Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June-2015 Volume 33 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2015 Volume 33 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer

  • Authors:
    • Fangfang Song
    • Ling Zhang
    • Ping Ji
    • Hong Zheng
    • Yanrui Zhao
    • Wei Zhang
    • Kexin Chen
  • View Affiliations / Copyright

    Affiliations: Department of Epidemiology and Biostatistics, Key Laboratory of Breast Cancer Prevention and Therapy, Ministry of Education, Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, Tiyuan Bei, Hexi, Tianjin 300060, P.R. China, Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA
  • Pages: 2771-2778
    |
    Published online on: April 8, 2015
       https://doi.org/10.3892/or.2015.3905
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Previous studies have characterized the migration and invasion inhibitory protein (MIIP) as a novel putative tumor-suppressor gene that regulates cell migration and invasion as well as the mitotic checkpoint. The MIIP gene is located on chromosome 1p36.22, a common site for deletion in many solid tumors including breast cancer. In the present study, we evaluated MIIP expression and allelic deletion to gain insight into the role of the MIIP gene in breast cancer. MIIP gene mRNA and protein expression was assessed in 86 matched breast cancer and adjacent normal tissues. Loss of heterogeneity (LOH) of the MIIP gene was determined using single‑nucleotide polymorphism (SNP) and microsatellite (MS) markers in 149 breast carcinomas and the corresponding normal lymphocytes. The analysis revealed that the expression levels of MIIP mRNA and protein were downregulated in tumor specimens compared to those in corresponding adjacent tissues. Advanced clinical stage and tumor size >2 cm were associated with a decreased MIIP expression level. Twenty-six percent (37/142) of tumors were shown to have LOH at the MIIP locus by MS and SNP markers. Breast cancer patients with LOH at the SNP marker rs2295283 experienced shorter survival time. The attenuated expression and LOH of the MIIP gene may contribute to the poor prognosis of breast cancer, supporting a tumor‑suppressing role of MIIP gene in the pathogenesis of this disease.

Introduction

Breast cancer is the most common type of cancer among women worldwide, and its incidence is on the increase (1). Clearly identified genetic susceptibilities to early onset familial breast cancer are associated with mutations in tumor-suppressor genes (TSGs) BRCA1 and BRCA2, which, however, are not important in sporadic breast cancer (2). Evidence suggests that allelic loss at chromosome 1p36 is a common genetic event in a various types of human cancer including breast cancer, suggesting the presence of at least one TSG located in this region (3). One of these genes is p73 (1p36.33), a p53 homologue (4). However, the allelic status of other genes mapped to this chromosomal region has yet to be sufficiently elucidated.

The migration and invasion inhibitory protein (MIIP; or invasion inhibitory protein 45, IIp45) gene, located on chromosome 1p36.22, has emerged as a key gene that plays a critical role in tumorigenesis (5). MIIP was initially identified in a yeast two-hybrid screen for proteins that interact and inhibit insulin-like growth factor binding protein 2 (IGFBP2) (6). Advances in characterizing this protein have demonstrated that MIIP regulates cell migration and mitosis (7), two essential microtubule and cytoskeleton-associated processes for homeostasis of tissues and fetal development. Additionally, MIIP is underexpressed in human glioma, and an in vivo study using transgenic mouse models showed that exogenously introduced MIIP reduced the incidence and grade of glioma (8). For breast cancer, a case-control epidemiological study conducted by our team identified a functional genetic single-nucleotide polymorphism (SNP) of MIIP that is associated with the risk of breast cancer development and prognosis (9).

However, unlike the classical TSGs such as TP53, PTEN and Rb, in which frequent mutations are identified in cancers, previous mutation screening among glioma and pancreatic cancer tissues only detected rare mutations in the MIIP gene (6,10), similar to the low mutation frequency found in the p73 gene in human cancers. Haploinsufficiency or loss of one allele in another group of TSGs has been described as an alternative important mechanism leading to gene inactivation and cancer development. Genes in this group include the CHD5 gene on 1p36 and the PTEN gene on 10q23 (11,12). In the present study, we evaluated loss of heterogeneity (LOH) of the MIIP locus in breast cancers and investigated the expression of MIIP in breast cancer tissues by reverse-transcription-quantitative PCR (RT-PCR) and western blotting.

