Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
September-2020 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2020 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer

  • Authors:
    • Marta Brunetti
    • Ioannis Panagopoulos
    • Ilyá Kostolomov
    • Ben Davidson
    • Sverre Heim
    • Francesca Micci
  • View Affiliations / Copyright

    Affiliations: Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, 0424 Oslo, Norway, Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, 0424 Oslo, Norway, Section for Applied Informatics, Institute for Cancer Genetics and Informatics, The Norwegian Radium Hospital, Oslo University Hospital, 0424 Oslo, Norway, Department of Pathology, The Norwegian Radium Hospital, Oslo University Hospital, 0424 Oslo, Norway
    Copyright: © Brunetti et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2273-2279
    |
    Published online on: June 26, 2020
       https://doi.org/10.3892/ol.2020.11782
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ovarian carcinomas and carcinosarcomas often cause malignant effusions, an accumulation within serous cavities of fluid containing cancer cells. Few studies have focused on the molecular alterations and genetic mechanisms behind effusion formation. The present study investigated the mutation status of TP53, PIK3CA, KRAS, HRAS, NRAS and BRAF in effusion fluids from 103 patients with ovarian cancer. In addition, array Comparative Genomic Hybridization (aCGH) analysis was performed on 20 effusions from patients with high‑grade serous carcinoma (10 cases positive for TP53 mutation and 10 with TP53 wild‑type). TP53 mutations, two of which were novel: c.826_830delCCTGT and c.475_476GC>TT, were identified in 44% of the cases. Mutations in KRAS, HRAS, and PIK3CA were identified in two, two and four cases, respectively. None of the effusions analysed showed NRAS or BRAF mutations. The aCGH analysis revealed highly imbalanced genomes similar to those described in primary ovarian carcinomas. No specific profile was indicated to distinguish tumors with TP53 mutations from those without. The molecular profiling of cells found in effusion fluids from patients with ovarian cancer thus showed considerable molecular heterogeneity. TP53 seems to be the most frequently mutated gene in these cells and may serve a leading role in the metastatic process.

Introduction

Cancers of the ovaries, most of which are carcinomas (OC), are the eighth most common malignancy in women and the most lethal one. In the year 2018, 295,414 new cases were diagnosed and 184,799 deaths occurred from ovarian cancer worldwide (1). OC can be subdivided into various histological subtypes, each showing distinct genomic and epigenomic characteristics (2). High-grade serous carcinoma (HGSC) is the most frequent and aggressive histotype, comprising 70% of newly diagnosed cases. Less frequent are endometrioid carcinoma (EC, 15%), clear cell carcinoma (CCC, 12%), low-grade serous carcinoma (LGSC, <10%), and mucinous carcinoma (MC, 3%) (3). Carcinosarcomas (CS) of the female genital tract are biphasic tumors containing some areas showing carcinomatous growth, mostly HGSC, and others displaying sarcomatous differentiation. CS are rare but aggressive tumors that often prove fatal within 1–2 years of diagnosis (4).

The majority of malignant ovarian effusions stem from carcinomas or CS (5,6). They are an almost universal clinical finding in advanced-stage OC, i.e., stage III–IV according to the International Federation of Gynaecology and Obstetrics (FIGO), reflecting widespread intra-abdominal disease with a large number of metastatic tumor cells. OC cells in effusions probably represent a chemoresistant population rendering the disease untreatable and fatal (7,8).

Different cytologic biomarkers are used as adjuncts to morphologic examination to diagnose cancer cells in effusions (5). Studies focusing on molecules that promote the process of invasion and metastasis, as well as influence intracellular signalling pathways and/or act as transcription factors, have provided a better understanding of the biological events behind formation of malignant effusions (5,8); however, this knowledge is still far from complete. Although a growing number of investigations have defined optimal panels for routine cytologic diagnosis of carcinoma cells in effusions, only few studies focused on the molecular alterations and genetic mechanisms behind effusions (5,9,10). And yet, the identification of genetic mutations and genomic imbalances in tumor cells has become increasingly important in the management of different cancer types and also allows us to assess the cells' proneness to develop metastases (11,12).

