Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November 2013 Volume 30 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2013 Volume 30 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo

  • Authors:
    • Qing Ye
    • Feng Huang
    • Xiao-Ying Wang
    • Yang-Mei Xu
    • Fu-Sheng Gong
    • Li-Jie Huang
    • Chun-Kang Yang
    • Qiu-Hong Zheng
    • Min-Gang Ying
  • View Affiliations / Copyright

    Affiliations: Department of Abdominal Surgery, Teaching Hospital of Fujian Medical University, Fujian Provincial Tumor Hospital, Fuzhou, Fujian 350014, P.R. China, Tumor Surgery Research Office, Teaching Hospital of Fujian Medical University, Fujian Provincial Tumor Hospital, Fuzhou, Fujian 350014, P.R. China
  • Pages: 2161-2170
    |
    Published online on: August 22, 2013
       https://doi.org/10.3892/or.2013.2688
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Recent evidence suggests the involvement of γ-synuclein in tumorigenesis and tumor progression. The present study was designed to further clarify the effects of γ-synuclein on the biological features of colon cancer cells in vitro and in vivo. We constructed the eukaryotic expression vector and siRNA vector and selected stable transfectants to respectively upregulate and downregulate γ-synuclein expression in SW1116 cells. we found that silencing of γ-synuclein significantly attenuated SW1116 cell growth and colony formation in vitro (P<0.05), and overexpression of γ-synuclein moderately enhanced cell growth and colony formation, but not significantly when compared with the parental SW1116 cells and empty vector-transfected cells (P>0.05). Meanwhile, overexpression of γ-synuclein significantly facilitated SW1116 cell migration, invasion and adhesion to human liver sinusoidal endothelial cells (HLSECs) in vitro (P<0.05), and the effects were less attenuated by γ-synuclein knockdown (P>0.05). Furthermore, γ-synuclein promoted these malignant phenotypes in a γ-synuclein expression quantity-dependent manner not only in vitro but also in the in vivo expression. stable cells were injected subcutaneously into the right flank, and injected intrasplenically in nude mice. γ-synuclein knockdown suppressed the tumorigenicity of SW1116 cells in mice, which presented significantly smaller tumor masses on day 6 over a 30-day period, compared with empty vector cells (P<0.05). Meanwhile, overexpression of γ-synuclein led to a profound augmentation of liver metastasis in nude mice, not only in macroscopic appearance but also in the size and weight of livers (P<0.05). These results provide strong evidence that suggests γ-synuclein plays a positive role in the progression of colorectal cancer.

Introduction

Colorectal cancer (CRC) is one of the most frequently diagnosed malignancies in both men and women worldwide, and CRC is the second most common cause of cancer-related mortality in developed countries such as the USA (1). Traditional and combined therapeutic approaches (surgery, chemotherapy and radiation) for curing CRC give rise to improvements in progression-free and overall survival, yet, the outcome of this common malignancy remains unsatisfactory mainly due to metastasis or recurrent disease, poor understanding of the mechanism of CRC development and the lack of specific target gene therapy (2,3). In recent years, multiple studies have been conducted to investigate the genes and their products that are involved in the progression of CRC (4–6).

The synucleins (α-, β- and γ-synuclein) are a small, soluble, highly conserved group of neuronal proteins that have attracted considerable attention due to their involvement in neurodegenerative disorders such as Alzheimer’s and Parkinson’s disease. Synuclein expression is commonly highly tissue-specific and is restricted to brain tissue and presynaptic terminals (7,8). However, aberrant expression of synucleins beyond the neuronal system has been highly associated with human malignancies. The γ-synuclein gene was initially cloned from infiltrating breast carcinoma cells by using the expressed sequence tag-based differential cDNA sequencing approach (9), and stage-specific expression of γ-synuclein has been found in advanced breast cancers and other malignancies, including ovarian, pancreatic and bladder cancers (10–13). The α-synuclein gene was identified in patients with bladder cancer by oligonucleotide arrays, and α-synuclein protein is significantly associated with tumor staging and clinical outcome (14). α- and β-synucleins have also been found to be expressed in several nervous system cancers and breast and ovarian cancer (15,16).

In our previous study, we investigated expression patterns of synucleins in CRC tissues and cell lines, and found that among α-, β- and γ-synucleins, γ-synuclein was most significantly correlated with CRC (17). We also provided clinical evidence suggesting that γ-synuclein expression is upregulated in CRC, which is primarily attributed to the demethylation of the CpG island in exon 1, and that aberrant expression and demethylation of γ-synuclein are closely correlated with advanced clinical stage, lymph node involvement and distant metastasis (18). Experimental data from previous studies have also revealed a tumor phenotype of γ-synuclein in other types of cancer. Overexpression of γ-synuclein was found to lead to a significant increase in motility and invasiveness in breast cancer cell culture and to a profound enhancement in metastasis in nude mice (19,20). γ-synuclein has been shown to compromise normal mitotic checkpoint controls, resulting in multinucleation as well as more rapid breast cancer cell growth (21,22). γ-synuclein has been implicated in late stage ovarian cancer metastasis by enhancing cell motility through activation of the RHO family small-GTPases and ERK1/2 (23).