Materials and methods

Patient characteristics

All 149 patients enrolled in the present study were newly diagnosed and histologically confirmed breast cancer cases from the Breast Cancer Research Center in Tianjin Medical University Cancer Institute and Hospital (TMUCIH) from January 1, 2006 to June 1, 2008. The patients recruited in the present study had not received any chemo- or radiotherapy prior to obtaining blood samples. The blood samples were obtained prior to surgery. All the patients met the following inclusion criteria: Tianjin residents aged 18–65 years with no previous diagnosis of cancer. The Ethics Committee of TMUCIH approved the study protocol. Written informed consent was obtained from all the patients participating in the present study.

The participants were personally interviewed using a structured questionnaire regarding their socio-demographic characteristics, lifestyle, and family history of cancer. Clinical information on tumor features and disease severity, including morphology, tumor size, lymph node and organ metastasis, tumor stage, and estrogen and progesterone receptor (ER and PR) status was also collected. Each subject donated 20 ml of blood, which was collected in heparinized tubes. Matched tumor and adjacent normal tissues from 86 cases were obtained from the Tissue Bank Facility of TMUCIH, which collects all solid tumor tissues from surgical patients when possible.

RNA extraction and RT-qPCR

Total RNA were extracted and purified from the 86 pairs of snap-frozen breast cancer and adjacent normal tissues according to the protocol of TRIzol reagent (Invitrogen Corporation, Grand Island, NY, USA). The reverse-transcribed products, cDNA, were synthesized from 5.0 ng total RNA in a 20 μl reaction mixture using M-MLV reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA, USA). RT-qPCR was performed on ABI PRISM 7900 Fast Real-Time system (Applied Biosystems, Foster City, CA, USA) using TaqMan gene expression assay for human MIIP according to the manufacturer’s instructions [Takara Biotechnology (Dalian) Co., Ltd., China]. The human GAPDH housekeeping gene was measured as an endogenous control. The probe used was purchased from Applied Biosystems (Hs00976263_m1 for MIIP). Each PCR was performed in triplicate in a 5-μl reaction volume containing 100 ng cDNA as template to detect MIIP gene expression. Amplification was performed under the following conditions: 50°C for 2 min, then 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. The 7900 Sequence Detection System 2.3 software (Applied Biosystems) was used to calculate the relative fold-change in MIIP expression by the 2−ΔΔCt method with 95% confidence (13).

Protein extraction and western blotting

Approximately 100–150 mg frozen tissues were homogenized with pestle and mortar containing liquid nitrogen, and then dissolved in 500–1,000 μl lysis buffer (500 μl protein lysate, 5 μl DTT and 5 μl protease inhibitor). Following incubation on ice for 15 min, the resulting lysates were centrifuged at 140,000 x g for 15 min at 4°C in an ultracentrifuge. Supernatant fractions were collected on ice and the total protein concentration was measured according to the protocol of the BCA Protein Quantitative Detection kit (Sangon Biological Engineering Technology and Services Corporation, Shanghai, China). Twenty microliters supernatant (~40–50 ng protein) was mixed with 5X SDS loading buffer containing 62.5 mM Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, 5% β-mercaptoethanol and 0.1% bromophenol blue, and then boiled at 95°C for 5 min. The denatured proteins of each group were loaded into lanes with 30% SDS-polyacrylamide gel electrophoresis, and then transferred to nitrocellulose membrane. Blots were blocked with 5% skim milk at room temperature for 1 h and incubated overnight at 4°C with monoclonal rabbit anti-IIP45 antibody (1:800; Sigma-Aldrich, St. Louis, MO, USA) and then with HRP-conjugated goat anti-rabbit IgG (1:2,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) as secondary antibody at room temperature for 1 h. β-actin was used as an internal reference and the antibodies (mouse anti-β-actin antibody and the secondary HRP-linked goat anti-mouse IgG antibody) were purchased from Santa Cruz Biotechnology. Immunoreactive bands were visualized using the Immobilon™ Western Chemiluminescent HRP Substrate (Millipore Corporation, Billerica, MA, USA), and exposed to film. The bands were subjected to densitometric quantification by Image J 2X [National Institutes of Health (NIH), Bethesda, MD, USA].

