E2452018. View Article : Google Scholar : PubMed/NCBI

3 

Burnet M: Cancer; A biological approach. I. The processes of control. Br Med J. 1:779–786. 1957. View Article : Google Scholar : PubMed/NCBI

4 

Schreiber RD, Old LJ and Smyth MJ: Cancer immunoediting: Integrating immunity's roles in cancer suppression and promotion. Science. 331:1565–1570. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Sugie T: Immunotherapy for metastatic breast cancer. Chin Clin Oncol. 7:282018. View Article : Google Scholar : PubMed/NCBI

6 

Mellman I, Coukos G and Dranoff G: Cancer immunotherapy comes of age. Nature. 480:480–489. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Wang X, Zhao X, Feng C, Weinstein A, Xia R, Wen W, Lv Q, Zuo S, Tang P, Yang X, et al: IL-36γ transforms the tumor microenvironment and promotes type 1 lymphocyte-mediated antitumor immune responses. Cancer Cell. 28:296–306. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Lippitz BE: Cytokine patterns in patients with cancer: A systematic review. Lancet Oncol. 14:e218–228. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Gresnigt MS and van de Veerdonk FL: Biology of IL-36 cytokines and their role in disease. Semin Immunol. 25:458–465. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Bassoy EY, Towne JE and Gabay C: Regulation and function of interleukin-36 cytokines. Immunol Rev. 281:169–178. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Qin X, Liu M, Zhang S, Wang C and Zhang T: The role of IL-36γ and its regulation in eosinophilic inflammation in allergic rhinitis. Cytokine. 117:84–90. 2019. View Article : Google Scholar : PubMed/NCBI

12 

Ramadas RA, Li X, Shubitowski DM, Samineni S, Wills-Karp M and Ewart SL: IL-1 receptor antagonist as a positional candidate gene in a murine model of allergic asthma. Immunogenetics. 58:851–855. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Blumberg H, Dinh H, Trueblood ES, Pretorius J, Kugler D, Weng N, Kanaly ST, Towne JE, Willis CR, Kuechle MK, et al: Opposing activities of two novel members of the IL-1 ligand family regulate skin inflammation. J Exp Med. 204:2603–2614. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Johnston A, Xing X, Guzman AM, Riblett M, Loyd CM, Ward NL, Wohn C, Prens EP, Wang F, Maier LE, et al: IL-1F5, -F6, -F8, and -F9: A novel IL-1 family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J Immunol. 186:2613–2622. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Chustz RT, Nagarkar DR, Poposki JA, Favoreto S Jr, Avila PC, Schleimer RP and Kato A: Regulation and function of the IL-1 family cytokine IL-1F9 in human bronchial epithelial cells. Am J Respir Cell Mol Biol. 45:145–153. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Gresnigt MS, Rosler B, Jacobs CW, Becker KL, Joosten LA, van der Meer JW, Netea MG, Dinarello CA and van de Veerdonk FL: The IL-36 receptor pathway regulates aspergillus fumigatus-induced Th1 and Th17 responses. Eur J Immunol. 43:416–426. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Vigne S, Palmer G, Martin P, Lamacchia C, Strebel D, Rodriguez E, Olleros ML, Vesin D, Garcia I, Ronchi F, et al: IL-36 signaling amplifies Th1 responses by enhancing proliferation and Th1 polarization of naive CD4+ T cells. Blood. 120:3478–3487. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Weinstein AM, Chen L, Brzana EA, Patil PR, Taylor JL, Fabian KL, Wallace CT, Jones SD, Watkins SC, Lu B, et al: Tbet and IL-36γ cooperate in therapeutic DC-mediated promotion of ectopic lymphoid organogenesis in the tumor microenvironment. Oncoimmunology. 6:e13222382017. View Article : Google Scholar : PubMed/NCBI

19 

Yang M, Feng Y, Yue C, Xu B, Chen L, Jiang J, Lu B and Zhu Y: Lower expression level of IL-33 is associated with poor prognosis of pulmonary adenocarcinoma. PLoS One. 13:e01934282018. View Article : Google Scholar : PubMed/NCBI

20 

Feng SH and Yang ST: The new 8th TNM staging system of lung cancer and its potential imaging interpretation pitfalls and limitations with CT image demonstrations. Diagn Interv Radiol. 25:270–279. 2019. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Chen C, Qu QX, Xie F, Zhu WD, Zhu YH and Huang JA: Analysis of B7-H4 expression in metastatic pleural adenocarcinoma and therapeutic potential of its antagonists. BMC Cancer. 17:6522017. View Article : Google Scholar : PubMed/NCBI