We investigated the mutation status of the tumor suppressor gene TP53, the phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA), the protooncogenes of the Ras family-ki-ras2 kirsten rat sarcoma viral oncogene homolog (KRAS), Harvey rat sarcoma viral oncogene homolog (HRAS), the neuroblastoma RAS viral (V-Ras) oncogene homolog (NRAS)-and the v-raf murine sarcoma viral oncogene homolog (BRAF) in a series of 103 ovarian effusions. Furthermore, we performed array comparative genomic hybridization (aCGH) to characterize the genomic imbalances incurred by the cells of 20 effusions from HGSC, of which ten tumors showed TP53 mutations whereas the remaining ten had wild-type TP53.

Materials and methods

Tumor material

The material consisted of 103 effusions from ovarian cancers, including 84 HGSC, 10 LGSC, two CCC, one EC, and six CS. All patients were treated at The Norwegian Radium Hospital between 2000 and 2015. The diagnoses were reached using a combination of cytological, morphological, and immunohistochemistry (IHC) investigations according to World Health Organization (WHO) 2014 guidelines (3). The study was approved by the Regional Committee for Medical and Health Research Ethics (REK, project number S-04300; http://helseforskning.etikkom.no), the government-appointed committee responsible for overseeing medical ethics in the South-East region of Norway. Informed consent, including consent for publication, was obtained according to national and institutional guidelines. An overview of the cohort used and the clinical and pathological data are given in Table I.

Table I.

Clinicopathologic parameters of the 103 ovarian effusions investigated.

Table I.

Clinicopathologic parameters of the 103 ovarian effusions investigated.

ParameterDistribution (n)
Histology
  HGSC84
  CS6
  LGSC10
  CCC2
  EC1
Age
  ≤6042
  >6061
FIGO stage
  I1
  II1
  III68
  IV33
Residual disease
  0 cm23
  ≤1 cm32
  >1 cm25
  N/A23
Chemoresponse after primary treatmenta
  CR53
  PR32
  SD7
  PD1
  N/A10

a N/A, Not available (missing data or disease response after chemotherapy could not be evaluated because of normalized CA 125 after primary surgery or missing CA 125 information and no residual tumor). HGSC, high-grade serous carcinoma; CS, carcinosarcoma; LGSC, low-grade serous carcinoma; CCC, clear cell carcinoma; EC, endometrioid carcinoma; N/A, not available; CR, complete response; PR, partial response; SD, stable disease; PD, progressive disease.

Molecular analyses

DNA was extracted using the Maxwell 16 extractor (Promega) and Maxwell 16 Cell DNA Purification kit (Promega) according to the manufacturer's recommendations. The concentration was measured using QIAxel (Qiagen).

Mutational analysis of TP53, PIK3CA, KRAS, HRAS, and NRAS was performed according to previously described protocols, using M13-linked PCR primers designed to flank and amplify targeted sequences (13,14). The primer combinations BRAF-F1 (5′TGCTTGCTCTGATAGGAAAATGAGATCT3′) and BRAF-R1 (5′ATCTCAGGGCCAAAAATTTAATCAGTG3′) were used to detect the mutation status of BRAF. The thermal cycling for BRAF included an initial step at 95°C for 10 min followed by 35 cycles at 96°C for 3 sec, 58°C for 15 sec, 30 sec at 68°C, and a final step at 72°C for 2 min. Direct sequencing was performed using a 3500 Genetic Analyzer (Applied Biosystems).

The genes were selected based on the information reported in the COSMIC database (Catalogue of Somatic Mutations in Cancer, at http://cancer.sanger.ac.uk/cosmic) (15). According to COSMIC, there is no information on mutations in effusions; however, it contains data on the most frequently mutated genes in ovarian carcinoma. Since KRAS was in the top list, we decided to investigate also the other member genes of the RAS and RAF families, i.e., HRAS, NRAS and BRAF.

The BLAST (http://blast.ncbi.nlm.nih.gov/blast.cgi) and BLAT (http://genome.ucsc.edu/cgi-bin/hgblat) programs were used for computer analysis of sequence data. The reference sequences used for TP53 was NM_000546.5.