DNA extraction and LOH analysis

LOH was determined on specific PCR products of tumors and corresponding normal peripheral leukocytes. Genomic DNA was extracted from paired snap-frozen tumor tissues and normal controls using the Qiagen DNA Mini kit according to the manufacturer’s protocol (Axygen Biosciences, Union City, CA, USA). LOH analysis of the MIIP locus was performed using three microsatellite (MS) markers and one SNP marker on 149 human breast cancer tumors. Following a search in the Human Genome Annotation Database (UCSC) and Human Sequence Tag Map (NCBI), no MS marker intragenic to the MIIP gene was identified. The three nearest MS loci flanking the 5′ and 3′ side of the MIIP gene (within 0.2 Mb of the gene): D1S2740, D1S489 and D1S434 were selected. PCR was performed with synthesized labeled primers (Sangon Biological Engineering Technology and Services Corporation; Table I) specific to the MS markers obtained from the NCBI UNISTAT database. The size of amplification products was determined by capillary electrophoresis on a 3730XL Genetic Analyzer (Applied Biosystems). Data were collected and analyzed by Gene-Scan3.1g software (Applied Biosystems).

Table I

Details of the SNP and microsatellite markers used for detecting the LOH status of MIIP.

Table I

Details of the SNP and microsatellite markers used for detecting the LOH status of MIIP.

MarkerPrimer sequences (5′–3′)Tm (°C)Product size (bp)
rs2295283Forward: CTCAGCCTAAATGCTCGCT
Reverse: TGGCACGGTCAGAGAAACAA58460
D1S2740Forward: AGCCTTTTGATACTCTTACTGTGG
Reverse: AAAGATTGGGAAGTGGCTCA55201
D1S489Forward: AGCCAGACCAAGTCTCAACA
Reverse: ACAAAATGATGGGGTTATGG55141–153
D1S434Forward: AGCTAATTTACATTACCCAAAAAGA
Reverse: ACAATACAGCAGCAGGTGGC55260

[i] MIIP, migration and invasion inhibitory protein; SNP, single-nucleotide polymorphism; LOH, loss of heterogeneity; Tm, temperature.

An SNP with a high heterozygosity status present in the MIIP gene was selected from the Ensembl database (Table I). This functional SNP (rs2295283) has been found to be associated with risk and prognosis of breast cancer in a previous large-scale epidemiological study (9). Genotypic and allelic frequency of this SNP was conducted by using the MGB TaqMan probe assay (Applied Biosystems) as described previously (9).

For LOH analysis, only those sample pairs in which the normal lymphocyte DNA exhibited a heterozygous pattern, i.e., two alleles for each MS or SNP marker, were considered informative (14,15). Among the informative sample pairs for MS loci, LOH was evaluated by comparing the areas of the two alleles in tumor tissue with corresponding peripheral leukocytes (15). An absence or a reduction by >33% for one allele in the tumor DNA as compared to the normal DNA was interpreted as LOH (16). Concerning the SNP site, LOH in informative samples was defined as a total loss of one allele in tumor DNA compared to its normal tissue counterpart (14). For scoring changes, LOH frequency for each MS or SNP marker was calculated separately as a percentage of all the informative samples in that particular locus (14).

Statistical analysis

Statistical analysis was performed with the SPSS version 17.0. Statistical tests were two-sided, and a difference was considered statistically significant at P<0.05. The relative expression levels of MIIP mRNA were quantified using the 2−ΔΔCt method, and the data were log10-transformed for analysis. Comparison of MIIP mRNA or protein expression level between tumors and adjacent normal tissues was made by the Wilcoxon rank-sum (Mann-Whitney) test. The χ2 test was employed to compare the differences in the frequency distribution of age, family history and clinical variables including morphology, tumor size, lymph node metastasis, tumor stage, and ER/PR status between cases with different LOH status in MIIP gene. MIIP mRNA (further divided into high- and low-expression groups by the median of log 2−ΔΔCt 10 value) and protein expression were correlated with clinical characteristics and MIIP gene LOH status by using the χ2 and Wilcoxon tests. The correlation between survival (overall survival) and LOH status of the MIIP gene was analyzed using the Kaplan-Meier method and log-rank test.