23 

Sun J, Chen LJ, Zhang GB, Jiang JT, Zhu M, Tan Y, Wang HT, Lu BF and Zhang XG: Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59:1163–1171. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Liew FY, Pitman NI and McInnes IB: Disease-associated functions of IL-33: The new kid in the IL-1 family. Nat Rev Immunol. 10:103–110. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Li X, Lv Q, Feng Y, Gu Y, Xia R, Ma J, He H and Zhu Y: Interleukin-33, a potential cytokine expressed in tumor microenvironment involves in antitumor immunotherapy through facilitates CD8(+) T cells. J Interferon Cytokine Res. 38:491–499. 2018. View Article : Google Scholar : PubMed/NCBI

26 

Zhao X, Chen X, Shen X, Tang P, Chen C, Zhu Q, Li M, Xia R, Yang X, Feng C, et al: IL-36β promotes CD8(+) T cell activation and antitumor immune responses by activating mTORC1. Front Immunol. 10:18032019. View Article : Google Scholar : PubMed/NCBI

27 

Boutet MA, Bart G, Penhoat M, Amiaud J, Brulin B, Charrier C, Morel F, Lecron JC, Rolli-Derkinderen M, Bourreille A, et al: Distinct expression of interleukin (IL)-36α, β and γ, their antagonist IL-36Ra and IL-38 in psoriasis, rheumatoid arthritis and Crohn's disease. Clin Exp Immunol. 184:159–173. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Tomuschat C, O'Donnell AM, Coyle D and Puri P: Altered expression of IL36γ and IL36 receptor (IL1RL2) in the colon of patients with Hirschsprung's disease. Pediatr Surg Int. 33:181–186. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Gardner JK and Herbst-Kralovetz MM: IL-36γ induces a transient HSV-2 resistant environment that protects against genital disease and pathogenesis. Cytokine. 111:63–71. 2018. View Article : Google Scholar : PubMed/NCBI

30 

Xiaoling Y, Chao W, Wenming W, Feng L and Hongzhong J: Interleukin (IL)-8 and IL-36γ but not IL-36Ra are related to acrosyringia in pustule formation associated with palmoplantar pustulosis. Clin Exp Dermatol. 44:52–57. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Wein AN, Dunbar PR, McMaster SR, Li ZT, Denning TL and Kohlmeier JE: IL-36γ protects against severe influenza infection by promoting lung alveolar macrophage survival and limiting viral replication. J Immunol. 201:573–582. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Chen Y, Sun J, Huang Y, Liu Y, Liang L, Yang D, Lu B and Li S: Targeted codelivery of doxorubicin and IL-36γ expression plasmid for an optimal chemo-gene combination therapy against cancer lung metastasis. Nanomedicine. 15:129–141. 2019. View Article : Google Scholar : PubMed/NCBI

33 

Huynh J, Scholz GM, Aw J, Kwa MQ, Achuthan A, Hamilton JA and Reynolds EC: IRF6 regulates the expression of IL-36γ by human oral epithelial cells in response to porphyromonas gingivalis. J Immunol. 196:2230–2238. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Foster AM, Baliwag J, Chen CS, Guzman AM, Stoll SW, Gudjonsson JE, Ward NL and Johnston A: IL-36 promotes myeloid cell infiltration, activation, and inflammatory activity in skin. J Immunol. 192:6053–6061. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Vigne S, Palmer G, Lamacchia C, Martin P, Talabot-Ayer D, Rodriguez E, Ronchi F, Sallusto F, Dinh H, Sims JE and Gabay C: IL-36R ligands are potent regulators of dendritic and T cells. Blood. 118:5813–5823. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu L, He H, Xu D, Feng Y, Zhou H, Shi L, Gu Y, Wang J and Zhu Y: Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer. Oncol Lett 19: 2457-2465, 2020.
APA
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L. ... Zhu, Y. (2020). Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer. Oncology Letters, 19, 2457-2465. https://doi.org/10.3892/ol.2020.11319
MLA
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L., Gu, Y., Wang, J., Zhu, Y."Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer". Oncology Letters 19.3 (2020): 2457-2465.
Chicago
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L., Gu, Y., Wang, J., Zhu, Y."Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer". Oncology Letters 19, no. 3 (2020): 2457-2465. https://doi.org/10.3892/ol.2020.11319
Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, He H, Xu D, Feng Y, Zhou H, Shi L, Gu Y, Wang J and Zhu Y: Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer. Oncol Lett 19: 2457-2465, 2020.
APA
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L. ... Zhu, Y. (2020). Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer. Oncology Letters, 19, 2457-2465. https://doi.org/10.3892/ol.2020.11319
MLA
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L., Gu, Y., Wang, J., Zhu, Y."Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer". Oncology Letters 19.3 (2020): 2457-2465.
Chicago
Liu, L., He, H., Xu, D., Feng, Y., Zhou, H., Shi, L., Gu, Y., Wang, J., Zhu, Y."Association between interleukin‑36γ and tumor progression in non‑small cell lung cancer". Oncology Letters 19, no. 3 (2020): 2457-2465. https://doi.org/10.3892/ol.2020.11319
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team