Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2021 Volume 22 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2021 Volume 22 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Suppression of circulating AP001429.1 long non‑coding RNA in obese patients with breast cancer

  • Authors:
    • Hani Choudhry
    • Mohammed A. Hassan
    • Abdulrahman L. Al‑Malki
    • Kaltoom A. Al‑Sakkaf
  • View Affiliations / Copyright

    Affiliations: Department of Biochemistry, Faculty of Science, King Abdulaziz University, Jeddah 21589, Kingdom of Saudi Arabia, Department of Medical Laboratory Technology, Faculty of Applied Medical Sciences, King Abdulaziz University, Jeddah 21589, Kingdom of Saudi Arabia
    Copyright: © Choudhry et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 508
    |
    Published online on: May 3, 2021
       https://doi.org/10.3892/ol.2021.12769
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Long non‑coding RNAs (lncRNAs), a type of cellular RNA, play a critical regulatory role in several physiological developments and pathological processes, such as tumorigenesis and tumor progression. Obesity is a risk factor for a number of serious health conditions, including breast cancer (BC). However, the underlying mechanisms behind the association between obesity and increased BC incidence and mortality remain unclear. Several studies have reported changes in lncRNA expression due to obesity and BC, independently encouraging further investigation of the relationship between the two in connection with lncRNAs. The present study was designed to first screen for the expression of 29 selected lncRNAs that showed a link to cancer or obesity in the blood of a selected cohort of 6 obese and 6 non‑obese patients with BC. The expression levels of significantly expressed lncRNAs, AP001429.1, PCAT6, P5549, P19461 and P3134, were further investigated in a larger cohort of 69 patients with BC (36 obese and 33 non‑obese), using reverse transcription‑quantitative polymerase chain reaction. Results showed not only that AP001429.1 remained significantly downregulated in the larger cohort (P=0.002), but also that it was associated with several clinicopathological characteristics, such as negative HER2 status, negative E‑cadherin expression, negative vascular invasion, negative margin invasion and LCIS. These findings suggest that obesity may have a role in inhibiting AP001429.1 expression, which may serve as a novel potential biomarker and therapeutic target for BC.

Introduction

Breast cancer (BC) is the most common type of cancer, having the highest incidence and being the leading cause of death from cancer in women worldwide. Globally, in 2018, more than 2 million cases of BC were newly diagnosed in women, with >625,000 deaths due to this disease. It was also reported that, in 2018, BC accounted for 31.6% of all newly diagnosed cancer cases in women in Saudi Arabia (1). Obesity poses a serious growing public health problem worldwide (2). According to estimates by the World Health Organization (WHO), in 2016, there were ~2 billion overweight adults, of whom >650 million were considered obese (3). In Saudi Arabia, the prevalence of obesity is higher among women than men (4).

Obesity is one of the risk factors of cancer and may be involved with ~20% of several types of cancer, including colorectal, postmenopausal breast, endometrial, renal and prostate cancers (5). Obesity has been reported to be a risk factor in BC, especially in postmenopausal women, and may associate with an increased incidence, a poor prognosis and decreased survival rate (6–8). Focusing on the molecular connection between BC and obesity could provide an important tool for researchers to clarify the underlying mechanisms, which may help identify novel prognostic biomarkers and therapeutic targets for BC.

Long non-coding RNAs (lncRNAs) are a class of untranslated regulatory RNA consisting of >200 nucleotides, which are considered important cellular RNA types that play critical regulatory roles in numerous biological processes, including genomic imprinting, chromatin modeling and post-transcriptional regulation (9); they have also been associated with various human diseases, including a variety of cancer types, such as breast, gastric and colorectal cancers (10,11). Although numerous lncRNAs have differential expression levels that may act as oncogenes or tumor suppressors (12), their biological functions and molecular mechanisms remain largely unknown (13).

Obesity involves profound epigenetic changes and affects the expression level of obesity-associated lncRNAs, which may be involved in cancer initiation and/or progression and affect the outcome of cancer therapy (14). Moreover, the expression levels of several lncRNAs, such as lncRNA P5549 (P5549), lncRNA P19461 (P19461) and lncRNA P3134 (P3134), are differentially expressed in obesity (15). However, the contribution of these lncRNAs to obesity in relation to BC is still unclear. Although several mechanisms have been proposed (16), the molecular association between obesity and BC is still not well understood and remains under investigation (17). Moreover, the role of lncRNAs in obesity-related cancer also remains unclear (16). Therefore, the present study was designed to evaluate the expression level of 29 selected lncRNAs that have previously been linked to cancer or obesity (Table I)(15,16,18–52) in the whole blood of obese patients with BC compared with that in non-obese patients with BC, using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Subsequently, the expression levels of significantly differentially expressed lncRNAs were assayed in a larger cohort and the associations with the baseline and clinicopathological characteristics of the patients were assessed.

Table I.

Selected lncRNAs associated with different cancer types, BC or obesity.

Table I.

Selected lncRNAs associated with different cancer types, BC or obesity.

lncRNAFull nameExpression statusBiological functionsAssociated diseases(Refs.)
AC011891.5lncRNA AC011891.5UpregulatedPositively correlated with BMIObesity(18)
ANRILlncRNA ANRILUpregulatedHomeostatic regulatorSeveral cancer types(16)
B4GALT1-AS1lncRNA B4GALT1-AS1UpregulatedPromotes cancer cell stemness and migrationColon cancer(19)
BCAR4BC anti-estrogen resistance 4UpregulatedInduces cancer cell proliferation and migrationBC(20)
Blnc1lncRNA Blnc1UpregulatedControls adipocyte differentiationEnergy homeostasis(21,22)
CCAT1Colon cancer-associated transcript 1UpregulatedPromotes cancer cell proliferation, migration and invasionCancer cell(23–25)
CCAT2Colon cancer-associated transcript 2UpregulatedPromotes cancer cell proliferation, migration and invasionSeveral carcinomas(26)
H-19H19, imprinted maternally expressed transcriptUpregulatedInhibits adipocyte differentiation and improves insulin sensitivity and mitochondrial biogenesisObesity and numerous cancer types, including BC(16,27)
HOTAIRHOX transcript antisense RNAUpregulatedAbdominal preadipocyte differentiationSeveral cancer types(16)
LINC00968Long intergenic non-protein coding RNA 968UpregulatedPositively correlated with BMIObesity(18)
LINCADLlincRNA adipogenesis- and lipogenesis-associatedUpregulatedRegulates adipocyte differentiation and fatty acid synthesisObesity(28)
MALAT-1 Metastasis-associated lung adenocarcinoma transcript 1UpregulatedPromotes cancer cell proliferation, migration and invasion, and plays a role in tumorigenesis and/or metastasisVarious cancer types(29–31)
NEAT1Nuclear-enriched abundant transcript 1UpregulatedRegulates adipogenic differentiationObesity(32,33)
PANDAR-1Promoter of CDKN1A antisense DNA damage-activated RNA 1UpregulatedInduces cancer cell proliferation, invasion and activation of cell epithelial-mesenchymal transition pathwayGastric cancer(34–36)
PCAT6Prostate cancer-associated ncRNA transcript 6UpregulatedPromotes cancer cell growthNumerous cancer types(37–40)
RP11-20G13.3LincRNA RP11-20G13.3UpregulatedAttenuates adipogenesis of preadipocytesObesity(18)
ZFAS1Zinc finger antisense 1UpregulatedPromotes cancer cell proliferation and metastasisVarious cancer types(41,42)
AP001429.1LncRNA AP001429.1UpregulatedNegatively correlated with BMIObesity(43)
GAS5Growth arrest-specific 5DownregulatedInhibits cancer cell proliferation and promotes apoptosisObesity and numerous types of cancer(44–47)
GYG2P1Glycogenin 2 pseudogene 1DownregulatedNegatively associated with BMI, fasting insulin and triglycerides, and may play a role in the pathogenetic mechanismObesity(18)
MEG3Maternally expressed gene 3DownregulatedInhibits adipogenesisObesity(48)
OLMALINCOligodendrocyte maturation-associated lincRNADownregulatedIncreases expression of lipid metabolism genesObesity(18)
P19461lncRNA P19461DownregulatedNegatively correlated with BMIObesity(15)
P21015lncRNA P21015DownregulatedNegatively correlated with BMIObesity(15)
P5549lncRNA P5549DownregulatedNegatively correlated with BMIObesity(15)
RP11-529H2.1lincRNA RP11-529H2.1DownregulatedNegatively correlated with BMIObesity(18)
RP11-559N14.5lncRNA RP11-559N14.5DownregulatedInvolve in the AMPK signaling pathway, adipocytokine signaling pathway and insulin resistanceObesity(18)
SAR1lncRNA steroid receptor RNA activator 1DownregulatedRegulates adipogenesis and insulin sensitivityObesity(49)
UCA1Urothelial carcinoma-associated 1DownregulatedPromotes cancer cell migration and invasionMultiple cancer types(50–52)

[i] lncRNA, long non-coding RNAs; lincRNA, long intergenic ncRNA; BC, breast cancer; BMI, body mass index.