Results

MIIP expression in breast cancer

We analyzed MIIP mRNA and protein expression in 86 cases with breast cancer and matched adjacent normal breast tissues. MIIP mRNA and protein expression was detected in all the adjacent normal tissues and in the majority of the breast carcinomas. The comparison between paired normal adjacent tissue and tumors revealed that MIIP transcript expression was significantly decreased in carcinomas (Fig. 1A). On the basis of log102−ΔΔct value, tumors were divided into the high- or low-expression groups by the median expression level. We found that MIIP gene exhibited a descending expression pattern with an advanced TNM stage of the tumors (P=0.012) and with an increased tumor size (P=0.005) (Table II).

Figure 1

Decreased MIIP expression in breast cancer tissues. (A) MIIP mRNA expression in adjacent normal tissues (N) and (C) breast cancer tissues. (B) MIIP protein expression in representative adjacent normal tissues (N) and (C) breast cancer tissues. MIIP, migration and invasion inhibitory protein.

Table II

Correlation between clinicopathological characteristics and MIIP expression in 86 breast cancer cases.

Table II

Correlation between clinicopathological characteristics and MIIP expression in 86 breast cancer cases.

VariablesmRNA expression
P-valueProtein expression
P-value
High expression/total (%)Median (min–max)
Age (years)
 ≤5019/41 (46.34)0.86014.85 (0.95–54.24)0.465
 >5020/45 (44.44)20.05 (0.96–63.45)
ER
 −17/32 (53.12)0.26521.19 (1.68–63.45)0.105
 +22/54 (40.74)14.85 (0.95–63.04)
PR
 −20/36 (55.56)0.10719.99 (3.51–63.45)0.956
 +19/50 (38.00)16.61 (0.95–63.04)
Benign breast disease
 Never30/68 (44.11)0.65616.61 (0.96–63.45)0.949
 Ever9/18 (50.00)18.09 (0.95–40.06)
Family history of cancer
 No27/58 (46.55)0.74718.09 (0.95–63.45)0.214
 Yes12/28 (42.86)14.98 (0.96–63.04)
Morphology
 Non-invasive29/57 (50.88)0.14916.61 (0.96–63.45)0.747
 Invasive10/29 (34.48)17.17 (0.95–63.04)
Clinical stage
 011/13 (84.62)0.01215.85 (3.51–63.04)0.249
 I13/34 (41.18)19.45 (1.01–63.45)
 II14/36 (38.89)16.61 (0.96–56.67)
 III1/3 (33.33)12.46 (0.95–23.98)
Tumor size (cm)
 ≤214/19 (73.68)0.00515.85 (3.51–63.04)0.289
 >225/67 (37.31)17.17 (0.95–63.45)
Lymph node metastasis
 No22/43 (51.16)0.27918.78 (1.01–63.45)0.843
 Yes17/43 (39.53)15.89 (0.95–56.67)

[i] ER, estrogen receptor; PR, progesterone receptor; MIIP, migration and invasion inhibitory protein.

At the protein level, 86 cases were analyzed for MIIP expression by western blotting, which varied in the same manner to the transcriptional level with a lower MIIP expression in cancer tissues than the normal tissues (Fig. 1B). No significant difference was identified in the expression pattern of MIIP protein based on patient clinical characteristics, with the exception of TNM staging. Tumor tissues in the advanced stage (stage III) expressed significantly decreased MIIP levels than those in the early stages (stage 0, I and II): 16.99 (0.96–63.45) vs. 12.46 (0.95–23.98), P=0.043.

LOH analysis of the MIIP locus

To determine the possible mechanism of MIIP gene underlying breast cancer onset and development, a LOH analysis with MS/SNP markers for MIIP gene was performed in 149 cases. The four MS and SNP markers used were all informative, being clearly biallelic in the normal lymphocyte samples and showing partial or total loss of one allele in the tumor samples (candidate LOH samples) or remained biallelic. Representative LOH profiles of all the markers used in the selected samples are shown in Fig. 2. As shown in Table III, of the 149 cancer tumors analyzed with the intragenic SNP marker rs2295283, 84 samples were informative (heterozygous), 9 of which (10.71%) showed LOH. For the flanking MS loci, 138 of 149 (92.62%) cancer samples were informative. LOH frequency affecting ≥1 MS locus observed was 23.91% (33/138). The most frequently deleted loci were D1S489 (20/97, 20.62%) and D1S2740 (14/70, 20.00%), with LOH for D1S434 marker being similar, at 16.49% (16/97) in all the samples studied.