Collectively, these findings suggest a potential role of γ-synuclein in the process of tumorigenesis and metastasis. However, little is known concerning the biological effects of γ-synuclein in CRC cell line culture and in animal models. In the present study, we investigated the effects of γ-synuclein on the biological features of colon cancer cell line SW1116 by cell growth curve, soft agar assay, cell migration, invasion and adhesion assays in vitro, and by a tumor xenograft model of tumorigenicity and a liver metastasis assay in vivo.

Materials and methods

Cell cultures

The colon cancer cell line SW1116 (ATCC no. CCL-233) was grown in RPMI-1640 medium (Gibco-BRL, Life Technologies Inc., Gaithersburg, MD, USA) supplemented with 10% heat inactivated fetal bovine serum (FBS) (Summit Biotechnology, Fort Collins, CO, USA). The colon cancer cell line HT-29 (ATCC no. HTB-38) was cultured in McCoy’s 5a medium (Gibco-BRL) supplemented with 10% FBS. Human liver sinusoidal endothelial cells (HLSECs) were purchased from Cell Systems (Kirkland, WA, USA) and grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco-BRL) supplemented with 10% FBS. Human umbilical vein endothelial cells (HUVECs) (ATCC no. PCS-100-013) were obtained from ATCC and maintained in F12K supplemented with endothelial cell growth supplement (ECGS) (0.05 mg/ml) (BD Biosciences, Bedford, MA, USA) and heparin (Sigma-Aldrich, Victoria, Australia) (0.1 mg/ml). Cells were maintained in a humidified incubator at 37°C with 5% CO2, fed every 3 days with complete medium and subcultured when confluence was reached.

RT-PCR

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Synthesis of cDNA from 1 μg RNA was performed with a reverse transcription system kit (Promega, Madison, WI, USA). PCR reactions were carried out in a thermal cycler (model PTC-225; M J Research, Watertown, MA, USA) using HotStarTaq DNA polymerase (Qiagen GmbH, Hilden, Germany) as follows: 95°C for 15 min, 34 cycles of 94°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec, and finally at 72°C for 5 min. The expression of GAPDH mRNA was taken as an internal loading control. The PCR products were separated on 1.5% agarose gels and stained with ethidium bromide. Table I provides the sequences of the primers used in the study.

Table I

Sequences of γ-synuclein gene-specific primers and shRNA.

Table I

Sequences of γ-synuclein gene-specific primers and shRNA.

OligonucleotidesSequence (5′-3′)
γ-synuclein-5′ (RT-PCR) CAAGAAGGGCTTCTCCATCGCCAAGG
γ-synuclein-3′ (RT-PCR) CCTCTTTCTCTTTGGATGCCACACCC
GAPDH-5′ GAAGGTGAAGGTCGGAGTC
GAPDH-3′ GAAGATGGTGATGGGATTTC
γ-synuclein-5′ (full-length PCR) CCCTCGAGGGATGGATGTCTTCAAGAAGG
γ-synuclein-3′ (full-length PCR) CGGGATCCCGCTAGTCTCCCCCACTCG
γ-synuclein-5′ (shRNA) GATCCGGAGAATGTTGTACAGAGCTTCAAGAGAGCTCTGTACAACATTCTCCTTTTTTGGAAA
γ-synuclein-5′ (shRNA) AGCTTTTCCAAAAAAGGAGAATGTTGTACAGAGCTCTCTTGAAGCTCTGTACAACATTCTCCG
Plasmid construction

Total RNA was extracted from HT29 cells, and the full-length cDNA of γ-synuclein was amplified using RT-PCR. The digested fragment of cDNA was inserted between the XhoI and BamHI sites of the pIRES2-EGFP plasmid to generate the pIRES2-γ-synuclein construct. The sequences (as shown in Table I) unique to the coding region of γ-synuclein were chemically synthesized and inserted between the BamHI and HindIII sites of the pGCsi-U6/neo/GFP plasmid to generate the pGCsi-γ-synuclein construct. The positive clones of pIRES2-γ-synuclein and pGCsi-γ-synuclein were confirmed by sequencing.

Plasmid transfection and selection of the SW1116 stable transfectants

One day before transfection, SW1116 cells were plated in a 6-well plate at 1×105 cells/well using RPMI-1640 medium without antibiotics. The cells were transfected with 3.0 μg/well of the recombinant plasmids and empty plasmids as control, respectively, using Lipofectamine (Invitrogen). Fresh growth medium was replaced after 4 h of transfection. Cells were passaged at a 1:10 dilution at 24 h after transfection and cultured in medium supplemented with G418 (Promega) at 1,000 μg/ml for 4 weeks. Stably transfected polyclones were selected from several cell islands with green fluorescent protein (GFP or EGFP) and were maintained in medium containing 400 μg/ml G418 for further study. Meanwhile, GFP or EGFP fluorescence was detected by flow cytometry to confirm that the purity of transfectants was >95%.

Western blot analysis

Cells were harvested and lysed with mammalian protein extraction reagent (Pierce, Rockford, IL, USA). The lysated proteins were quantified by bicinchoninic acid (BCA) protein assay kit (Pierce). Total protein (50 μg) was subjected to 15% SDS-PAGE and electrophoretically transferred to PVDF membranes (Millipore, Bedford, MA, USA). Membranes were blocked overnight with 5% skimmed milk in TBS buffer containing 0.05% Tween-20 at 4°C, and incubated with a 1:500 dilution of mouse anti-γ-synuclein monoclonal antibody (sc-65979; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and goat anti-mouse IgG-AP antibody (Santa Cruz Biotechnology) (1:5,000), respectively. Membranes incubated with ECL (Pierce) for 1 min were exposed to the film for 1–5 min. GAPDH served as a loading control.