This study could lead to a better understanding of the expression status of circulating lncRNAs and provide new insights into the lncRNAs involved in the interaction between obesity and BC, which could serve as a potential biomarker in BC prognosis.

Materials and methods

Study subjects

The study included 69 BC female patients who attended between October 2016 and September 2017 the Unit of Mammography, Department of Radiography at King Abdulaziz University Hospital (KAUH; Jeddah, Saudi Arabia), where they were diagnosed with BC. No patient had yet undergone any treatment and patients with recurrent BC were also excluded. Depending on the body mass index (BMI) differentiation (53), the BC patients were categorized as non-obese, which included lean and overweight (BMI <30 kg/m2; n=33), and obese (BMI ≥30 kg/m2; n=36). All patients provided written informed consent. The KAUH Unit of Biomedical Ethics Research Committee approved the study (approval number, HA-02-J-008). The patient information and sociodemographic characteristics were obtained through a standard questionnaire by interview. A standard well-established method was used to collect anthropometric data following WHO recommendations (53). The clinicopathological characteristics and clinical interpretation were provided by the consultants, radiologist and pathologist, as described previously (54,55).

Blood sample collection and storage

According to the manufacturer's instruction, whole blood samples were collected in PAXgene™ blood RNA tubes (Qiagen, Inc.), and then stored at −80°C until being used for RNA extraction.

RNA extraction

Total RNA was isolated from the whole blood of 69 patients with BC using the PAXgene blood RNA kit (Qiagen, Inc.). The quantity and quality of the extracted RNA were verified by DeNovix DS-11 Spectrophotometer (DeNovix, Inc.). The RNA samples were also separated in 1.2% agarose gel electrophoresis to check the quality. The RNA samples were aliquoted and stored at −80°C until being used for complementary DNA (cDNA) synthesis.

Complementary DNA (cDNA) synthesis

Total RNA (400 ng) from each BC sample was reverse transcribed to generate cDNA using a QuantiTect Reverse Transcription (RT) kit (Qiagen, Inc.) following the manufacturer's protocols. The cDNA was stored at −20°C until required.

Quantitative polymerase chain reaction (qPCR)

The gene expression levels of 29 lncRNAs, selected according to a suggested role in cancer or obesity as reported by the literature, including by our previous study (43) (Table I), were evaluated in the blood of obese and non-obese patients with BC by qPCR. Each experiment was run in duplicate in 96-well plates using a Bio-Rad IQ SYBR Green mix and the CFX Connect™ Real-Time PCR Detection system (both Bio-Rad Laboratories, Inc.), according to the manufacturers' protocols and guidelines. The qPCR reactions were carried out as follows: Initial cycle for 30 sec at 95°C; followed by 40 cycles of 15 sec at 98°C, and 30 sec at 60°C. The amplification product was checked at the end of each cycle, and the purity of amplification products was checked by the analysis of melting curves. The lncRNA expression levels were normalized using the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal control for relative expression quantification. The primer pairs of target lncRNAs and reference genes were designed over two different exons using the Primer3 web tool and assessed using the In-Silico PCR tool for human genome assembly GRCh38 (hg38), provided by the University of California, Santa Cruz Genome Browser (http://genome.ucsc.edu/index.html). The sequences of the primers are presented in Table II. The relative expression quantification was calculated using the relative expression software tool (REST 2009) version 2.0.13 (56) and the comparative Cq method (2−ΔΔCq) (57).

Table II.

PCR primer sequences for target lncRNAs and reference genes.

Table II.

PCR primer sequences for target lncRNAs and reference genes.

Gene symbolGene nameGene typeForward primer (5′-3′)Reverse primer (5′-3′)
GAPDH Glyceraldehyde-3-phosphate dehydrogenaseReference TCACCAGGGCTGCTTTTAAC GATGATCTTGAGGCTGTTGTCA
AP001429.1lncRNA AP001429.1Non-coding AATATGACTGGGCCCTGCAA CCGTTGGCCATTTCGTGATT
P5549lncRNA P5549Non-coding CTTTTCCGGCTGAGGTGTTC TGAACCAGCCATCTCTCACA
P21015lncRNA P21015Non-coding ACCCCAGAAGTGACAAGAGG AGATAAACCGCTGCCTTGTG
P19461lncRNA P19461Non-coding CAGCCTCCTCCTGTGATGTA CGTTCTTCTTGTTTGGACCCA
Blnc1lncRNA Blnc1Non-coding CCTTCTCCAACCATCTGCCT CTCTTCCCTCTGCCTCTGAC
SRA1lncRNA steroid receptor RNA activator 1Non-coding GGAGGATGTGCTGAGACCTT CAACTTTCCTCCAGCCCACT
B4GALT1-AS1lncRNA B4GALT1-AS1Non-coding CTAGCCCACCGTCTGTTTTGGCAG GGAAACTAGCCAACCT
LINCADLlincRNA adipogenesis-and lipogenesis-associatedNon-coding ATATGACCCAAGACCAGGCC TCACAGCGAATCACTCCCTT
ANRILlncRNA ANRILNon-coding ACGAAGCTCTACACACTTGAAG GGATCACAGACCATACTTGCAC
RP11-20G13.3lincRNA RP11-20G13.3Non-coding TCTGGAAGGAGTGTCGGTCT CGTGTTCACAGATTGGGAGA
LINC00968long intergenic non-protein coding RNA 968Non-coding ACCATCCCATTGAGAACCAA CGAAAGGCTGGAAGTGTCAT
AC011891.5lncRNA AC011891.5Non-coding CGAAAGGCTGGAAGTGTCAT TGACCCAATTCTGACATTTGC
GYG2P1Glycogenin 2 pseudogene 1Non-coding TCAGCCTCCCAAGTAGCTGT CAGCCTGTGTCTCCTCAGTG
RP11-529H2.1lincRNA RP11-529H2.1Non-coding AGGAGAATGGTGAAGGCAGA TGCCGAAGCAGTTTAATCCT
OLMALINCOligodendrocyte maturation-associated lincRNANon-coding AGACCCAGGACAGGAGGACT ATTGGCAAGATGTTCCTTGG
MALAT1 Metastasis-associated lung adenocarcinoma transcript 1Non-coding GCAGGGAGAATTGCGTCATT TTCTTCGCCTTCCCGTACTT
PCAT6Prostate cancer-associated ncRNA transcript 6Non-coding CTCCATCCTCATTCGGTCCA GAAGGGTGGTGGTAGAAGCA
UCA1Urothelial carcinoma-associated 1Non-coding TTTGCCAGCCTCAGCTTAAT TTGTCCCCATTTTCCATCAT
MEG3Maternally expressed 3Non-coding TCACCTGCTAGCAAACTGGA CATGCTCATTCCAGAAGCCC
CCAT2Colon cancer-associated transcript 2Non-coding ATGAAGGCGTCGTCCAAATG TCAGGCAATTGGTCAGAGGT
BCAR4BC anti-estrogen resistance 4Non-coding CGATGCTTGTCTTGCTCTGA CCGCTTTTTCGTATCACTCC
CCAT1Colon cancer-associated transcript 1Non-coding TTGCTCACCTTACTGCCTGA CCTGCAACTAGACACTCCCA
PANDARPromoter of CDKN1A antisense DNA damage-activated RNA 1Non-coding TTGTAGCTCCTCCCATGTCG AGGAACAGGCAATGGGATCA
HOTAIRHOX transcript antisense RNANon-coding GAGTTCCACAGACCAACACC AATCCGTTCCATTCCACTGC
NEAT1Nuclear-enriched abundant transcript 1Non-coding CCAGTGTGAGTCCTAGCATTGC CCTGGAAACAGAACATTGGAGAAC
GAS5Growth arrest-specific 5Non-coding CCCAAGGAAGGATGAGAATAGC CTGTCTAATGCCTGTGTGCC
H19H19 imprinted maternally expressed transcriptNon-coding ATCCGGACACAAAACCCTCT AGAGCCGATTCCTGAGTCAG
ZFAS1ZNFX1 antisense RNA1Non-coding AAGCCACGTGCAGACATCTAC CTACTTCCAACACCCGCATTCA
P3134lncRNA P3134Non-coding GTGGTGAGATCTCGGGGAAA GTGCCAGAATTTCCTCACCC

[i] lncRNA, long non-coding RNAs; lincRNA, long intergenic ncRNA.