The difference between mutation and polymorphism was evaluated by the Genome Aggregation Database (gnomAD; http://gnomad.broadinstitute.org/variant/11-534242-A-G).

Whole genome investigation by means of aCGH was performed using the CytoSure Consortium Cancer + SNP arrays (Oxford Gene Technology) according the manufacturers' recommendation. Data were analysed using Agilent Feature Extraction Software (version 10.7.3.1) and CytoSure Interpret Software (version 4.9.40, Oxford Gene Technology). The genomic imbalances were identified using the Circular Binary Segmentation (CBS) algorithm and adding a custom-made aberration filter defining a copy number aberration (CNA) as a region with minimum five probes gained/lost (16). Annotations are based on human reference sequence GRCh37/hg19.

Twenty samples were selected for aCGH investigation, ten bearing TP53 mutation in their genome and ten wild-type. The average copy number alteration (ANCA) index was calculated as the total number of aberrations divided by the samples number between the two groups (17). The statistical analysis was performed using the Mann-Whitney U test.

Results

All effusions analyzed for TP53, PIK3CA, KRAS, HRAS, NRAS, and BRAF mutation status gave informative results. TP53 was found mutated in 41 out of 84 HGSC (49%), in two out of 10 LGSC (20%), in the only case of EC examined, and in one out of six CS. A detailed overview of the TP53 findings is shown in Table II. Two novel mutation sites were identified for TP53: c.826_830delCCTGT in case 7 and c.475-476GC>TT in case 26 (Fig. 1). PIK3CA mutations were found in four HGSC of 103, in which a c.1634A>C (cases 2, 56, and 58) and a c.3155C>T mutation (case 79) were seen. We identified the c.34G>T and c.183A>C KRAS mutations in two of 103 specimens (cases 10, a HGSC, and 85, an LGSC, respectively). The HRAS mutation c.173C>T was also detected in two tumors (2%; cases 16 and 23), both of them HGSC. Finally, we identified an HRAS polymorphism, c.81T>C, in 38 effusions (37.5%) of all histotypes. None of the tumors showed a mutated sequence for NRAS or BRAF.

Figure 1.

Novel site mutations for TP53 (A) Partial sequence chromatogram of case 7 showing delCCTGT; (B) open reading frame of case 7; (C) partial sequence chromatogram of case 26 showing the substitution GC>TT.

Table II.

Mutation status of TP53.

Table II.

Mutation status of TP53.