Cell proliferation analysis

Cells were plated in five copies onto 96-well plates at a density of 2×103 cells/well in 100 μl RPMI-1640 medium containing 10% FBS at 37°C with 5% CO2. The number of viable cells was determined daily with the WST-8 cytotoxicity assay using the Cell Counting Kit-8 (Dojindo, Japan). Briefly, 10 μl of the CCK-8 solution was added to each well of the microplate, and the absorbance at 490 nm was measured by a microplate reader (μQuant; Bio-Tek, Winooski, VT, USA) after a 4-h incubation.

Soft agar colony formation assay

Cells (1×103) were trypsinized to a single-cell suspension and then plated in triplicate onto 6-well plates in complete culture medium containing 0.3% agar on top of 0.6% agar in the same medium. Cultures were maintained at 37°C with 5% CO2 incubator for 14 days. The colonies were fixed with 70% ethanol and stained with 0.2% crystal violet. The colonies containing at least 50 cells were counted. Colony formation rates were calculated as the number of colonies relative to that of cells initially plated in a well (1×103), and were expressed as mean ± SD.

Wound healing assay

Cells were plated in 35-mm dishes to form a monolayer one day before assay. After making a straight scratch with a pipette tip, cells were incubated in RPMI-1640 medium containing 10% FBS at 37°C with 5% CO2 for 36 h. The motile cells were photographed under light microscopy to detect the speed of wound closure at various intervals. Assays were repeated three times.

Cell invasion assay

Boyden chambers with 8-μm polycarbonate membranes in 24-well dishes (Nucleopore, Pleasanton, CA, USA) were coated with 4 mg/ml growth factor-reduced Matrigel (50 μg; Collaborative Biomedical, Becton Dickinson Labware, Bedford, MA, USA). Cells (1×105) were resuspended in serum-free RPMI-1640 and added to the upper chamber in triplicate. Consecutively, RPMI-1640 with 10% FBS was added to the lower chamber. Chambers were incubated at 37°C with 5% CO2 incubator. After a 48-h incubation, the chambers were fixed with 70% ethanol, and cells were stained with 0.2% crystal violet. Cells on the surface of the upper chamber were removed by swiping with cotton swabs. The number of invasive cells in the lower chamber was determined under light microscopy. The data are expressed as means ± SD of cell counts in 10 random fields of vision.

Cell adhesion assay

For the adhesion assay with HLSECs or HUVECs, a 96-well plate, coated by 2% gelatin, was seeded with 1×104 endothelial cells/well and cultured until confluent. SW1116 cells (5×104) were then transferred to each well in triplicate and left to adhere to the endothelial layer for 1 h at 37°C. The endothelial layer was washed with PBS to remove the non-adherent cells. Since γ-synuclein expression plasmids contained green fluorescence protein (GFP or EGFP), the attached cells were quantified by measuring the fluorescence intensity using a microplate reader (model Safire 2; Tecan, Männedorf, Switzerland).

Tumor xenograft model of tumorigenicity and liver metastasis assay

Six-week-old male BALB/c nu/nu nude mice were purchased from the Experimental Animal Centre of Shanghai Institutes for Biological Sciences (SIBS, Shanghai, China) and housed in a specific pathogen-free environment. The pIRES2-EGFP, pIRES2-γ-synuclein, pGCsi-U6/neo/GFP, and pGCsi-γ-synuclein cells were harvested, washed and re-suspended in PBS, respectively. For the tumorigenicity assay, 1×106 cells suspended in 100 μl PBS were injected subcutaneously into the right flank regions using a 27-gauge needle. Mice were checked every 3 days for tumor appearance, and tumor size was determined by measuring two diameters with a caliper. Tumor volume (V) was estimated by using the equation: V = 4/3π × L/2 × (W/2)2, where L is the mid-axis length and W is the mid-axis width. For liver metastasis assay, mice were anesthetized intraperitoneally with 2.5% Avertin (Sigma). The spleen was exteriorized through a left lateral flank incision, and 1×106 cells in 50 μl of PBS were injected into the distal tip of spleen parenchyma using a 27-gauge needle. The injection site on the spleen was pressed with a cotton stick wet in iodine-polividone solution in order to destroy extravasated cells and ensure hemostasis. The peritoneum and skin were closed in a single layer with surgical thread. Each group for the tumorigenicity assay included 10 mice and each group for the liver metastasis assay included 7 mice. All animals were sacrificed on day 30 after tumor cell implantation. Tumor specimens (in the right flank, liver and spleen) were collected, fixed in 10% neutral buffered formalin, embedded in paraffin and subjected to hematoxylin and eosin (H&E) staining and immunohistochemistry (IHC). The Ethics Committee of the Fujian Medical University approved the animal usage in the research, and all surgical procedures and care administered to the animals were in accordance with institutional guidelines.