Statistical analysis

GraphPad Prism version 8.0.1 (GraphPad Software) was used to evaluate the statistical analyses of the obtained data using an unpaired, two-tailed t-test to determine the significant differences in the gene expression between groups. Moreover, χ2 and Kruskal-Wallis tests (one-way ANOVA) with a two-tailed P-value were used to test the distribution of categorical baseline and clinicopathological characteristics between obese and non-obese patients with BC. P≤0.05 was used to indicate a statistically significant difference. Bonferroni's correction was applied and the corrected P-value of ≤0.05 used for multiple comparisons of AP001429.1 expression level and patient baseline and clinicopathological characterizations. The data are presented as the mean ± standard error of the mean (SEM). Receiver operating characteristic (ROC) curves were generated to evaluate the sensitivity and specificity of AP001429.1 as a potential biomarker, using its gene expression values (2−ΔCq) of obese and non-obese patients with BC in the easyROC web-tool (ver.1.3.1; http://www.biosoft.hacettepe.edu.tr/easyROC/).

Results

General and clinicopathological characterization of the studied patients

The study cohort consisted of 69 newly diagnosed female patients with BC. The mean age ± SEM of the patients at the time of diagnosis was 52.3±1.51 (age range, 29–80 years). Over half (50.7%) were <50 years old, of which 29.0% were between 41 and 50 years old. The mean BMI ± SEM of the patients was 30.0±0.67 kg/m2; 52.2% of the patients were obese at the time of diagnosis and 47.8% were not obese, with a mean BMI ± SEM of 33.9±0.74 and 25.8±0.51 kg/m2, respectively (Table III).

Table III.

Baseline characteristics of studied patients with BC.

Table III.

Baseline characteristics of studied patients with BC.

ParametersTotalNon-obese BCObese BC
Number of patients, n (%)69 (100.0)33 (47.8)36 (52.2)
Age, yearsa52.3±1.5146.5±1.5557.5±2.20
BMI, kg/m2a30.0±0.6725.8±0.5133.9±0.74
Waist circumference, cma90.2±2.8487.1±4.5693.1±3.48
Hip circumference, cma104.5±2.94101.8±4.51106.9±3.84
W/H ratioa0.87±0.010.85±0.020.88±0.01
Age of first menstruation, yearsa13.36±0.1613.22±0.2313.49±0.23
Age since menopause, yearsa50.30±0.8948.37±1.2051.43±1.20
Age of first pregnancy, yearsa22.37±0.5422.10±0.7922.62±0.76

a Data presented as mean ± SEM. BC, breast cancer; BMI, body mass index; W/H, waist/hip ratio.

Overall, 84.1% of the patients were married with three children or less, 46.4% had experienced a miscarriage and 81.1% were breastfeeding mothers. The mean age of first pregnancy was 22.7±0.65 years. A total of 40 patients had reached menopause at the time of diagnosis, with a mean age ± SEM 49.9±0.99 years, while the first appearance of menstruation for most patients was at a mean age ± SEM of 13.41±0.19 years, with only 5.8% experiencing first menstruation when <12 years of age. Most patients did not have any family history of BC or other cancer types, nor polycystic fibrosis or diabetes mellitus. In total, 92.8% of the patients were non-smokers, of which 33.3% performed physical activity. Moreover, most of the patients (75.4%) did not have diet rich in fat, and a few of the patients (18.8%) took omega-3 supplements (Table IV).

Table IV.

Distribution of general information characteristics of the studied patients with BC.

Table IV.

Distribution of general information characteristics of the studied patients with BC.

CategoriesTotal, n (%)Non-obese BC, n (%)Obese BC, n (%)P-value
Patients69 (100)33 (47.8)36 (52.2)
Age of patients, years 0.004
  ≤4015 (21.7)10 (66.7)5 (33.3)
  41-6038 (55.1)21 (55.3)17 (44.7)
  >6016 (23.2)2 (12.5)14 (87.5)
Marital status 0.56
  Single7 (10.1)2 (28.6)5 (71.4)
  Married58 (84.1)29 (50.0)29 (50.0)
  Divorced4 (5.8)2 (50.0)2 (50.0)
Education level 0.45
  Illiterate19 (27.5)7 (36.8)12 (63.2)
  School25 (36.2)12 (48.0)13 (52.0)
  First and higher degree25 (36.2)14 (56.0)11 (44.0)
Nationality 0.57
  Saudi38 (55.1)17 (44.7)21 (55.3)
  Non-Saudi31 (44.9)16 (51.6)15 (48.4)
Age of first menstruation, years 0.53
  <124 (5.8)3 (75.0)1 (25.0)
  12-1561 (88.4)28 (45.9)33 (54.1)
  >154 (5.8)2 (50.0)2 (50.0)
Menopausal status 0.003
  Postmenopausal40 (58.0)13 (32.5)27 (67.5)
  Premenopausal29 (42.0)20 (69.0)9 (31.0)
Age of menopause, years 0.44
  <483 (7.5)0 (0.0)3 (100.0)
  48-5532 (80.0)11 (34.4)21 (65.6)
  >555 (12.5)2 (40.0)3 (60.0)
Hormone replacement therapy 0.17
  Yes2 (2.9)0 (0.0)2 (100.0)
  No67 (97.1)33 (49.3)34 (50.7)
Number of children 0.14
  None8 (11.6)2 (25.0)6 (75.0)
  ≤331 (44.9)19 (61.3)12 (38.7)
  4-618 (26.1)6 (33.3)12 (66.7)
  >612 (17.4)6 (50.0)6 (50.0)
Number of miscarriages 0.48
  None27 (39.1)14 (51.9)13 (48.1)
  1 or 224 (34.8)13 (54.2)11 (45.8)
  ≥38 (11.6)2 (25.0)6 (75.0)
  No answer10 (14.5)4 (40.0)6 (60.0)
Age of pregnancy, years 0.79
  ≤2022 (36.1)12 (54.5)10 (45.5)
  21-3034 (55.7)16 (47.1)18 (52.9)
  >305 (8.2)3 (60.0)2 (40.0)
Breast feeding 0.45
  Never13 (18.8)5 (38.5)8 (61.5)
  Yes56 (81.2)28 (50.0)28 (50.0)
Family history of BC 0.89
  Yes13 (18.8)6 (46.2)7 (53.8)
  No56 (81.2)27 (48.2)29 (51.8)
Family history of other cancer 0.89
  Yes13 (18.8)6 (46.2)7 (53.8)
  No56 (81.2)27 (48.2)29 (51.8)
Polycystic fibrosis status 0.35
  Yes9 (13.0)3 (33.3)6 (66.7)
  No60 (87.0)30 (50.0)30 (50.0)
Diabetes mellitus status 0.92
  Yes15 (21.7)7 (46.7)8 (53.3)
  No54 (78.3)26 (48.1)28 (51.9)
Physical activities performance 0.31
  Yes23 (33.3)13 (56.5)10 (43.5)
  No46 (66.7)20 (43.5)26 (56.5)
Smoking status 0.2
  Yes5 (7.2)1 (20.0)4 (80.0)
  No64 (92.8)32 (50.0)32 (50.0)
Omega-3 supplements 0.17
  Yes13 (18.8)4 (30.8)9 (69.2)
  No56 (81.2)29 (51.8)27 (48.2)
Diet rich in fat 0.23
  Yes17 (24.6)6 (35.3)11 (64.7)
  No52 (75.4)27 (51.9)25 (48.1)

[i] BC, breast cancer.

