[Erratum] Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line
- Authors:
- Published online on: December 10, 2013 https://doi.org/10.3892/or.2013.2912
- Pages: 1030-1030
-
Copyright: © Koike . This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
Article
Expression of junB is markedly stimulated by glycyrrhizin in a human hepatoma cell line
KATSURO KOIKE
[Related article:] Oncol Rep 25: 609–617, 2011; DOI: 10.3892/or.2011.1137
After the publication of the article, an error was found and we would like to correct it. The corresponding author takes full responsibility for this oversight.
In Materials and methods, the third paragraph; ‘Construction of plasmid vector DNA’, the first appeared junB primer sets of ready-made primers by Takara Bio Inc., were mistaken following the order described in Fig. 1, where No. 1 and No. 2 primer sets were custom-made primer sets by Operon Biotechnologies. Thus, No. 3 and No. 4 primer sets (ready-made primers by Takara Bio Inc.) and No. 1 and No. 2 primer sets were reversely described.
In the article, it was described:
‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: ACCCCTACCGGAGTCTC AAA, reverse: GGAGTAGCTGCTGAGGTTGG) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: GAGCTGG AACGCCTGATTGTC, reverse: TGGTTCATCTTGTGCAG ATCGTC) using...’
However, it should be corrected as:
‘...junB DNA was amplified with junB primer sets (Takara Bio Inc., Otsu, Shiga, Japan) (forward: GAGCTGGAACGCCTGA TTGTC, reverse: TGGTTCATCTTGTGCAGATCGTC) and custom-made human junB exon-primer sets (Operon Biotechnologies, Tokyo, Japan) as summarized in Fig. 1 (forward: AC CCCTACCGGAGTCTCAAA, reverse: GGAGTAGCTGCTG AGGTTGG) using...’