Histology and immunohistochemistry

Unstained 4-mm sections were cut from tissue blocks and stained with H&E and subjected to IHC analysis. Sections subjected to IHC were cleared with xylene and rehydrated with ethanol, and the slides were bathed in 0.01 mol/l sodium citrate and heated in a microwave oven for 12 min. The sections were incubated with anti-γ-synuclein antibody (sc-65979; Santa Cruz Biotechnology) and kept at 4°C overnight. Negative control slides were treated only with non-immunized mouse immunoglobulin fraction under equivalent conditions. For the secondary developing reagents, a labeled streptavidin-biotin kit (Dako, Carpinteria, CA, USA) was used. Slides were developed with diaminobenzaminidine and counterstained with hematoxylin.

Statistical analysis

The results are presented as means ± SD. Differences between groups were compared by two-way ANOVA, and were considered significant at P<0.05. Data analysis was carried out using SSPS 13.0 software.

Results

Identification of SW1116 stable transfectants

After identification by sequence analysis, γ-synuclein gene eukaryotic expression plasmids and siRNA plasmids were successfully constructed. The recombinant plasmids and empty plasmids were transfected into SW1116 cells. After 4 weeks of selection with G418, stable transfected clones were successfully established, and the purity of the transfectants was >95% (Fig. 1A). To confirm the γ-synuclein expression in the stable transfectants, we examined the expression of γ-synuclein by RT-PCR and western blot analysis. The expression of γ-synuclein mRNA was upregulated in pooled pIRES2-γ-synuclein cells and downregulated in pooled pGCsi-γ-synuclein cells (Fig. 1B); these finding paralleled those of the western blot analysis (Fig. 1C).

Figure 1

Identification of SW1116 stable transfectants. (A) Images of the SW1116 stable transfectants using fluorescence and light microscopy. (B) RT-PCR analysis of γ-synuclein mRNA in parental SW1116 (control) and stable transfectants. (C) Western blot analysis of γ-synuclein protein in control and stable transfectants.

Effects of γ-synuclein on SW1116 cell proliferation and colony formation in vitro

In vitro cell proliferation assay showed that γ-synuclein knockdown significantly suppressed cell growth, and the number of pGCsi-γ-synuclein cells was significantly reduced by 48, 72, 96 and 120 h after plating, respectively, compared with the corresponding empty plasmid cells and parental (control) cells (Fig. 2A; P<0.05). The number of pIRES2-γ-synuclein cells was increased, but not significantly (Fig. 2A; P>0.05), compared with the control and pIRES2-EGFP cells, as well as the pGCsi-U6/neo/GFP and pGCsi-γ-synuclein cells, which in general presented the effects in a γ-synuclein expression quantity-dependent manner. Subsequent soft agar colony formation assay was conducted to evaluate the tumorigenicity of cells in vitro. Colony formation rates were 32.6±.1, 42.2±7.5, 30.8±5.9, 34.2±6.2 and 12.8±4.6% in the pIRES2-EGFP, pIRES2-γ-synuclein, control, pGCsi-U6/neo/GFP and pGCsi-γ-synuclein cells. The colony formation rate of the pGCsi-γ-synuclein cells was significantly reduced, compared with the empty vector and control cells (Fig. 2B; P<0.05). The size of colonies formed by the pGCsi-γ-synuclein cells was smaller than that of the two control cells. Whereas in parallel with the results of the proliferation assay, overexpression of γ-synuclein moderately enhanced colony formation of the SW1116 cells (Fig. 2B; P>0.05), which also exhibited a γ-synuclein expression quantity-dependent trend.

Figure 2

Effects of γ-synuclein on cell proliferation and colony formation. (A) The role of γ-synuclein in regulating SW1116 cell proliferation was determined by the CCK-8 assay. Values are the mean ± SD of absorbance at 490 nm for five independent experiments; *P<0.05, **P<0.01. (B) The colony formation rates were analyzed by soft agar assay. Values are the mean ± SD for three independent experiments, *P<0.05.

Effects of γ-synuclein on SW1116 cell migration, invasion and adhesion in vitro

The results of the wound healing assay demonstrated that γ-synuclein is closely involved in cell motility. SW1116 cells overexpressing γ-synuclein moved more rapidly towards the gap, compared with the empty vector and control cells, and γ-synuclein knockdown decreased the healing rate of the SW1116 cell injury (Fig. 3A). A subsequent reconstituted basement membrane (Matrigel) invasion assay was carried out. As expected, γ-synuclein facilitated SW1116 cell invasion through Matrigel and a filter membrane, and the number of invasive pIRES2-γ-synuclein cells was increased by 93.1 and 81.5%, respectively; a higher number than that of the control and empty vector cells (Fig. 3B; P<0.05). However, γ-synuclein knockdown did not significantly attenuate invasion of SW1116 cells, compared with the two corresponding control cells (Fig. 3B; P>0.05). Generally speaking, γ-synuclein promoted SW1116 cell migration and invasion in a γ-synuclein expression quantity-dependent trend, which was observed in the following in vivo assays.