Regarding the clinicopathological features (Table V), the majority of the patients (76.8%) had invasive ductal carcinoma, 7.2% had invasive lobular carcinoma and 10.1% were diagnosed with an invasive mixture of ductal and lobular carcinoma. Approximately 56.5% of the patients had grade II tumors, 53.6% had tumor size <2 cm, and 43.5% had negative lymph node involvement. Based on the hormone receptor phenotypes, 71.0% of the patients had a luminal BC subtype (ER+/PR+/HER2−): 69.6% ER+, 56.5% PR+ and 59.4% HER2−. By contrast, HER2+ was only found in 34.8% of the patients. Therefore, the ER+/PR+/HER2− phenotype was the most abundant in the patient cohort.

Table V.

Distribution of clinicopathological features of the studied patients with BC.

Table V.

Distribution of clinicopathological features of the studied patients with BC.

CategoriesTotal, n (%)Non-obese BC, n (%)Obese BC, n (%)P-value
Patients69 (100)33 (47.8)36 (52.2)
Hormone receptor phenotype 0.28
  Luminal49 (71.0)25 (51.0)24 (49.0)
  HER2-enriched10 (14.5)5 (50.0)5 (50.0)
  Triple negative/basal like6 (8.7)1 (16.7)5 (83.3)
  Unknown4 (5.8)2 (50.0)2 (50.0)
ER status 0.53
  ER−17 (24.6)7 (41.2)10 (58.8)
  ER+48 (69.6)24 (50.0)24 (50.0)
  Unknown4 (5.8)2 (50.0)2 (50.0)
PR status 0.08
  PR−26 (37.7)9 (34.6)17 (65.4)
  PR+39 (56.5)22 (56.4)17 (43.6)
  Unknown4 (5.8)2 (50.0)2 (50.0)
HER2 status 0.19
  HER2−41 (59.4)17 (41.5)24 (58.5)
  HER2+24 (34.8)14 (58.3)10 (41.7)
  Unknown4 (5.8)2 (50.0)2 (50.0)
Lymph node involvement 0.67
  Negative30 (43.5)12 (40.0)18 (60.0)
  Positive15 (21.7)7 (46.7)8 (53.3)
  Unknown24 (34.8)14 (58.3)10 (41.7)
Size of tumor, cm 0.69
  <237 (53.6)17 (45.9)20 (54.1)
  2-522 (31.9)9 (40.9)13 (59.1)
  >53 (4.3)2 (66.7)1 (33.3)
  Unknown7 (10.1)5 (71.4)2 (28.6)
Tumor grade 0.37
  I8 (11.6)4 (50.0)4 (50.0)
  II39 (56.5)16 (41.0)23 (59.0)
  III18 (26.1)11 (61.1)7 (38.9)
  Unknown4 (5.8)2 (50.0)2 (50.0)
Histotype 0.32
  DCIS53 (76.8)23 (43.4)30 (56.6)
  LCIS5 (7.2)3 (60.0)2 (40.0)
  Mixture of ductal and lobular7 (10.1)5 (71.4)2 (28.6)
  Unknown4 (5.8)2 (50.0)2 (50.0)
Vascular invasion 0.28
  Negative42 (60.9)19 (45.2)23 (54.8)
  Positive11 (15.9)3 (27.3)8 (72.7)
  Unknown16 (23.2)11 (68.8)5 (31.3)
Margin 0.40
  Negative41 (59.4)17 (41.5)24 (58.5)
  Positive1 (3.6)0 (0.0)1 (100.0)
  Unknown27 (39.1)16 (59.3)11 (40.7)

[i] BC, breast cancer; DCIS, ductal carcinoma in situ; ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; LCIS, lobular carcinoma in situ; PR, progesterone receptor.

The non-obese and obese BC groups were significantly different in terms of age and menopausal status (P=0.003); however, the results did not show any significant differences with regard to other general and clinicopathological characteristics (Tables IV and V).

Screening of lncRNAs in a selected cohort of obese versus non-obese BC patients

The gene expression levels of the 29 selected lncRNAs were initially measured in a selected cohort of BC patients, based on the greatest BMI differentiation: 6 obese patients with the highest BMI and 6 non-obese BC patients with the lowest BMI were selected from the overall BC patient cohort. The amplification products for lncRNAs and GAPDH were specific and pure in all samples as assessed by melting curve analysis and across the threshold within 30 cycles.

The expression level of lncRNAs in a selected cohort of obese compared with non-obese patients with BC is shown in Fig. 1. Among all selected lncRNAs, P5549, P19461, PCAT6, AP001429.1 and P3134 were significantly differentially expressed. The expression levels of circulating PCAT6, P19461 and P3134 were significantly upregulated [fold-change (FC), 2.526 and P≤0.02; FC, 1.361 and P≤0.008; and FC, 1.5 and P=0.05, respectively], whereas P5549 and AP001429.1 showed a significant decrease in expression within the same group of obese BC patients (FC, 0.56 and P=0.05; and FC, 0.6 and P=0.02, respectively). The rest of the studied lncRNAs did not show any significant differences in expression between the groups (Fig. 1).

Figure 1.

Relative expression fold of long non-coding RNAs in a selected cohort of obese compared with non-obese patients with BC. Gene expression was detected by reverse transcription-quantitative PCR and normalized according to GAPDH expression. Error bars represent SEM. *P≤0.05 and **P<0.01. BC, breast cancer.

Evaluation of lncRNA expression in a larger cohort of obese and non-obese BC patients

The gene expression levels of the significantly differentially expressed identified lncRNAs, (P5549, P19461, P3134, PCAT6 and AP001429.1) were evaluated in a larger cohort consisting of the study population of 36 obese and 33 non-obese BC patients, as shown in Fig. 2. Among these evaluated lncRNAs, AP001429.1 was significantly downregulated in obese compared with non-obese patients with BC (FC, 0.5; P=0.002). By contrast, P5549 (FC, 1.0; P=0.97), P19461 (FC, 1.1; P=0.56), P3134 (FC, 1.2; P=0.12) and PCAT6 (FC, 1.0; P=0.94) were not found to exhibit any significant differences in expression within the larger group of patients (Fig. 2).

Figure 2.

Long non-coding RNA relative expression fold in a larger cohort of obese compared with non-obese patients with BC. Gene expression was detected by reverse transcription-quantitative PCR and normalized according to GAPDH expression. Error bars represent SEM. **P<0.01. BC, breast cancer.

To evaluate AP001429.1 as a potential biomarker, a ROC curve was generated using the gene expression values of AP001429.1 in obese and non-obese BC patients. In the ROC curve analysis (Fig. 3 and Table SI), the area under the ROC curve was 0.684 (nearly 0.7), indicating that AP001429.1 expression enabled weak but significant differentiation of patients with BC based on obesity status (P=0.004) (58). Therefore, AP001429.1 may act as a potential biomarker in obese patients with BC.

Figure 3.

Receiver operating characteristic curve for the gene expression of AP001429.1, a suggested potential biomarker in obese patients with breast cancer.

Association between AP001429.1 expression level and patient baseline characteristics

Differential expression patterns in AP001429.1 were observed when assessing the association with patient baseline features (Table SII). Significant differences in AP001429.1 expression with regard to patient baseline characteristics were assessed by Bonferroni's correction (P≤0.05) and are presented in Fig. 4. Significant decreases in AP001429.1 expression were detected in obese patients with BC who were at middle-aged (FC, 0.4; P=0.03), married (FC, 0.4; P=0.006), Saudi national (FC, 0.5; P=0.02) and patients who had low education level (FC, 0.2; P<0.0003). AP001429.1 also showed significant downregulation in relation to premenopausal obese BC patients (FC, 0.3; P=0.002), in those who were breastfeeding their children (FC, 0.4; P<0.001) and in those who experienced their first menstruation event between 12 and 15 years old (FC, 0.5; P=0.01) or had their first pregnancy aged between 21 and 30 (FC, 0.4; P=0.03). Moreover, the non-smoking obese BC patients, those who did not take omega-3 supplements and those who performed physical activity also showed a significantly decreased expression level of AP001429.1 (FC, 0.6 and P=0.01; FC, 0.5 and P=0.02; and FC, 0.2 and P<0.001, respectively). Furthermore, AP001429.1 showed significant downregulation in relation to diabetic obese patients with BC, as well as those who did not have hormone replacement therapy, those who did not have any family history of BC, other cancer types or polycystic fibrosis (FC, 0.2 and P<0.001; FC, 0.5 and P=0.01; FC, 0.4 and P=0.004; and FC, 0.5 and P=0.01, respectively). Moreover, the significantly decreased expression of AP001429.1 was also detected in obese patients with BC who had 4 to 6 children (FC, 0.2; P=0.03) and those who had miscarriages once or twice (FC, 0.4; P=0.03) (Fig. 4).