Figure 2

Representative capillary electrophoretic photographs for (A) SNP and (B) MS markers indicating LOH, non-LOH (NLOH) and uninformative (U) results in breast cancer. N, normal leucocyte DNA. T, tumor DNA. SNP, single-nucleotide polymorphism; MS, microsatellite; LOH, loss of heterogeneity.

Table III

Summary of LOH analysis of MIIP gene locus in 149 breast cancer cases using SNP and MS markers.

Table III

Summary of LOH analysis of MIIP gene locus in 149 breast cancer cases using SNP and MS markers.

LociInformative samples/total (%)LOH per informative sample (%)
rs229528384/149 (56.38)9/84 (10.71)
D1S274070/149 (46.98)14/70 (20.00)
D1S48997/149 (65.10)20/97 (20.62)
D1S43497/149 (65.10)16/97 (16.49)
Overall MS loci138/149 (92.62)33/138 (23.91)

[i] LOH, loss of heterogeneity; MS, microsatellite; SNP, single-nucleotide polymorphism; MIIP, migration and invasion inhibitory protein.

A comparison of the rates of LOH for the four MS/SNP markers in breast cancer patients with different subtypes of tumor characteristics demonstrated no correlations among the four markers (Table IV). However, survival analysis revealed that breast cancer patients with LOH in the SNP marker rs2295283 had a poorer prognosis (P=0.035) (Fig. 3; Table V). A similar trend was observed for MS loci, with an association with overall survival reaching significance (P=0.054) (Table V).

Figure 3

Kaplan-Meier curves of overall survival in breast cancer by the LOH status of MIIP SNP rs2295283. P-value is from the log-rank test. MIIP, migration and invasion inhibitory protein; SNP, single-nucleotide polymorphism; MIIP, migration and invasion inhibitory protein; LOH, loss of heterogeneity.

Table IV

Association between the MIIP gene LOH and clinicopathological characteristics in breast cancer patients.

Table IV

Association between the MIIP gene LOH and clinicopathological characteristics in breast cancer patients.

Variablesrs2295283
D1S2740
D1S489
D1S434
Overall MS loci
−+P-value−+P-value−+P-value−+P-value−+P-value
Age (years)
 ≤503930.4832450.6274080.3413570.96847150.944
 >5036632937124695818
ER
 −2820.4802770.9053350.1453270.75246120.450
 +47729744154995921
PR
 −2840.7262670.8113070.7453160.95445140.965
 +475307471350106019
Benign breast disease
 Never5780.67738101.00059180.55062131.00080250.959
 Ever181184173196258
Family history of cancer
 No4460.7333980.52551110.3515280.25871170.080
 Yes3131762692883316
Morphology
 Non-invasive5671.00039110.7425951.00062110.53326100.527
 Invasive19217318151957923
Clinical stage
 0+I3920.09132100.32939110.72943120.10656220.178
 II+III3672443893844911
Tumor size (cm)
 ≤21500.3521040.4571520.5111460.0911780.295
 >26094610621867108825
Lymph node metastasis
 No3620.17430100.22734120.20643110.24955210.257
 Yes3972644383855012

[i] −, non-LOH (NLOH); +, LOH; MIIP, migration and invasion inhibitory protein; ER, estrogen receptor; PR, progesterone receptor; LOH, loss of heterogeneity.

Table V

Univariate analysis for overall survival of breast cancer patients.

Table V

Univariate analysis for overall survival of breast cancer patients.

LociSurvival times (months)
P-value
Means95% CI
rs2295283
 −50.7348.92–52.540.035
 +42.1534.37–49.93
D1S2740
 −46.3042.25–50.340.286
 +36.1625.90–46.42
D1S489
 −49.7546.49–53.020.436
 +48.6443.33–53.95
D1S434
 −44.8740.87–48.870.782
 +45.4838.44–52.53
Overall MS loci
 −50.0948.21–51.960.054
 +46.0240.47–51.59

[i] −, non-LOH (NLOH); +, LOH; MS, microsatellite; LOH, loss of heterogeneity.