Figure 3

Effects of γ-synuclein on SW1116 cell migration, invasion and adhesion. (A) Representative images of migrated cells. The solid lines indicate the areas occupied by the initial wound or healing wound. (B) The number of invasive cells was counted in 10 random fields of vision. Values are the number of cells relative to that of the parental SW1116 cells (control), and are expressed as the mean ± SD of three independent experiments; *P<0.05. (C and D) Representative images of SW1116 cell adhesion to (C) HLSECs or (D) HUVECs. The attached cells were quantified by measuring the fluorescence intensity of EGFP or GFP by a microplate reader, and values are expressed as the mean ± SD of three independent experiments;*P<0.05.

We carried out adhesion assays to investigate whether γ-synuclein influences the adhesion of SW1116 cells to endothelial cells. In the HLSEC adhesion assay, the average fluorescence intensity of EGFP was 1.07±0.25 in the pIRES2-EGFP cells and 1.73±0.32 in the pIRES2-γ-synuclein cells; γ-synuclein significantly facilitated SW1116 cell adhesion to HLSECs (Fig. 3C; P<0.05). There was no difference in fluorescence intensity of GFP between the pGCsi-U6/neo/GFP (0.94±0.26) and pGCsi-γ-synuclein (0.78±0.15) cells (Fig. 3C; P>0.05). Meanwhile, the results of the HUVEC adhesion assay revealed no effect of γ-synuclein on the adhesive ability of SW1116 cells to HUVECs (Fig. 3D; P>0.05), which suggests that SW1116 cells overexpressing γ-synuclein interact specifically with HLSECs.

Effects of γ-synuclein on SW1116 cell tumorigenicity in vivo

We examined the in vivo tumorigenicity of SW1116 cells by injecting pIRES2-EGFP, pIRES2-γ-synuclein, pGCsi-U6/neo/GFP and pGCsi-γ-synuclein cells subcutaneously into the right flank regions of nude mice. The xenograft tumor growth rates in the different groups were compared. Xenograft tumors appeared in all mice of the three groups except for the pGCsi-γ-synuclein group on day 6, and pIRES2-γ-synuclein group mice exhibited a faster tumor growth rate from day 27 to the end of the expreriment, compared to the other three groups (Fig. 4A; P<0.05). However, only 6 of the 10 mice injected with pGCsi-γ-synuclein cells presented with tumors on day 6, and the other 4 mice remained with no tumor formation until day 9. All pGCsi-γ-synuclein cell tumors maintained a slow rate of growth, compared to the other three groups, within the time remaining until sacrifice (Fig. 4A; P<0.05). All animals were sacrificed on day 30 and tumor tissue specimens were collected as shown in Fig. 4B. The expression of γ-synuclein in tumor tissues was detected by IHC staining. The results showed that γ-synuclein protein was upregulated in tumors derived from pIRES2-γ-synuclein transfectants and downregulated in tumors derived from pGCsi-γ-synuclein transfectant, when compared with the two empty vector transfectants. (Fig. 4C).

Figure 4

Effects of γ-synuclein on SW1116 cell tumorigenicity in vivo. (A) Tumor dimensions were measured every 3 days over a 30-day period. Each point represents the average volume (mean ± SD) calculated from 10 mice; *P<0.05, **P<0.01. (B) Images of tumor specimens from the injected mice on day 30. (C) Images of IHC analysis of γ-synuclein protein expression in tumors (original magnification, ×200).

Effects of γ-synuclein on SW1116 cell liver metastasis in vivo

We adopted an experimental model that entailed the injection of tumor cells into the spleen of nude mice, followed by assessment of their ability for tumorigenesis in the spleens and invasion via the portal vein into the liver and potential intraperitoneal dissemination. All animals were sacrificed by laparotomy on day 30, and tumor progression was observed macroscopically. All mice developed primary tumors in the spleen, and all mice injected with pIRES2-γ-synuclein cells developed metastases on the liver surface. Meanwhile, mice infected with pIRES2-γ-synuclein developed multiple intraperitoneal dissemination nodules in the mesentery, gastrointestinal serosa and peritoneum, whease less tumor nodules were found in the peritoneal cavity of mice in the other three groups (Table II). Liver and spleen specimens were collected for further evaluation. Liver replacement by metastases was too extensive in the liver of 71.4% (n=5 of 7) of pIRES2-γ-synuclein mice, which displayed enlarged livers covered with numerous tumor nodules throughout and with a whitish and irregular surface caused by extensive tumor growth, whereas the livers of the other groups were smaller in size, displaying a macroscopically normal appearance with a few surface nodules, and no liver surface metastases were found in 2 of 7 pIRES2-EGFP, 3 of 7 pGCsi-U6/neo/GFP and 3 of 7 pGCsi-γ-synuclein mice (Fig. 5A). The results paralleled the weight of the livers (Fig. 5B), which also exhibited a γ-synuclein expression quantity-dependent trend; the more γ-synuclein protein expressed, the more obvious the liver metastasis. As shown in Fig. 5C, the growth of these cells in the spleens was almost identical in the pIRES2-γ-synuclein and two empty vector groups, and was significantly decreased in the pGCsi-γ-synuclein group (P<0.05). Liver specimens were subsequently subjected to histologic examination by H&E staining (Fig. 5D). The results showed that liver metastases were found microscopically in all mice including micrometastases in mice without macroscopic nodules. Large regions of liver tissues were replaced by metastases with formation of neovessels, which was reported to be required for tumors to grow beyond a critical size, whereas livers containing pGCsi-γ-synuclein cells were mainly occupied by small-sized metastases with central necrosis.