Figure 4.

Relative expression fold of AP001429.1 and its association with patient baseline characteristics within obese patients with BC compared with the same categories in non-obese patients with BC. Gene expression was detected by reverse transcription-quantitative-PCR and normalized according to GAPDH expression. Error bars represent SEM. The significance level is presented as assessed by Bonferroni's correction. *P≤0.05, **P<0.01 and ***P<0.001. BC, breast cancer.

Association between AP001429.1 expression level and patient clinicopathological characteristics

Associations in the expression levels of AP001429.1 in obese patients with BC compared with that in non-obese patients with BC were assessed with regard to patient clinicopathological characteristics (Table SIII). Significant differences in AP001429.1 expression with regard to patient clinicopathological characteristics were assessed by Bonferroni's correction (P≤0.05) and are presented in Fig. 5. AP001429.1 exhibited a significantly lower expression level in obese patients compared with that in non-obese patients with BC; however, the significantly decreased expression was detected with regard to negative HER2 status (FC, 0.4; P=0.02), negative E-cadherin expression (FC, 0.1; P<0.001), negative vascular invasion (FC, 0.4; P=0.004), negative margin invasion (FC, 0.5; P=0.02) and LCIS (FC, 0.2; P<0.001) BC patients. By contrast, a high expression level of AP001429.1 was only detected in relation to positive E-cadherin expression (FC, 5.3; P=0.04) within the obese patients with BC (Fig. 5).

Figure 5.

Relative expression fold of AP001429.1 and its association with patient clinicopathological parameters in obese patients with BC compared with the same categories in non-obese patients with BC. Gene expression was detected by reverse transcription-quantitative PCR and normalized according to GAPDH expression. Error bars represent SEM. The significance level is presented as assessed by Bonferroni's correction. *P≤0.05, **P<0.01 and ***P<0.001. BC, breast cancer; DCIS, ductal carcinoma in situ; LCIS, lobular carcinoma in situ.

Discussion

lncRNA, as a class of untranslated regulatory RNA, is considered an important type of cellular RNA that plays a critical regulatory role in a number of biological processes in normal development, as well as in tumorigenesis and tumor progression processes (59). lncRNA is regarded as a key regulator of diseases with tissue specificity (60). lncRNA controls the flux of genetic information modulating various cellular processes, such as modulation of chromosome structure, transcription, splicing, mRNA stability and availability, post-translational modifications (61) and epigenetic mechanisms (62). Obesity involves profound epigenetic changes and affects the expression of obesity-associated lncRNAs that may be involved in cancer initiation and/or progression and affect cancer therapy. To the best of our knowledge, the approach of the present study comparing differences between obese and non-obese patients with BC has so far not been applied. Previous studies investigated healthy non-obese versus obese patients (15,16,44,63,64) as well as healthy control cases versus patients with BC (65–68). Therefore, in the present study, lncRNA expression levels were evaluated in whole blood taken from BC patients by liquid biopsy, with obese patients being compared with non-obese patients, aiming to determine the expression status of lncRNAs in obese patients with BC and their associations with the general and clinicopathological attributes of the patients.

AP001429.1 is also known as novel transcript sense intronic lncRNA to tetratricopeptide repeat domain 3; it is located on the long arm of chromosome 21 (21q22.13) and is 530 nucleotides in length (69). Very limited information is available on the expression and biological functions of AP001429.1; however, its mRNA expression has been detected in a number of normal human tissues and cells, including whole blood, brain, cerebellum, endometrium, heart, ovary and testis (69). Furthermore, according to the RNAcentral resource (70) and the LncBase database (71), AP001429.1 is targeted by several miRNAs; notably, a number of AP001429.1-targeted miRNAs are downregulated and reported to have roles as tumor suppressors in BC, such as miR-124-3p (72), miR-196b-5p (73), the miR-34-5p family (74,75), miR-449b-5p (76), miR-940 (77) and miR-99a-3p (78,79). In addition, miR-196a-5p and miR-449a were upregulated and reported to be involved in oncogenesis in BC (80,81), suggesting that AP001429.1 may function as a potential tumor suppressor in BC by targeting those miRNAs. The present study showed that AP001429.1 was significantly downregulated in obese patients with BC compared with non-obese patients with BC. A significant decrease in AP001429.1 expression was detected in obese patients with BC who were middle-aged, premenopausal, married, had 4 to 6 children and who breastfed their newborn. Moreover, in the BC patient cohort, non-smoking status, performance of a physical activity, diabetes, the absence of hormone replacement therapy and the absence of a family history of cancer or polycystic fibrosis, was also associated with a significant decrease in the expression level of AP001429.1 (Fig. 3 and Table SII). Moreover, a significant association was also detected with regard to certain molecular and histological characteristic, including negative HER2 status, negative E-cadherin expression, negative vascular and margin invasion, and LCIS. Obese patients with BC also exhibited downregulation of AP001429.1 compared with non-obese patients with BC (Fig. 4 and Table SIII). The exact reasoning behind the significant associations with regard to these parameters is not clear.

Numerous lncRNAs have been detected as differentially expressed in different cells and tissues associated with cancer and/or obesity (82). Moreover, the differential expression of lncRNAs may contribute to the initiation, development, invasion and metastasis of various types of cancer, including BC, as well as obesity development, brown adipocyte differentiation and the function of adipose tissue (83), through both activation and inhibition of the expression of other genes (84) that could affect various cancer-related physiological processes (85). Therefore, lncRNAs may serve as BC prognostic and diagnostic biomarkers as well as being useful as therapeutic targets for BC treatments. Despite the existence of studies considering lncRNAs in BC, there is still an urgent need for more studies focusing on the role of lncRNAs in BC with obesity in order to provide a better understanding of their involvement and offer new insights into the role of lncRNAs in obesity-related BC.

In conclusion, the present results demonstrated the downregulation of AP001429.1 in obese patients with BC, suggesting that obesity may have a role in inhibiting the expression of AP001429.1, which could be considered as a potential tumor suppressor of BC. This information may help improve our understanding and provide an important research tool with regard to the molecular associations between obesity and BC. Therefore, the expression of AP001429.1 could serve as a potential biomarker for BC prognosis and a target for therapy. Further study is needed to confirm these findings and elucidate the underlying mechanism for the effects of AP001429.1 with regard to connections between obesity and BC.

The current study has certain limitations, including the small sample size, which needs to be increased to confirm and validate the findings. Further control cross-sectional studies using healthy obese and non-obese patients with an increase in sample size will be conducted in the near future. Finally, further investigation is required to elucidate the expression profile and functional role of AP001429.1 in BC tissue.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This project was funded by the Deanship of Scientific Research (DSR) at King Abdulaziz University (KAU) Jeddah, Kingdom of Saudi Arabia (grant no. G: 638/130/1438).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

MAH, HC, KAAS and ALAM designed and coordinated the experiments. KAAS obtained the ethical approval, patients' consent and blood samples. MAH performed the experiments and analyzed the data. HC contributed to laboratory facilitates and project funding. MAH wrote the original manuscript draft. KAAS and HC edited the manuscript. HC, MAH and KAAS confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was approved by the Unit of Biomedical Ethics Research Committee, KAUH (approval no. HA-02-J-008). All patients signed a consent form to engage in this study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare no that they have no competing interests.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Smith KB and Smith MS: Obesity statistics. Prim Care. 43:121–135. 2016. View Article : Google Scholar : PubMed/NCBI

3 

WHO, . Obesity and overweight. https://www.who.int/en/news-room/fact-sheets/detail/obesity-and-overweightDecember 15–2020

4 

Memish ZA, El Bcheraoui C, Tuffaha M, Robinson M, Daoud F, Jaber S, Mikhitarian S, Al Saeedi M, AlMazroa MA, Mokdad AH and Al Rabeeah AA: Obesity and associated factors-Kingdom of Saudi Arabia, 2013. Prev Chronic Dis. 11:E1742014. View Article : Google Scholar : PubMed/NCBI