Additionally, we analyzed the correlations among the four MS/SNP markers and MIIP expression, and found MIIP expression was not affected by LOH status in the MIIP gene (Table VI).

Table VI

Relationship between the LOH status and mRNA/protein expression of MIIP gene in breast cancer.

Table VI

Relationship between the LOH status and mRNA/protein expression of MIIP gene in breast cancer.

LocimRNA expression
P-valueProtein expression
P-value
High expression/total (%)Median (min–max)
rs2295283
 −16/40 (0.40)0.45420.05 (0.95–63.04)0.424
 +2/49 (0.22)14.35 (4.04–56.67)
D1S2740
 −14/27 (0.52)0.56420.12 (1.68–40.73)0.414
 +8/13 (0.62)22.78 (3.51–63.04)
D1S489
 −17/42 (0.41)0.78816.61 (0.95–54.24)0.599
 +7/19 (0.37)16.80 (3.81–63.04)
D1S484
 −19/42 (0.45)0.91916.61 (0.95–63.45)0.470
 +7/16 (0.42)16.99 (3.51–63.04)
Overall MS loci
 −16/45 (0.36)0.54119.04 (0.95–63.45)0.877
 +16/38 (0.42)16.23 (3.51–63.04)

[i] −, non-LOH (NLOH); +, LOH; MIIP, migration and invasion inhibitory protein; LOH, loss of heterogeneity.

Discussion

Cell motility and cell cycle regulation are essential processes for normal tissue development and remodeling. Disruption of this homeostasis is involved in tumorigenesis and tumor progression through aberrant increase in cell migration and invasion as well as the loss of control for the cell cycle checkpoint. leading to genome instability (17). MIIP, as a novel candidate tumor suppressor, inhibits tumor cell migration and invasion and regulates mitosis through the IGFBP2 and histone deacetylase 6 (HDAC6) downstream target proteins (7). Song et al (6) first reported a significantly reduced MIIP expression in highly-invasive glioblastoma multiformes compared with normal brain and anaplastic glioma tissues. Subsequently, Wu et al (18) found a decrease in expression of MIIP in high-grade compared to lower-grade gliomas. Similarly, in the present study, we detected a decreased MIIP expression at the mRNA and protein level. This downregulation is more evident in patients with advanced tumor stage and larger tumor size. Therefore, MIIP may be important in the tumorigenic process and in the tumor development of breast cancer.

Although not fully elucidated, the mechanism by which MIIP is downregulated in tumors was examined in the present study. Considering its localization on chromosome 1p36 (refined in 1p36.22) where frequent deletions are observed in various cancer types (5), we hypothesized that attenuation of the MIIP gene is a genetic event contributing to carcinogenicity. However, this hypothesis was not further supported by the mutation screening of 59 glioma samples and pancreatic cancer tissues and cell lines, among which only rare frequent mutations were observed in the MIIP gene (6,10). This observation suggests that MIIP may not be a classic TSG such as p53. In the present study, we provide evidence that MIIP functions as a TSG in another important manner, similar to the CHD5 and PTEN genes whose inactivation occurs, not because of mutations but due to haploinsufficiency or the loss of one allele (11,12).

Frequent LOH of a specific chromosomal region is regarded as an indicator of a loss of a closely linked TSG. The classic method for LOH analysis is using MS markers. For its low coverage and uneven distribution on the chromosome, MS loci selected are usually distant from the relevant genes with poor representativeness (19). However, this method is prone to false-negative (such as non-symmetrical amplification phenomenon) and false-positive (such as sliding) products, affecting the determination of the results (19). SNPs are the most common and widely distributed sequence variations in the human genome. Thus, LOH status of certain SNP may be the specifically localized gene itself (15,19) and has been analyzed by many studies on other specific chromosomal loci (14,20,21).