CaseHistologyTP53
1HGSCc.437G>A; p.W146*; COSM43609
2HGSCc.584T>C; p.I195T; COSM11089
3HGSCc.273G>A; p.W91*COSM44492
4HGSC
5HGSCc.916C>T; p.R306*; COSM10663
6HGSC
7aHGSC c.826_830delCCTGT
8HGSCc.818G>A; p.R273H; COSM10660
9HGSCc.797G>A; p.G266E; COSM10867
10HGSC
11HGSCc.488A>G; p.Y163C; COSM10808
12HGSCc.524G>A; p.R175H; COSM10648
13HGSCc.844C>T; p.R282W; COSM10704
14HGSCc.574C>T; p.Q192*; COSM10733
15HGSCc.527G>T; p.C176F; COSM10645
16HGSCc.469G>T; p.V157F; COSM10670
17HGSCc.527G>A; p.C176Y; COSM10687
18HGSC
19HGSCc.754del; p. L252fs*93; COSM45215
20HGSCc.403del; p.C135fs*35; COSM44670
21HGSC
22HGSCc.394A>T; p.K132*; COSM44641
23HGSCc.832C>G; p.P278A; COSM10814
24HGSCc.814G>A; p.V272M; COSM10891
25HGSCc.394A>G; p.K132E; COSM10813
26aHGSC c.475_476GC>TT
27HGSC
28HGSCc.797G>A; p.G266E; COSM10867
29HGSCc.108G>A; p.P36P; COSM6474191
c.737T>A; p.M246K; COSM44103
30HGSCc.742C>T; p.R248W; COSM10656
31HGSC
32HGSCc.488A>G; p.Y163C; COSM10808
33HGSCc.836G>A; p.G279E; COSM43714
34HGSC
35HGSCc.818G>A; p.R273H; COSM10660
36HGSC
37HGSC
38HGSC
39HGSCc.524G>A; p.R175H; COSM10648
40HGSC
41HGSCc.711G>A; p.M237I; COSM10834
42HGSC
43HGSCc.166G>T; p.E56*; COSM12168
44HGSCc.524G>A; p.R175H; COSM10648
45HGSC
46HGSC
47HGSC
48HGSC
49HGSC
50HGSC
51HGSC
52HGSCc.434T>C; p.L145P; COSM43899
53HGSC
54HGSC
55HGSCc.475G>C; Pa159P; COSM43836
56HGSC
57HGSC
58HGSC
59HGSC
60HGSCc.844C>T; p.R282W; COSM10704
61HGSCc.646G>A; p.V216M; COSM10667
62HGSCc.832 C>T; p.P278S; COSM10939
63HGSC
64HGSC
65HGSC
66HGSC
67HGSC
68HGSC
69HGSC
70HGSC
71HGSCc.527G>T; p.C176F; COSM10645
72HGSC
73HGSC
74HGSC
75HGSCc.578A>G; p.H193R; COSM10742
76HGSC
77HGSC
78HGSC
79HGSC
80HGSC
81HGSCc.796G>A; p.G266R; COSM10794
82HGSCc.844C>T; p.R282W; COSM10704
83HGSC
84HGSC
85LGSCc.750del; p. I251fs*94; COSM44064
86LGSC
87LGSCc.714T>A; p.C238*; COSM45677
88LGSC
89LGSC
90LGSC
91LGSC
92LGSC
93LGSC
94LGSC
95CCC
96CCC
97ECc.1024C>T; p.R342*; COSM11073
98CSc.796G>A; p.G266R; COSM10794
99CS
100CS
101CS
102CS
103CS

a Novel mutation site; *, stop codon; HGSC, high-grade serous carcinoma; CS, carcinosarcoma; LGSC, low-grade serous carcinoma; CCC, clear cell carcinoma; EC, endometrioid carcinoma.

aCGH analysis for genomic imbalances was performed on 20 effusions from patients with HGSC, comparing 10 tumors bearing TP53 mutations (cases 1, 3, 5, 7, 8, 13, 14, 15, 19, and 32) and 10 which had a wild-type TP53 sequence (cases 18, 27, 31, 36, 37, 38, 42, 45, 47, and 48). Overall, the aCGH analysis revealed highly imbalanced genomes in all tumors analysed with many gains and/or losses (Table SI). The most frequent gains were scored at 8q24.3, 20q13.2, and 20q13.31 (70%) whereas the most frequent losses were scored at 4q25 and 4q26 (75%) (Fig. 2). Amplifications mostly involved chromosomal band 19q11 followed by the segment 3q22q29. The two subgroups of effusions, i.e., with and without TP53 mutation, were both very complex and similar with regard to imbalances. The ANCA index calculated for tumors (18) with TP53 mutation was 83.2 but 66.3 for tumors with wild-type TP53 (P=0.14).

Figure 2.

Profiles of imbalances detected by aCGH. (A) Gains and losses detected in effusion cells in patients with HGSC whose tumors were either TP53 mutated or wild-type; (B) Genomic gains and losses in TP53 mutated HGSC effusions; (C) Genomic gains and losses in TP53 wild-type HGSC effusions. aCGH, array Comparative Genomic Hybridization; HGSC, high-grade serous carcinoma.

Discussion

Molecular profiles of different tumor types have helped manage cancer patients with regard to diagnosis, prognosis, and lately also choice of treatment (19). A similar molecular characterization of effusions from ovarian cancer might highlight the mechanisms behind development of metastasis and possibly, further down the road, help decide among different personalized therapies (5). Since the number of studies focusing on molecular analysis of ovarian cancers at such advanced stage that effusions have already developed, is low, and since chemoresistance is one of the main characteristics of these malignancies, we aimed to add to the existing knowledge by performing mutation analyses of selected genes as well as determining copy number profiles of two groups of patients, those whose tumors did or did not have TP53 mutations.