5 

De Pergola G and Silvestris F: Obesity as a major risk factor for cancer. J Obes. 2013:2915462013. View Article : Google Scholar : PubMed/NCBI

6 

Argolo DF, Hudis CA and Iyengar NM: The impact of obesity on breast cancer. Curr Oncol Rep. 20:472018. View Article : Google Scholar : PubMed/NCBI

7 

Iyengar NM, Hudis CA and Dannenberg AJ: Obesity and cancer: Local and systemic mechanisms. Annu Rev Med. 66:297–309. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Chan DS and Norat T: Obesity and breast cancer: Not only a risk factor of the disease. Curr Treat Options Oncol. 16:222015. View Article : Google Scholar : PubMed/NCBI

9 

Wang J, Zhang X, Chen W, Hu X, Li J and Liu C: Regulatory roles of long noncoding RNAs implicated in cancer hallmarks. Int J Cancer. 146:906–916. 2020. View Article : Google Scholar : PubMed/NCBI

10 

Zhao H, Shi J, Zhang Y, Xie A, Yu L, Zhang C, Lei J, Xu H, Leng Z, Li T, et al: LncTarD: A manually-curated database of experimentally-supported functional lncRNA-target regulations in human diseases. Nucleic Acids Res. 48:D118–D126. 2019.PubMed/NCBI

11 

Li Z, Zhao W, Wang M and Zhou X: The Role of Long Noncoding RNAs in Gene Expression Regulation. Gene Expression Profiling in Cancer IntechOpen London, UK: 2019, View Article : Google Scholar

12 

Zhuang C, Ma Q, Zhuang C, Ye J, Zhang F and Gui Y: LncRNA GClnc1 promotes proliferation and invasion of bladder cancer through activation of MYC. FASEB J. 33:11045–11059. 2019. View Article : Google Scholar : PubMed/NCBI

13 

Li Y, Yang X, Kang X and Liu S: The regulatory roles of long noncoding RNAs in the biological behavior of pancreatic cancer. Saudi J Gastroenterol. 25:145–151. 2019. View Article : Google Scholar : PubMed/NCBI

14 

Rohde K, Keller M, la Cour Poulsen L, Blüher M, Kovacs P and Böttcher Y: Genetics and epigenetics in obesity. Metabolism. 92:37–50. 2019. View Article : Google Scholar : PubMed/NCBI

15 

Sun J, Ruan Y, Wang M, Chen R, Yu N, Sun L, Liu T and Chen H: Differentially expressed circulating LncRNAs and mRNA identified by microarray analysis in obese patients. Sci Rep. 6:354212016. View Article : Google Scholar : PubMed/NCBI

16 

Yau MY, Xu L, Huang CL and Wong CM: Long non-coding RNAs in obesity-induced cancer. Noncoding RNA. 4:192018.PubMed/NCBI

17 

Zeng J, Sauter ER and Li B: FABP4: A new player in obesity-associated breast cancer. Trends Mol Med. 26:437–440. 2020. View Article : Google Scholar : PubMed/NCBI

18 

Liu Y, Ji Y, Li M, Wang M, Yi X, Yin C, Wang S, Zhang M, Zhao Z and Xiao Y: Integrated analysis of long noncoding RNA and mRNA expression profile in children with obesity by microarray analysis. Sci Rep. 8:87502018. View Article : Google Scholar : PubMed/NCBI

19 

Zhang Y, Fang ZX, Guo X, Dong H, Zhou K, Huang Z and Xiao Z: lncRNA B4GALT1-AS1 promotes colon cancer cell stemness and migration by recruiting YAP to the nucleus and enhancing YAP transcriptional activity. J Cell Physiol. 234:18524–18534. 2019. View Article : Google Scholar : PubMed/NCBI

20 

Ouyang S, Zhou X, Chen Z, Wang M, Zheng X and Xie M: LncRNA BCAR4, targeting to miR-665/STAT3 signaling, maintains cancer stem cells stemness and promotes tumorigenicity in colorectal cancer. Cancer Cell Int. 19:722019. View Article : Google Scholar : PubMed/NCBI

21 

Mi L, Zhao XY, Li S, Yang G and Lin JD: Conserved function of the long noncoding RNA Blnc1 in brown adipocyte differentiation. Mol Metab. 6:101–110. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Sun L and Lin JD: Function and mechanism of long noncoding RNAs in adipocyte biology. Diabetes. 68:887–896. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Li GH, Ma ZH and Wang X: Long non-coding RNA CCAT1 is a prognostic biomarker for the progression of oral squamous cell carcinoma via miR-181a-mediated Wnt/β-catenin signaling pathway. Cell Cycle. 18:2902–2913. 2019. View Article : Google Scholar : PubMed/NCBI

24 

Hu M, Zhang Q, Tian XH, Wang JL, Niu YX and Li G: lncRNA CCAT1 is a biomarker for the proliferation and drug resistance of esophageal cancer via the miR-143/PLK1/BUBR1 axis. Mol Carcinog. 58:2207–2217. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Li Y, Zhu G, Ma Y and Qu H: lncRNA CCAT1 contributes to the growth and invasion of gastric cancer via targeting miR-219-1. J Cell Biochem. 120:19457–19468. 2019. View Article : Google Scholar : PubMed/NCBI

26 

Cai Y, He J and Zhang D: Long noncoding RNA CCAT2 promotes breast tumor growth by regulating the Wnt signaling pathway. Onco Targets Ther. 8:2657–2664. 2015.PubMed/NCBI

27 

Schmidt E, Dhaouadi I, Gaziano I, Oliverio M, Klemm P, Awazawa M, Mitterer G, Fernandez-Rebollo E, Pradas-Juni M, Wagner W, et al: LincRNA H19 protects from dietary obesity by constraining expression of monoallelic genes in brown fat. Nat Commun. 9:36222018. View Article : Google Scholar : PubMed/NCBI

28 

Zhang X, Xue CY, Line J, Ferguson JF, Weiner A, Liu W, Han Y, Hinkle C, Li W, Jiang H, et al: Interrogation of nonconserved human adipose lincRNAs identifies a regulatory role of linc-ADAL in adipocyte metabolism. Sci Transl Med. 10:eaar59872018. View Article : Google Scholar : PubMed/NCBI

29 

Kong X, Wang J, Cao Y, Zhang H, Lu X, Wang Y, Bo C, Wang T, Li S, Tian K, et al: The long noncoding RNA MALAT-1 functions as a competing endogenous RNA to regulate MSL2 expression by sponging miR-338-3p in myasthenia gravis. J Cell Biochem. 120:5542–5550. 2019. View Article : Google Scholar : PubMed/NCBI

30 

Han X, Xu Z, Tian G, Tang Z, Gao J, Wei Y and Xu X: Suppression of the long non-coding RNA MALAT-1 impairs the growth and migration of human tongue squamous cell carcinoma SCC4 cells. Arch Med Sci. 15:992–1000. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al: The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 39:925–938. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Gernapudi R, Wolfson B, Zhang Y, Yao Y, Yang P, Asahara H and Zhou Q: MicroRNA 140 promotes expression of long noncoding RNA NEAT1 in adipogenesis. Mol Cell Biol. 36:30–38. 2015.PubMed/NCBI

33 

Cooper DR, Carter G, Li P, Patel R, Watson JE and Patel NA: Long non-coding RNA NEAT1 associates with SRp40 to temporally regulate PPARγ2 splicing during adipogenesis in 3T3-L1 cells. Genes (Basel). 5:1050–1063. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Li Y, Su X and Pan H: Inhibition of lncRNA PANDAR reduces cell proliferation, cell invasion and suppresses EMT pathway in breast cancer. Cancer Biomark. 25:185–192. 2019. View Article : Google Scholar : PubMed/NCBI

35 

Liu J, Ben Q, Lu E, He X, Yang X, Ma J, Zhang W, Wang Z, Liu T, Zhang J and Wang H: Long noncoding RNA PANDAR blocks CDKN1A gene transcription by competitive interaction with p53 protein in gastric cancer. Cell Death Dis. 9:1682018. View Article : Google Scholar : PubMed/NCBI

36 

Wang H, Fang L, Jiang J, Kuang Y, Wang B, Shang X, Han P, Li Y, Liu M, Zhang Z and Li P: The cisplatin-induced lncRNA PANDAR dictates the chemoresistance of ovarian cancer via regulating SFRS2-mediated p53 phosphorylation. Cell Death Dis. 9:11032018. View Article : Google Scholar : PubMed/NCBI