Figure 5

Effects of γ-synuclein on SW1116 cell liver metastasis in vivo. (A) Macroscopic images of liver metastases at 30 days after intrasplenic injection of tumor cells. (B) Quantitative analysis of the weights of tumor-bearing livers on day 30 and expressed as the mean ± SD from 7 mice; *P<0.05. (C) Representative images of primary tumors in the spleen. The tumor volume was determined on day 30 and expressed as mean ± SD from 7 mice; *P<0.05. (D) Representative photomicrographs of H&E-stained sections of liver tissues from mice following intrasplenic injection of tumor cells (original magnification, a–c, f–h, ×200; d, e, i, ×400). (a) Normal liver tissues of pGCsi-γ-synuclein mice. (b–e) Liver tissues from pIRES2-γ-synuclein mice, which presented large regions of liver metastases with formation of neovessels. (f) Liver metastases from pIRES2-EGFP mice. (g) Liver metastases from pGCsi-U6/neo/GFP mice. (h and i) Liver tissues from pGCsi-γ-synuclein mice, which presented small-sized metastases with central necrosis. L, liver; M, metastases; arrows, neovessels.

Table II

Intraperitoneal dissemination nodules of the tumors.

Table II

Intraperitoneal dissemination nodules of the tumors.

No. of nodules

TransfectantsTumor incidence (%)MesenteryGastrointestinal serosaPeritoneum
pIRES2-EGFP4/7 (57.1)1153
pIRES2-γ-synuclein7/7 (100)2884
pGCsi-U6/neo/GFP3/7 (42.9)834
pGCsi-γ-synuclein2/7 (28.6)621

Discussion

Colon carcinogenesis and metastasis is a multistage process involving alterations of various tumor-suppressor genes and oncogenes (24,25). In recent years, multiple studies have been conducted to investigate the genes and proteins correlated with progression of CRC; however, no internationally recognized molecular marker has been identifed for potential clinical implications (4–6). γ-synuclein is a promising biomarker, belonging to the synuclein protein family, which was initially investigated in the field of neurodegenerative diseases (7,8). Although one study showed downregulation of γ-synuclein in human esophageal squamous cell carcinoma (26), additional studies including ours support the overexpression and the oncological role of γ-synuclein in a variety of cancers (10–13,18). The prognostic impact of γ-synuclein overexpression is impressive, and it was found to be the only independent predictor of reduced overall survival and the strongest negative indicator of disease-free survival by multivariate analysis in breast cancer (10).

On the basis of our previous study on expression and demethylation of γ-synuclein in CRC tissues and cell lines (17,18), we constructed the γ-synuclein gene eukaryotic expression and siRNA vectors, and established permanent transfected SW1116 cells to investigate the biological functions of γ-synuclein. Our data showed that silencing of γ-synuclein in SW1116 cells contributed to suppression of cellular proliferation and colony formation in vitro. These results were consistent with observations of the γ-synuclein siRNA vector in HCT116 cells in our previous study and as well as in other reports of breast and ovarian cancer (21–23,27). The overexpression of γ-synuclein moderately facilitated proliferation and colony formation of SW1116 cells, but not significantly compared with the other groups of cells, which presented a promotive effect in a γ-synuclein expression quantity-dependent manner. Similar findings were also found in the tumorigenicity assay in vivo. In the in vivo tumorigenicity assay, γ-synuclein-knockdown SW1116 cells formed significantly smaller tumor masses than the empty vector cells on day 6 over a 30-day period, whereas tumors derived from overexpressed γ-synuclein cells did not significantly exhibit faster tumor growth until day 27. The probable reasons are as follow. Upregulation of γ-synuclein frequently contributes to cancer cell survival but not proliferation, and moderate expression of γ-synuclein is enough for cell proliferation through an HSP- or ER-based multiprotein chaperone complex. However, overexpression of γ-synuclein may cause occupation of all binding sites in the multiprotein chaperone complex, with no site left for remaining γ-synuclein proteins (10,28,29).

Metastasis leads to ~90% of CRC-related mortality, yet, the underlying mechanisms remain largely unclear (30). Metastasis is a sequential process that includes detachment from the primary site, invasion and adhesion to vasculature, translocation through the systemic circulation, extravasation into the parenchyma of distant tissues (liver and lungs) and colonization of a distant site (31). In order to model this process, we therefore, developed migration, invasion and adhesion assays in vitro, and a liver metastasis assay in vivo. The results of these assays also exhibited a γ-synuclein expression quantity-dependent trend; the more γ-synuclein protein expressed, the more obvious was the promotion of these malignant phenotypes. In vitro, upregulation of γ-synuclein promoted SW1116 cell migration through a Matrigel and a filter membrane, and adherence of SW1116 cells to HLSECs but not HUVECs. Similar effects of γ-synuclein on cell migration and invasion have been reported in breast and ovarian cancer, as well as effects on adhesion as in the report of Hu et al who found that SW1116 subpopulation, SW1116p21, with high potential for liver metastasis that highly express γ-synuclein, exhibited enhanced adhesion to HLSECs (19,23,32), whereas downregulation of γ-synuclein did not significantly inhibit SW1116 cell ability for migration, invasion and adhesion to HLSECs. Our previous experimental data revealed that downregulation of γ-synuclein significantly inhibited the migration and invasion ability of HCT116 cells. The discordant results may be due to the difference in metastatic features between HCT116 and SW1116 cells, and the effects of γ-synuclein siRNA vector were not apparent in relative weak metastatic SW1116 cells. The similar magnitude of migration and invasion-stimulating activity, and special interaction with HLSECs suggests that γ-synuclein enhances the SW1116 cell capacity for invasion and metastasis, which were later confirmed by an experimental model of liver metastasis in vivo. Overexpression of γ-synuclein facilitated SW1116 cell liver metastases, and apparent differences were found not only in macroscopic appearance but also in size and the weight of livers, which further confirmed the positive role of γ-synuclein in the invasion and liver metastasis potential of colon cancer cells. Livers containing pGCsi-γ-synuclein cells had less and small-sized metastases with central necrosis, consistent with observations of the effects of γ-synuclein siRNA on cell proliferation and colony formation. It is likely that survival and proliferation in systemic circulation and colonization at a distant site are also important steps in the sequential process of metastasis. On the other hand, except for the pGCsi-γ-synuclein group, the growth rate of tumors in the spleens was almost the same, whereas the intraperitoneal dissemination tumor rate was different, which collectively suggests that liver metastases occurred independent of a direct effect on primary tumor growth in the study.