The tumor suppressor gene TP53 has been found mutated in many different malignancies (20), including those arising in the ovaries, at a frequency of 66% in the most aggressive serous carcinomas (21). The rate of TP53 mutation detected in our series was 46% for effusions from HGSC and LGSC. The seeming discrepancy between the frequencies recorded in the present series and in the literature could be due to methodological limitations, see below. In HGSC, we identified two novel sites for TP53 mutation: A deletion of the CCTGT sequence was found in position c.826_830 of case 7 (stage III tumor), whereas a substitution GC>TT in position 475_476GC was identified in case 26 (stage IV tumor). The c.826_830del CCTGT is an out-of-frame change resulting in a frameshift of 26 amino acids (aa) (p. A276fs*26) (Fig. 1) after which a stop codon occurs. The predicted protein would consist of 156 aa. The substitution c.475_476GC>TT results in a change from alanine (A) to phenylalanine (F) (p.A159F). The mutation is at present of unknown pathogenicity in ovarian cancer. However, other mutations on c.475 have been reported as pathogenic in the COSMIC database, e.g., in tumors of the lung and liver (https://cancer.sanger.ac.uk/cosmic). The impact of the new mutation sites in relation to different clinical parameters awaits further studies, ideally of larger series of patients. The two patients here examined had received upfront surgery and standard chemotherapy; case 7 showed a residual disease of 6 cm whereas case 26 had no residual disease at primary operation. Furthermore, both cases showed relatively long survival: Case 7 had 13 months progression-free survival (PFS) and overall survival (OS) of 81 months, whereas case 26 had PFS of 27 months and OS of 45 months.

PIK3CA belongs to the family of genes encoding phosphatidylinositol 3-kinases (PI3Ks). It is activated through the PI3K/AKT signalling pathway in 70% of ovarian cancers, promoting cellular growth, proliferation, and cell survival (22). Somatic mutations of this gene have been detected in different cancer types (23). In ovarian cancer, it occurs in 30% of all tumors, but reaches 45% in EC and CCC (24). We found PIK3CA mutated in 4% of the HGSC effusions examined, which is in line with what is reported in the COSMIC database. Unfortunately, the number of EC and CCC samples was too low to allow statistical conclusions. A number of clinical studies have focused on the PI3K/AKT/mTOR signaling pathway as a therapeutic target for patients with ovarian cancer (25,26); the identification of patients carrying PIK3CA mutation may therefore be important for the choice of therapy. Important to note in this regard is the fact that also other genes of the PI3K/AKT/mTOR signaling pathway should be investigated for their mutation status as they, too, may be involved pathogenetically (26).

KRAS and HRAS are principal members of the RAS family and have frequently been implicated in the development of different types of tumors (27). In ovarian carcinomas, the incidence of KRAS point mutations was found to be 13% (21). Previous studies have demonstrated an association between KRAS mutations and well-differentiated, clinically less advanced cancers (28,29). KRAS mutation was in ovarian serous carcinoma found more frequently in LGSC than in HGSC (30–32).

HRAS mutations are rare in ovarian tumors (33,34). We found an HRAS mutation in only two HGSC: However, our study showed presence of the 81T>C polymorphism in the coding region of HRAS in 38 out of 103 tumors (37%) of all histotypes. The Genome Aggregation Database, gnomAD, reports that SNP 81T>C is a polymorphism seen in 30% of the normal population. Both tumors with HRAS mutation also showed TP53 mutation. In each case, one can hypothesize a scenario in which the mutations represent a primary and a secondary event either in the same cell or in different cells/clones.

Information on effusions from CS arising in the female genital tract is limited to data generated by immunohistochemical techniques (35). This is the first time that mutation analyses have been performed on such metastatic cells. It seems, however, that the genes investigated in the present study are not relevant in cells from effusions since we found only one CS with TP53 mutation.