37 

Xin Y, He X, Zhao W, Zhan M, Li Y, Xiao J, He K and Lu L: LncRNA PCAT6 increased cholangiocarcinoma cell proliferation and invasion via modulating miR-330-5p. Am J Transl Res. 11:6185–6195. 2019.PubMed/NCBI

38 

Wu H, Zou Q, He H, Liang Y, Lei M, Zhou Q, Fan D and Shen L: Long non-coding RNA PCAT6 targets miR-204 to modulate the chemoresistance of colorectal cancer cells to 5-fluorouracil-based treatment through HMGA2 signaling. Cancer Med. 8:2484–2495. 2019. View Article : Google Scholar : PubMed/NCBI

39 

Huang WM, Su G, Huang XX, Zou A, Wu J, Yang Y, Zhu Y, Liang S, Li D, Ma F and Guo L: Long noncoding RNA PCAT6 inhibits colon cancer cell apoptosis by regulating anti-apoptotic protein ARC expression via EZH2. Cell Cycle. 18:69–83. 2019. View Article : Google Scholar : PubMed/NCBI

40 

Dong F, Ruan S, Wang J, Xia Y, Le K, Xiao X, Hu T and Wang Q: M2 macrophage-induced lncRNA PCAT6 facilitates tumorigenesis and angiogenesis of triple-negative breast cancer through modulation of VEGFR2. Cell Death Dis. 11:7282020. View Article : Google Scholar : PubMed/NCBI

41 

Tong H, Zhuang X, Cai J, Ding Y, Si Y, Zhang H and Shen M: Long noncoding RNA ZFAS1 promotes progression of papillary thyroid carcinoma by sponging miR-590-3p and upregulating HMGA2 expression. Onco Targets Ther. 12:7501–7512. 2019. View Article : Google Scholar : PubMed/NCBI

42 

Dong D, Mu Z, Wei N, Sun M, Wang W, Xin N, Shao Y and Zhao C: Long non-coding RNA ZFAS1 promotes proliferation and metastasis of clear cell renal cell carcinoma via targeting miR-10a/SKA1 pathway. Biomed Pharmacother. 111:917–925. 2019. View Article : Google Scholar : PubMed/NCBI

43 

Hassan MA, Al-Sakkaf K, Shait Mohammed MR, Dallol A, Al-Maghrabi J, Aldahlawi A, Ashoor S, Maamra M, Ragoussis J, Wu W, et al: Integration of transcriptome and metabolome provides unique insights to pathways associated with obese breast cancer patients. Front Oncol. 10:8042020. View Article : Google Scholar : PubMed/NCBI

44 

Mansoori Y, Tabei MB, Askari A, Izadi P, Daraei A, Bastami M, Naghizadeh MM, Nariman-Saleh-Fam Z, Mansoori B and Tavakkoly-Bazzaz J: Expression levels of breast cancer-related GAS5 and LSINCT5 lncRNAs in cancer-free breast tissue: Molecular associations with age at menarche and obesity. Breast J. 24:876–882. 2018. View Article : Google Scholar : PubMed/NCBI

45 

Ni W, Yao S, Zhou Y, Liu Y, Huang P, Zhou A, Liu J, Che L and Li J: Long noncoding RNA GAS5 inhibits progression of colorectal cancer by interacting with and triggering YAP phosphorylation and degradation and is negatively regulated by the m6A reader YTHDF3. Mol Cancer. 18:1432019. View Article : Google Scholar : PubMed/NCBI

46 

Ji J, Dai X, Yeung SJ and He X: The role of long non-coding RNA GAS5 in cancers. Cancer Manag Res. 11:2729–2737. 2019. View Article : Google Scholar : PubMed/NCBI

47 

Sun M, Jin FY, Xia R, Kong R, Li JH, Xu TP, Liu YW, Zhang EB, Liu XH and De W: Decreased expression of long noncoding RNA GAS5 indicates a poor prognosis and promotes cell proliferation in gastric cancer. BMC Cancer. 14:3192014. View Article : Google Scholar : PubMed/NCBI

48 

Li Z, Jin C, Chen S, Zheng Y, Huang Y, Jia L, Ge W and Zhou Y: Long non-coding RNA MEG3 inhibits adipogenesis and promotes osteogenesis of human adipose-derived mesenchymal stem cells via miR-140-5p. Mol Cell Biochem. 433:51–60. 2017. View Article : Google Scholar : PubMed/NCBI

49 

Xu B, Gerin I, Miao H, Vu-Phan D, Johnson CN, Xu R, Chen XW, Cawthorn WP, MacDougald OA and Koenig RJ: Multiple roles for the non-coding RNA SRA in regulation of adipogenesis and insulin sensitivity. PLoS One. 5:e141992010. View Article : Google Scholar : PubMed/NCBI

50 

Gong P, Qiao F, Wu H, Cui H, Li Y, Zheng Y, Zhou M and Fan H: LncRNA UCA1 promotes tumor metastasis by inducing miR-203/ZEB2 axis in gastric cancer. Cell Death Dis. 9:11582018. View Article : Google Scholar : PubMed/NCBI

51 

Bian Z, Jin L, Zhang J, Yin Y, Quan C, Hu Y, Feng Y, Liu H, Fei B, Mao Y, et al: LncRNA-UCA1 enhances cell proliferation and 5-fluorouracil resistance in colorectal cancer by inhibiting miR-204-5p. Sci Rep. 6:238922016. View Article : Google Scholar : PubMed/NCBI

52 

Yao F, Wang Q and Wu Q: The prognostic value and mechanisms of lncRNA UCA1 in human cancer. Cancer Manag Res. 11:7685–7696. 2019. View Article : Google Scholar : PubMed/NCBI

53 

de Onis M and Habicht JP: Anthropometric reference data for international use: Recommendations from a world health organization expert committee. Am J Clin Nutr. 64:650–658. 1996. View Article : Google Scholar : PubMed/NCBI

54 

Al-Maghrabi J, Al-Sakkaf K, Qureshi IA, Butt NS, Damnhory L, Elshal M, Al-Maghrabi B, Aldahlawi A, Ashoor S, Brown B, et al: AMPK expression patterns are significantly associated with poor prognosis in breast cancer patients. Ann Diagn Pathol. 29:62–67. 2017. View Article : Google Scholar : PubMed/NCBI

55 

Khabaz MN, Al-Sakkaf K, Qureshi IA, Butt NS, Damnhory L, Elshal M, Al-Maghrabi B, Aldahlawi A, Ashoor S, Brown B, et al: Expression of p-AMPK is associated with hormone receptor phenotypes and lymph node metastasis in breast cancer. Int J Clin Exp Patho. 10:7044–7051. 2017.

56 

Pfaffl MW, Horgan GW and Dempfle L: Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30:e362002. View Article : Google Scholar : PubMed/NCBI

57 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

58 

Mandrekar JN: Receiver operating characteristic curve in diagnostic test assessment. J Thorac Oncol. 5:1315–1316. 2010. View Article : Google Scholar : PubMed/NCBI

59 

Soudyab M, Iranpour M and Ghafouri-Fard S: The role of long non-coding RNAs in breast cancer. Arch Iran Med. 19:508–517. 2016.PubMed/NCBI

60 

Zhu Y, Mao D, Gao W, Han G and Hu H: Analysis of lncRNA expression in patients with eosinophilic and neutrophilic asthma focusing on LNC_000127. Front Genet. 10:1412019. View Article : Google Scholar : PubMed/NCBI

61 

Fernandes JCR, Acuña SM, Aoki JI, Floeter-Winter LM and Muxel SM: Long non-coding RNAs in the regulation of gene expression: Physiology and disease. Noncoding RNA. 5:172019.PubMed/NCBI

62 

Wei JW, Huang K, Yang C and Kang CS: Non-coding RNAs as regulators in epigenetics (Review). Oncol Rep. 37:3–9. 2017. View Article : Google Scholar : PubMed/NCBI

63 

Ghafouri-Fard S and Taheri M: The expression profile and role of non-coding RNAs in obesity. Eur J Pharmacol. 892:1738092021. View Article : Google Scholar : PubMed/NCBI