In the present study, we selected one intragenic SNP (rs2295283) (9) and the three nearest MS loci flanking the MIIP gene (D1S2740, D1S489 and D1S434) to evaluate the LOH of the MIIP gene. In our series of 142 informative samples of paired breast tumors and normal genomic DNA counterparts, we identified 37 tumors (~26%) showing LOH, which clearly showed the allelic loss of one or more polymorphic sites within and close to the MIIP sequences. Furthermore, a significant association of allelic loss of MIIP with unfavorable overall survival in breast cancer cases was observed, strengthening the potential role of the locus in the development or progression of the breast tumors. No correlation was identified between MIIP downregulation and LOH, suggesting there may be other to-be-determined mechanisms inactivating MIIP in breast cancer, such as homozygous deletion and methylation.

In conclusion, we present direct evidence that the MIIP sequences are susceptible to LOH in breast cancer, and suggested a possible association between this gene and development or progression of this disease. We cannot exclude the possibility of other candidate TSGs on chromosome 1p36 as potential LOH targets in breast cancer, Nevertheless, the occurrence of allelic deletion in the MIIP gene and loss of the gene expression in breast tumors presented in this study are useful for further functional and clinical exploration of this gene in cancer.

Acknowledgments

We would like to thank Hongwei Han and Lei Lei for their technical assistance. The Tissue Bank is jointly supported by the Tianjin Cancer Institute and Hospital, and the National Foundation for Cancer Research (USA). This study was supported by grants from the Specialized Research Fund for the Doctoral Program of Higher Education (no. 20101202120007), the National Natural Science Foundation of China (nos. 81172762 and 81302293), and the the Chinese 863 Program (no. 2012AA02A207).

Abbreviations:

TSG

tumor-suppressor genes

MIIP

migration and invasion inhibitory protein

IIp45

invasion inhibitory protein 45

IGFBP2

insulin-like growth factor binding protein 2

SNP

single- nucleotide polymorphism

LOH

loss of heterogeneity

ER

estrogen receptor

PR

progesterone receptor

MS

microsatellite

HDAC6

histone deacetylase 6

References

1 

Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 55:74–108. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Wooster R, Bignell G, Lancaster J, Swift S, Seal S, Mangion J, Collins N, Gregory S, Gumbs C and Micklem G: Identification of the breast cancer susceptibility gene BRCA2. Nature. 378:789–792. 1995. View Article : Google Scholar : PubMed/NCBI

3 

Guan Y, Hata N, Kuga D, Yoshimoto K, Mizoguchi M, Shono T, Suzuki SO, Tahira T, Kukita Y, Higasa K, et al: Narrowing of the regions of allelic losses of chromosome 1p36 in meningioma tissues by an improved SSCP analysis. Int J Cancer. 122:1820–1826. 2008. View Article : Google Scholar

4 

Zwahlen D, Tschan MP, Grob TJ, Peters UR, Fink D, Haenggi W, Altermatt HJ, Cajot JF, Tobler A, Fey MF, et al: Differential expression of p73 splice variants and protein in benign and malignant ovarian tumours. Int J Cancer. 88:66–70. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Song SW, Fuller GN, Zheng H and Zhang W: Inactivation of the invasion inhibitory gene IIp45 by alternative splicing in gliomas. Cancer Res. 65:3562–3567. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Song SW, Fuller GN, Khan A, Kong S, Shen W, Taylor E, Ramdas L, Lang FF and Zhang W: IIp45, an insulin-like growth factor binding protein 2 (IGFBP-2) binding protein, antagonizes IGFBP-2 stimulation of glioma cell invasion. Proc Natl Acad Sci USA. 100:13970–13975. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Wang Y, Wen J and Zhang W: MIIP, a cytoskeleton regulator that blocks cell migration and invasion, delays mitosis, and suppresses tumorogenesis. Curr Protein Pept Sci. 12:68–73. 2011. View Article : Google Scholar