The mutation rates for the analysed genes in the present study differ slightly from those reported in the literature, something that may be attributable to the molecular methods applied. We used PCR followed by Sanger sequencing. It is known that Sanger sequencing cannot detect mutation if the level of abnormal cells is below 15% (36), whereas next generation sequencing (NGS) or exome sequencing, used in most published studies (37), is more sensitive, i.e., has a higher resolution level. NGS, on the other hand, cannot discriminate between a ‘real’ mutation and a polymorphism. Taking into account these two factors, one would indeed expect higher mutation rates to be detected by NGS compared to Sanger sequencing, as was observed.

aCGH data showed highly imbalanced genomes both in tumors with mutated and wild-type TP53. The genomic regions involved are in agreement with the results of previous studies where primary OC were investigated (38). The ANCA index detected in the TP53 mutated subgroup was 83.2 whereas it was 66.3 in the subgroup with wild-type TP53. The difference between the two groups was not found statistically significant using the Mann-Whitney U test.

The origin of ovarian carcinomas has lately been debated but, according to the latest WHO classification, the majority of HGSC are thought to originate in the tubes whereupon metastatic spreading occurs to the ovaries (39,40). In the light of this concept, it is not surprising that ovarian carcinomas show the same imbalances as do ovarian cancer cells found in effusions, since both represent late evolutionary stages in carcinoma development.

Supplementary Material

Supporting Data

Acknowledgements

The authors wish to thank Miss Margrethe Stoltenberg and Dr Rønnaug A. U. Strandabø, both from the Section for Cancer Cytogenetics, Institute for Cancer Genetics and Informatics, Oslo University Hospital, for technical assistance.

Funding

This work was supported by grants from the South-East Norway Regional Health Authority (Helse Sør-Øst) and Radiumhospitalets Legater.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MB performed molecular experiments and wrote the manuscript. IP participated in performing molecular experiments and interpretation of data. IK participated in performing data analysis. BD provided clinical data and specimens. SH assisted with writing of the article and experimental design. FM designed the study and supervised the writing of the manuscript. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

The ethical approval was granted by the Regional Committee for Medical and Health Research Ethics (REK; http://helseforskning.etikkom.no); for further information, please see this website: http://www.eurecnet.org/information/norway.html.

Patient consent for publication

Consent for publication of data was provided by all patients.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Prat J, D'Angelo E and Espinosa I: Ovarian carcinomas: At least five different diseases with distinct histological features and molecular genetics. Hum Pathol. 80:11–27. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Kurman RJ, Carcangiu ML, Herrington CS and Young RH: WHO classification of tumors of female reproductive organs. IARC. 2014.

4 

D'Angelo E and Prat J: Pathology of mixed Mullerian tumours. Best Pract Res Clin Obstet Gynaecol. 25:705–718. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Davidson B: Ovarian and primary peritoneal carcinoma. Serous Effusions - Etiology, Diagnosis, Prognosis and Therapy. Davidson B, Firat P and Michael CW: Springer; London, UK: pp. 47–68, 167-204. 2011

6 

Piche A: Malignant peritoneal effusion acting as a tumor environment in ovarian cancer progression: Impact and significance. World J Clin Oncol. 9:167–171. 2018. View Article : Google Scholar : PubMed/NCBI

7 

Davidson B: Recently identified drug resistance biomarkers in ovarian cancer. Expert Rev Mol Diagn. 16:569–578. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Davidson B: Biomarkers of drug resistance in ovarian cancer-an update. Expert Rev Mol Diagn. 19:469–476. 2019. View Article : Google Scholar : PubMed/NCBI

9 

Brunetti M, Holth A, Panagopoulos I, Staff AC, Micci F and Davidson B: Expression and clinical role of the dipeptidyl peptidases DPP8 and DPP9 in ovarian carcinoma. Virchows Archiv. 474:177–185. 2019. View Article : Google Scholar : PubMed/NCBI