In summary, we used in vitro and in vivo assays to study the effects of γ-synuclein on tumorigenicity and metastasis of the colon cancer cell line SW1116. Through construction of γ-synuclein gene eukaryotic expression and siRNA vectors, and selection of SW1116 stable transfectants, respectively, we found that downregulation of γ-synuclein inhibited the proliferation and colony formation of SW1116 cells in vitro and tumorigenicity in nude mice. Meanwhile, upregulation of γ-synuclein enhanced SW1116 cell ability of migration, invasion and adhesion to HLSECs in vitro and liver metastasis in nude mice. Furthermore, γ-synuclein promoted these malignant phenotypes of SW1116 cells in a γ-synuclein expression quantity-dependent manner not only in vitro but also in vivo. This is also the first report of the in vivo evidence of γ-synuclein effects on a colon cancer cell line, which further suggests that γ-synuclein plays a positive role in the progression of CRC, and may serve as a novel molecular target for potential clinical application.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (81101897) and the Science Foundation of Fujian Province, China (2011J05061).

References

1 

Siegel R, Naishadham D and Jemal A: Cancer statistics. CA Cancer J Clin. 63:11–30. 2013.

2 

Mayo SC and Pawlik TM: Current management of colorectal hepatic metastasis. Expert Rev Gastroenterol Hepatol. 3:131–144. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Berri RN and Abdalla EK: Curable metastatic colorectal cancer: recommended paradigms. Curr Oncol Rep. 11:200–208. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Hartwell KA, Muir B, Reinhardt F, Carpenter AE, Sgroi DC and Weinberg RA: The Spemann organizer gene, Goosecoid, promotes tumor metastasis. Proc Natl Acad Sci USA. 103:18969–18974. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Mani SA, Yang J, Brooks M, et al: Mesenchyme Forkhead 1 (FOXC2) plays a key role in metastasis and is associated with aggressive basal-like breast cancers. Proc Natl Acad Sci USA. 104:10069–10074. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Yang J, Mani SA, Donaher JL, et al: Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 117:927–939. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Surguchov A: Molecular and cellular biology of synucleins. Int Rev Cell Mol Biol. 270:225–317. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Ahmad M, Attoub S, Singh MN, Martin FL and El-Agnaf OM: γ-Synuclein and the progression of cancer. FASEB J. 21:3419–3430. 2007.

9 

Ji H, Liu YE, Jia T, et al: Identification of a breast cancer-specific gene, BCSG1, by direct differential cDNA sequencing. Cancer Res. 57:759–764. 1997.PubMed/NCBI

10 

Guo J, Shou C, Meng L, et al: Neuronal protein synuclein γ predicts poor clinical outcome in breast cancer. Int J Cancer. 121:1296–1305. 2007.

11 

Hibi T, Mori T, Fukuma M, et al: Synuclein-γ is closely involved in perineural invasion and distant metastasis in mouse models and is a novel prognostic factor in pancreatic cancer. Clin Cancer Res. 15:2864–2871. 2009.

12 

Dokun OY, Florl AR, Seifert HH, Wolff I and Schulz WA: Relationship of SNCG, S100A4, S100A9 and LCN2 gene expression and DNA methylation in bladder cancer. Int J Cancer. 123:2798–2807. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Liu H, Liu W, Wu Y, et al: Loss of epigenetic control of synuclein-γ gene as a molecular indicator of metastasis in a wide range of human cancers. Cancer Res. 65:7635–7643. 2005.PubMed/NCBI

14 

Sanchez-Carbayo M, Socci ND, Lozano J, Saint F and Cordon-Cardo C: Defining molecular profiles of poor outcome in patients with invasive bladder cancer using oligonucleotide microarrays. J Clin Oncol. 24:778–789. 2006. View Article : Google Scholar

15 

Fung KM, Rorke LB, Giasson B, Lee VM and Trojanowski JQ: Expression of alpha-, beta-, and gamma-synuclein in glial tumors and medulloblastomas. Acta Neuropathol. 106:167–175. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Bruening W, Giasson BI, Klein-Szanto AJ, Lee VM, Trojanowski JQ and Godwin AK: Synucleins are expressed in the majority of breast and ovarian carcinomas and in preneoplastic lesions of the ovary. Cancer. 88:2154–2163. 2000. View Article : Google Scholar : PubMed/NCBI

17 

Ye Q, Wang TF, Peng YF, et al: Expression of α-, β- and γ-synuclein in colorectal cancer, and potential clinical significance in progression of the disease. Oncol Rep. 23:429–436. 2010.