8 

Ji P, Smith SM, Wang Y, Jiang R, Song SW, Li B, Sawaya R, Bruner JM, Kuang J, Yu H, et al: Inhibition of gliomagenesis and attenuation of mitotic transition by MIIP. Oncogene. 29:3501–3508. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Song F, Ji P, Zheng H, Song F, Wang Y, Hao X, Wei Q, Zhang W and Chen K: Definition of a functional single nucleotide polymorphism in the cell migration inhibitory gene MIIP that affects the risk of breast cancer. Cancer Res. 70:1024–1032. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Wang Y, Yang D, Cogdell D, Hu L, Xue F, Broaddus R and Zhang W: Genomic characterization of gene copy-number aberrations in endometrial carcinoma cell lines derived from endometrioid-type endometrial adeno carcinoma. Technol Cancer Res Treat. 9:179–189. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Cairns P, Evron E, Okami K, Halachmi N, Esteller M, Herman JG, Bose S, Wang SI, Parsons R and Sidransky D: Point mutation and homozygous deletion of PTEN/MMAC1 in primary bladder cancers. Oncogene. 16:3215–3218. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Fujita T, Igarashi J, Okawa ER, Gotoh T, Manne J, Kolla V, Kim J, Zhao H, Pawel BR, London WB, et al: CHD5, a tumor suppressor gene deleted from 1p36.31 in neuroblastomas. J Natl Cancer Inst. 100:940–949. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

14 

Chosdol K, Misra A, Puri S, Srivastava T, Chattopadhyay P, Sarkar C, Mahapatra AK and Sinha S: Frequent loss of heterozy-gosity and altered expression of the candidate tumor suppressor gene ‘FAT’ in human astrocytic tumors. BMC Cancer. 9:52009. View Article : Google Scholar

15 

Schwarzenbach H, Muller V, Beeger C, Gottberg M, Stahmann N and Pantel K: A critical evaluation of loss of heterozygosity detected in tumor tissues, blood serum and bone marrow plasma from patients with breast cancer. Breast Cancer Res. 9:R662007. View Article : Google Scholar : PubMed/NCBI

16 

Xu XM, Qian JC, Cai Z, Tang T, Wang P, Zhang KH, Deng ZL and Cai JP: DNA alterations of microsatellite DNA, p53, APC and K-ras in Chinese colorectal cancer patients. Eur J Clin Invest. 42:751–759. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Hanahan D and Weinberg RA: The hallmarks of cancer. Cell. 100:57–70. 2000. View Article : Google Scholar : PubMed/NCBI

18 

Wu Y, Song SW, Sun J, Bruner JM, Fuller GN and Zhang W: IIp45 inhibits cell migration through inhibition of HDAC6. J Biol Chem. 285:3554–3560. 2010. View Article : Google Scholar :

19 

Hata N, Yoshimoto K, Yokoyama N, Mizoguchi M, Shono T, Guan Y, Tahira T, Kukita Y, Higasa K, Nagata S, et al: Allelic losses of chromosome 10 in glioma tissues detected by quantitative single-strand conformation polymorphism analysis. Clin Chem. 52:370–378. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Cvetkovic D, Pisarcik D, Lee C, Hamilton TC and Abdollahi A: Altered expression and loss of heterozygosity of the LOT1 gene in ovarian cancer. Gynecol Oncol. 95:449–455. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Wegman PP, Marcus NJ, Malakkaran BP and Wingren S: Biological significance of allele specific loss of the p53 gene in breast carcinomas. Breast Cancer Res Treat. 118:15–20. 2009. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Song F, Zhang L, Ji P, Zheng H, Zhao Y, Zhang W and Chen K: Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer. Oncol Rep 33: 2771-2778, 2015.
APA
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., & Chen, K. (2015). Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer. Oncology Reports, 33, 2771-2778. https://doi.org/10.3892/or.2015.3905
MLA
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., Chen, K."Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer". Oncology Reports 33.6 (2015): 2771-2778.
Chicago
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., Chen, K."Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer". Oncology Reports 33, no. 6 (2015): 2771-2778. https://doi.org/10.3892/or.2015.3905
Copy and paste a formatted citation
x
Spandidos Publications style
Song F, Zhang L, Ji P, Zheng H, Zhao Y, Zhang W and Chen K: Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer. Oncol Rep 33: 2771-2778, 2015.
APA
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., & Chen, K. (2015). Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer. Oncology Reports, 33, 2771-2778. https://doi.org/10.3892/or.2015.3905
MLA
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., Chen, K."Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer". Oncology Reports 33.6 (2015): 2771-2778.
Chicago
Song, F., Zhang, L., Ji, P., Zheng, H., Zhao, Y., Zhang, W., Chen, K."Altered expression and loss of heterozygosity of the migration and invasion inhibitory protein (MIIP) gene in breast cancer". Oncology Reports 33, no. 6 (2015): 2771-2778. https://doi.org/10.3892/or.2015.3905
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team