10 

Davidson B, Stavnes HT, Holth A, Chen X, Yang Y, Shih IeM and Wang TL: Gene expression signatures differentiate ovarian/peritoneal serous carcinoma from breast carcinoma in effusions. J Cell Mol Med. 15:535–544. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Shah RH, Scott SN, Brannon AR, Levine DA, Lin O and Berger MF: Comprehensive mutation profiling by next-generation sequencing of effusion fluids from patients with high-grade serous ovarian carcinoma. Cancer Cytopathol. 123:289–297. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Nagel H, Schulten HJ, Gunawan B, Brinck U and Fuzesi L: The potential value of comparative genomic hybridization analysis in effusion-and fine needle aspiration cytology. Mod Pathol. 15:818–825. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Malcikova J, Tausch E, Rossi D, Sutton LA, Soussi T, Zenz T, Kater AP, Niemann CU, Gonzalez D, Davi F, et al: ERIC recommendations for TP53 mutation analysis in chronic lymphocytic leukemia-update on methodological approaches and results interpretation. Leukemia. 32:1070–1080. 2018. View Article : Google Scholar : PubMed/NCBI

14 

Brunetti M, Agostini A, Staurseth J, Davidson B, Heim S and Micci F: Molecular characterization of carcinosarcomas arising in the uterus and ovaries. Oncotarget. 10:3614–3624. 2019. View Article : Google Scholar : PubMed/NCBI

15 

Tate JG, Bamford S, Jubb HC, Sondka Z, Beare DM, Bindal N, Boutselakis H, Cole CG, Creatore C, Dawson E, et al: COSMIC: The catalogue of somatic mutations in cancer. Nucleic Acids Res. 47:D941–D947. 2019. View Article : Google Scholar : PubMed/NCBI

16 

Olshen AB, Venkatraman ES, Lucito R and Wigler M: Circular binary segmentation for the analysis of array-based DNA copy number data. Biostatistics. 5:557–572. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Ried T, Heselmeyer-Haddad K, Blegen H, Schröck E and Auer G: Genomic changes defining the genesis, progression, and malignancy potential in solid human tumors: A phenotype/genotype correlation. Genes Chromosomes Cancer. 25:195–204. 1999. View Article : Google Scholar : PubMed/NCBI

18 

Micci F, Teixeira MR, Haugom L, Kristensen G, Abeler VM and Heim S: Genomic aberrations in carcinomas of the uterine corpus. Genes Chromosomes Cancer. 40:229–246. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Jackson SE and Chester JD: Personalised cancer medicine. Int J Cancer. 137:262–266. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Zhang W, Edwards A, Flemington EK and Zhang K: Significant prognostic features and patterns of somatic TP53 mutations in human cancers. Cancer Inform. 16:11769351176912672017. View Article : Google Scholar : PubMed/NCBI

21 

simplewww.sanger.ac.uk/genetics/CGP/cosmic

22 

Li H, Zeng J and Shen K: PI3K/AKT/mTOR signaling pathway as a therapeutic target for ovarian cancer. Arch Gynecol Obstet. 290:1067–1078. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Samuels Y and Waldman T: Oncogenic mutations of PIK3CA in human cancers. Curr Top Microbiol Immunol. 347:21–41. 2010.PubMed/NCBI

24 

Campbell IG, Russell SE, Choong DY, Montgomery KG, Ciavarella ML, Hooi CS, Cristiano BE, Pearson RB and Phillips WA: Mutation of the PIK3CA gene in ovarian and breast cancer. Cancer Res. 64:7678–7681. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Mabuchi S, Kuroda H, Takahashi R and Sasano T: The PI3K/AKT/mTOR pathway as a therapeutic target in ovarian cancer. Gynecol Oncol. 137:173–179. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Gasparri ML, Bardhi E, Ruscito I, Papadia A, Farooqi AA, Marchetti C, Bogani G, Ceccacci I, Mueller MD and Benedetti Panici P: PI3K/AKT/mTOR pathway in ovarian cancer treatment: Are we on the right track? Geburtshilfe Frauenheilkd. 77:1095–1103. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Fernández-Medarde A and Santos E: Ras in cancer and developmental diseases. Genes Cancer. 2:344–358. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Nodin B, Zendehrokh N, Sundstrom M and Jirstrom K: Clinicopathological correlates and prognostic significance of KRAS mutation status in a pooled prospective cohort of epithelial ovarian cancer. Diagn Pathol. 8:1062013. View Article : Google Scholar : PubMed/NCBI