64 

Butler AE, Hayat S, Dargham SR, Malek JA, Abdullah SA, Mahmoud YA, Sathyapalan T and Atkin SL: Long non-coding RNA expression in non-obese women with polycystic ovary syndrome and weight-matched controls. Reprod Biomed Online. 41:579–583. 2020. View Article : Google Scholar : PubMed/NCBI

65 

Liang Y, Song X, Li Y, Chen B, Zhao W, Wang L, Zhang H, Liu Y, Han D, Zhang N, et al: LncRNA BCRT1 promotes breast cancer progression by targeting miR-1303/PTBP3 axis. Mol Cancer. 19:852020. View Article : Google Scholar : PubMed/NCBI

66 

Sun Z and Liu J and Liu J: The expression of lncRNA-MALAT1 in breast cancer patients and its influences on prognosis. Cell Mol Biol (Noisy-le-grand). 66:72–78. 2020. View Article : Google Scholar : PubMed/NCBI

67 

Lv D, Xu K, Jin X, Li J, Shi Y, Zhang M, Jin X, Li Y, Xu J and Li X: LncSpA: LncRNA spatial atlas of expression across normal and cancer tissues. Cancer Res. 80:2067–2071. 2020. View Article : Google Scholar : PubMed/NCBI

68 

Mohebi M, Ghafouri-Fard S, Modarressi MH, Dashti S, Zekri A, Kholghi-Oskooei V and Taheri M: Expression analysis of vimentin and the related lncRNA network in breast cancer. Exp Mol Pathol. 115:1044392020. View Article : Google Scholar : PubMed/NCBI

69 

Stelzer G, Rosen N, Plaschkes I, Zimmerman S, Twik M, Fishilevich S, Stein TI, Nudel R, Lieder I, Mazor Y, et al: The genecards suite: From gene data mining to disease genome sequence analyses. Curr Protoc Bioinformatics. 54:1.30.1–1.30.33. 2016.PubMed/NCBI

70 

The Rnacentral Consortium, Petrov AI, Kay SJE, Kalvari I, Howe KL, Gray KA, Bruford EA, Kersey PJ, Cochrane G, Finn RD, et al: RNAcentral: A comprehensive database of non-coding RNA sequences. Nucleic Acids Res. 45:D128–D134. 2017. View Article : Google Scholar : PubMed/NCBI

71 

Paraskevopoulou MD, Vlachos IS, Karagkouni D, Georgakilas G, Kanellos I, Vergoulis T, Zagganas K, Tsanakas P, Floros E, Dalamagas T and Hatzigeorgiou AG: DIANA-LncBase v2: Indexing microRNA targets on non-coding transcripts. Nucleic Acids Res. 44:D231–D238. 2016. View Article : Google Scholar : PubMed/NCBI

72 

Wang Y, Chen L, Wu Z, Wang M, Jin F, Wang N, Hu X, Liu Z, Zhang CY, Zen K, et al: miR-124-3p functions as a tumor suppressor in breast cancer by targeting CBL. BMC Cancer. 16:8262016. View Article : Google Scholar : PubMed/NCBI

73 

Zhu X, Rao X, Yao W and Zou X: Downregulation of MiR-196b-5p impedes cell proliferation and metastasis in breast cancer through regulating COL1A1. Am J Transl Res. 10:3122–3132. 2018.PubMed/NCBI

74 

Wang B, Li D, Kovalchuk I, Apel IJ, Chinnaiyan AM, Wóycicki RK, Cantor CR and Kovalchuk O: miR-34a directly targets tRNAiMet precursors and affects cellular proliferation, cell cycle, and apoptosis. Proc Natl Acad Sci USA. 115:7392–7397. 2018. View Article : Google Scholar : PubMed/NCBI

75 

Zhang L, Wang L, Dong D, Wang Z, Ji W, Yu M, Zhang F, Niu R and Zhou Y: MiR-34b/c-5p and the neurokinin-1 receptor regulate breast cancer cell proliferation and apoptosis. Cell Prolif. 52:e125272019. View Article : Google Scholar : PubMed/NCBI

76 

Jiang J, Yang X, He X, Ma W, Wang J, Zhou Q, Li M and Yu S: MicroRNA-449b-5p suppresses the growth and invasion of breast cancer cells via inhibiting CREPT-mediated Wnt/β-catenin signaling. Chem Biol Interact. 302:74–82. 2019. View Article : Google Scholar : PubMed/NCBI

77 

Hou L, Chen M, Yang H, Xing T, Li J, Li G, Zhang L, Deng S, Hu J, Zhao X and Jiang J: MiR-940 inhibited cell growth and migration in triple-negative breast cancer. Med Sci Monit. 22:3666–3672. 2016. View Article : Google Scholar : PubMed/NCBI

78 

Hu Y, Zhu Q and Tang L: MiR-99a antitumor activity in human breast cancer cells through targeting of mTOR expression. PLoS One. 9:e920992014. View Article : Google Scholar : PubMed/NCBI

79 

Wang X, Li Y, Qi W, Zhang N, Sun M, Huo Q, Cai C, Lv S and Yang Q: MicroRNA-99a inhibits tumor aggressive phenotypes through regulating HOXA1 in breast cancer cells. Oncotarget. 6:32737–32747. 2015. View Article : Google Scholar : PubMed/NCBI

80 

Wang YW, Zhang W and Ma R: Bioinformatic identification of chemoresistance-associated microRNAs in breast cancer based on microarray data. Oncol Rep. 39:1003–1010. 2018.PubMed/NCBI

81 

Shi W, Bruce J, Lee M, Yue S, Rowe M, Pintilie M, Kogo R, Bissey PA, Fyles A, Yip KW and Liu FF: MiR-449a promotes breast cancer progression by targeting CRIP2. Oncotarget. 7:18906–18918. 2016. View Article : Google Scholar : PubMed/NCBI

82 

Dahariya S, Paddibhatla I, Kumar S, Raghuwanshi S, Pallepati A and Gutti RK: Long non-coding RNA: Classification, biogenesis and functions in blood cells. Mol Immunol. 112:82–92. 2019. View Article : Google Scholar : PubMed/NCBI

83 

Xu S, Chen P and Sun L: Regulatory networks of non-coding RNAs in brown/beige adipogenesis. Biosci Rep. 35:e002622015. View Article : Google Scholar : PubMed/NCBI

84 

Jiang MC, Ni JJ, Cui WY, Wang BY and Zhuo W: Emerging roles of lncRNA in cancer and therapeutic opportunities. Am J Cancer Res. 9:1354–1366. 2019.PubMed/NCBI

85 

Lo PK, Wolfson B, Zhou X, Duru N, Gernapudi R and Zhou Q: Noncoding RNAs in breast cancer. Brief Funct Genomics. 15:200–221. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Choudhry H, Hassan MA, Al‑Malki AL and Al‑Sakkaf KA: Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer. Oncol Lett 22: 508, 2021.
APA
Choudhry, H., Hassan, M.A., Al‑Malki, A.L., & Al‑Sakkaf, K.A. (2021). Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer. Oncology Letters, 22, 508. https://doi.org/10.3892/ol.2021.12769
MLA
Choudhry, H., Hassan, M. A., Al‑Malki, A. L., Al‑Sakkaf, K. A."Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer". Oncology Letters 22.1 (2021): 508.
Chicago
Choudhry, H., Hassan, M. A., Al‑Malki, A. L., Al‑Sakkaf, K. A."Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer". Oncology Letters 22, no. 1 (2021): 508. https://doi.org/10.3892/ol.2021.12769
Copy and paste a formatted citation
x
Spandidos Publications style
Choudhry H, Hassan MA, Al‑Malki AL and Al‑Sakkaf KA: Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer. Oncol Lett 22: 508, 2021.
APA
Choudhry, H., Hassan, M.A., Al‑Malki, A.L., & Al‑Sakkaf, K.A. (2021). Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer. Oncology Letters, 22, 508. https://doi.org/10.3892/ol.2021.12769
MLA
Choudhry, H., Hassan, M. A., Al‑Malki, A. L., Al‑Sakkaf, K. A."Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer". Oncology Letters 22.1 (2021): 508.
Chicago
Choudhry, H., Hassan, M. A., Al‑Malki, A. L., Al‑Sakkaf, K. A."Suppression of circulating <em>AP001429.1</em> long non‑coding RNA in obese patients with breast cancer". Oncology Letters 22, no. 1 (2021): 508. https://doi.org/10.3892/ol.2021.12769
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team