18 

Ye Q, Zheng MH, Cai Q, et al: Aberrant expression and demethylation of γ-synuclein in colorectal cancer, correlated with progression of the disease. Cancer Sci. 99:1924–1932. 2008.

19 

Jia T, Liu YE, Liu J and Shi YE: Stimulation of breast cancer invasion and metastasis by synuclein γ. Cancer Res. 59:742–747. 1999.PubMed/NCBI

20 

Surgucheva IG, Sivak JM, Fini ME, Palazzo RE and Surguchov AP: Effect of γ-synuclein overexpression on matrix metalloproteinases in retinoblastoma Y79 cells. Arch Biochem Biophys. 410:167–176. 2003.

21 

Gupta A, Inaba S, Wong OK, Fang G and Liu J: Breast cancer-specific gene 1 interacts with the mitotic checkpoint kinase BubR1. Oncogene. 22:7593–7599. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Inaba S, Li C, Shi YE, Song DQ, Jiang JD and Liu J: Synuclein gamma inhibits the mitotic checkpoint function and promotes chromosomal instability of breast cancer cells. Breast Cancer Res Treat. 94:25–35. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Pan ZZ, Bruening W and Godwin AK: Involvement of RHO GTPases and ERK in synuclein-γ enhanced cancer cell motility. Int J Oncol. 29:1201–1205. 2006.PubMed/NCBI

24 

Gennari L, Russo A and Rossetti C: Colorectal cancer: what has changed in diagnosis and treatment over the last 50 years? Tumori. 93:235–241. 2007.PubMed/NCBI

25 

Samoha S and Arber N: Cyclooxygenase-2 inhibition prevents colorectal cancer: from the bench to the bed side. Oncology. 69:33–37. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Zhou CQ, Liu S, Xue LY, et al: Down-regulation of γ-synuclein in human esophageal squamous cell carcinoma. World J Gastroenterol. 9:1900–1903. 2003.

27 

Pan ZZ, Bruening W, Giasson BI, Lee VM and Godwin AK: γ-synuclein promotes cancer cell survival and inhibits stress- and chemotherapy drug-induced apoptosis by modulating MAPK pathways. J Biol Chem. 277:35050–35060. 2002.

28 

Liu YE, Pu W, Jiang Y, Shi D, Dackour R and Shi YE: Chaperoning of estrogen receptor and induction of mammary gland proliferation by neuronal protein synuclein gamma. Oncogene. 26:2115–2125. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Jiang Y, Liu YE, Goldberg ID and Shi YE: γ-synuclein, a novel heat-shock protein-associated chaperone, stimulates ligand-dependent estrogen receptor α signaling and mammary tumorigenesis. Cancer Res. 64:4539–4546. 2004.

30 

Gupta GP and Massague J: Cancer metastasis: building a framework. Cell. 127:679–695. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Fidler IJ: The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited. Nat Rev Cancer. 3:453–458. 2003.

32 

Hu H, Sun L, Guo C, et al: Tumor cell-microenvironment interaction models coupled with clinical validation reveal CCL2 and SNCG as two predictors of colorectal cancer hepatic metastasis. Clin Cancer Res. 15:5485–5493. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ye Q, Huang F, Wang X, Xu Y, Gong F, Huang L, Yang C, Zheng Q and Ying M: Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo. Oncol Rep 30: 2161-2170, 2013.
APA
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L. ... Ying, M. (2013). Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo. Oncology Reports, 30, 2161-2170. https://doi.org/10.3892/or.2013.2688
MLA
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L., Yang, C., Zheng, Q., Ying, M."Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo". Oncology Reports 30.5 (2013): 2161-2170.
Chicago
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L., Yang, C., Zheng, Q., Ying, M."Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo". Oncology Reports 30, no. 5 (2013): 2161-2170. https://doi.org/10.3892/or.2013.2688
Copy and paste a formatted citation
x
Spandidos Publications style
Ye Q, Huang F, Wang X, Xu Y, Gong F, Huang L, Yang C, Zheng Q and Ying M: Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo. Oncol Rep 30: 2161-2170, 2013.
APA
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L. ... Ying, M. (2013). Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo. Oncology Reports, 30, 2161-2170. https://doi.org/10.3892/or.2013.2688
MLA
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L., Yang, C., Zheng, Q., Ying, M."Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo". Oncology Reports 30.5 (2013): 2161-2170.
Chicago
Ye, Q., Huang, F., Wang, X., Xu, Y., Gong, F., Huang, L., Yang, C., Zheng, Q., Ying, M."Effects of γ-synuclein on the tumorigenicity and metastasis of colon cancer SW1116 cells in vitro and in vivo". Oncology Reports 30, no. 5 (2013): 2161-2170. https://doi.org/10.3892/or.2013.2688
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team