29 

Dobrzycka B, Terlikowski SJ, Kowalczuk O, Niklińska W, Chyczewski L and Kulikowski M: Mutations in the KRAS gene in ovarian tumors. Folia Histochem Cytobiol. 47:221–224. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Della Pepa C, Tonini G, Santini D, Losito S, Pisano C, Di Napoli M, Cecere SC, Gargiulo P and Pignata S: Low grade serous ovarian carcinoma: From the molecular characterization to the best therapeutic strategy. Cancer Treat Rev. 41:136–143. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Singer G, Shih Ie M, Truskinovsky A, Umudum H and Kurman RJ: Mutational analysis of K-ras segregates ovarian serous carcinomas into two types: Invasive MPSC (low-grade tumor) and conventional serous carcinoma (high-grade tumor). Int J Gynecol Pathol. 22:37–41. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Singer G, Oldt R III, Cohen Y, Wang BG, Sidransky D, Kurman RJ and Shih IeM: Mutations in BRAF and KRAS characterize the development of low-grade ovarian serous carcinoma. J Natl Cancer Inst. 95:484–486. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Hunter SM, Anglesio MS, Ryland GL, Sharma R, Chiew YE, Rowley SM, Doyle MA, Li J, Gilks CB, Moss P, et al: Molecular profiling of low grade serous ovarian tumours identifies novel candidate driver genes. Oncotarget. 6:37663–37677. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Hollis RL and Gourley C: Genetic and molecular changes in ovarian cancer. Cancer Biol Med. 13:236–247. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Ikeda K, Tate G, Suzuki T and Mitsuya T: Effusion cytodiagnosis of carcinosarcoma derived from the female genital tract: Immunohistochemical features of MMP-7 and Ki-67 and immunofluorescence double staining analyses of eight cases. Gynecol Oncol. 97:323–329. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Rohlin A, Wernersson J, Engwall Y, Wiklund L, Bjork J and Nordling M: Parallel sequencing used in detection of mosaic mutations: Comparison with four diagnostic DNA screening techniques. Hum Mutat. 30:1012–1020. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Salk JJ, Schmitt MW and Loeb LA: Enhancing the accuracy of next-generation sequencing for detecting rare and subclonal mutations. Nat Rev Genet. 19:269–285. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Micci F, Haugom L, Abeler VM, Davidson B, Trope CG and Heim S: Genomic profile of ovarian carcinomas. BMC cancer. 14:3152014. View Article : Google Scholar : PubMed/NCBI

39 

Kim J, Park EY, Kim O, Schilder JM, Coffey DM, Cho CH and Bast RC Jr: Cell origins of high-grade serous ovarian cancer. Cancers (Basel). 10:4332018. View Article : Google Scholar

40 

Lengyel E: Ovarian cancer development and metastasis. Am J Pathol. 177:1053–1064. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Brunetti M, Panagopoulos I, Kostolomov I, Davidson B, Heim S and Micci F: Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer. Oncol Lett 20: 2273-2279, 2020.
APA
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., & Micci, F. (2020). Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer. Oncology Letters, 20, 2273-2279. https://doi.org/10.3892/ol.2020.11782
MLA
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., Micci, F."Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer". Oncology Letters 20.3 (2020): 2273-2279.
Chicago
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., Micci, F."Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer". Oncology Letters 20, no. 3 (2020): 2273-2279. https://doi.org/10.3892/ol.2020.11782
Copy and paste a formatted citation
x
Spandidos Publications style
Brunetti M, Panagopoulos I, Kostolomov I, Davidson B, Heim S and Micci F: Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer. Oncol Lett 20: 2273-2279, 2020.
APA
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., & Micci, F. (2020). Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer. Oncology Letters, 20, 2273-2279. https://doi.org/10.3892/ol.2020.11782
MLA
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., Micci, F."Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer". Oncology Letters 20.3 (2020): 2273-2279.
Chicago
Brunetti, M., Panagopoulos, I., Kostolomov, I., Davidson, B., Heim, S., Micci, F."Mutation analysis and genomic imbalances of cells found in effusion fluids from patients with ovarian cancer". Oncology Letters 20, no. 3 (2020): 2273-2279. https://doi.org/10.3892/ol.2020.11782
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team