Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April-2017 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2017 Volume 37 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice

  • Authors:
    • Stéphanie Miard
    • Marie-Josée Girard
    • Philippe Joubert
    • Sophie Carter
    • Amy Gonzales
    • Huiping Guo
    • Benjamin Morpurgo
    • Louise Boivin
    • Andrei Golovko
    • Frédéric Picard
  • View Affiliations / Copyright

    Affiliations: Research Center, Quebec Heart and Lung Institute, Laval University, Québec, QC G1V 4G5, Canada, Texas A&M Institute for Genomic Medicine, College Station, TX 77843, USA
  • Pages: 2153-2160
    |
    Published online on: February 20, 2017
       https://doi.org/10.3892/or.2017.5468
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Long non-coding RNAs (lncRNA) are key regulators of gene expression both at the transcriptional and post-transcriptional levels. The lncRNA metastasis associated lung adenocarcinoma transcript 1 (Malat1) is overexpressed in many types of cancer, including hepatocarcinoma, and induces cell proliferation in several cell lines in vitro. However, the direct causal effects of Malat1 on hepatocyte proliferation and liver carcinogenesis in vivo are not fully understood. To better determine the contribution of Malat1 to hepatocarcinoma oncogenesis, this study was aimed at testing the hypothesis that its absence confers resistance to the development of liver tumors. Male Malat1-/- mice and their wild-type (WT) littermates were studied one year after treatment with the genotoxic agent diethylnitrosamine (DEN), a potent inducer of liver cancer. As expected, in WT mice, Malat1 expression was significantly higher in hepatic tumors than in healthy liver regions. Altered hepatic mRNA levels of Ki67, HDAC3, NFκB and p27 were observed in DEN-treated Malat1-/- mice. Despite this, these mice were characterized by similar liver weight, prevalence of tumors, and histological features compared to those of their WT littermates. In parallel, plasma lipids and glucose homeostasis did not significantly differ between DEN-treated groups. These findings support a role for Malat1 as a marker of liver carcinogenesis, but also suggest that its role in the regulation of hepatocyte hyperproliferation in mice is either minimal or masked by redundant and/or overwhelming mechanisms.

Introduction

Human and mouse genomes generate many transcripts that lack the capacity to produce functional proteins. These products include non-coding RNAs (ncRNA) (1). Small (<200 nucleotides) ncRNAs are involved in multiple biological processes such as neuronal development, and are potential key regulators of human diseases, including cancer (2,3). The functions and mechanisms of action of long ncRNA (lncRNA), transcripts ranging from 200 nucleotides to 100 kb, are also being uncovered, in applications ranging from cancer to epigenetics (4–8). Some of these lncRNA are expressed in a cellular compartment- or tissue-specific manner and at substantially lower levels than mRNAs (9), which suggests key regulatory roles in gene expression both at transcriptional and post-transcriptional levels (10–12).

Malat1, also known as non-coding nuclear-enriched abundant transcript 2 (Neat2), was originally identified as an lncRNA whose expression was increased in early-stage non-small cell lung cancers that later metastasized compared with those that did not progress into tumors (13). Malat1 lacks open reading frames of significant length, is highly conserved and is located in the nucleus, specifically in nuclear speckles (14), where it regulates alternative splicing (15). In addition, post-transcriptional modifications of Malat1 yield a tRNA-like 61 nt transcript (termed mascRNA) that is exported to the cytoplasm (16) for as yet elusive functions.

High expression levels of Malat1 within tumors have been associated with poor prognosis and severity of various types of cancer, including bladder (17), lung (18), gallbladder (19) and liver cancers (20). In addition, circulating Malat1 levels have also been recently shown to predict development of hepatocellular carcinoma (21,22), suggesting its possible use as a reliable biomarker. Moreover, Malat1 may be directly implicated in the development of cancer through its effect on cellular proliferation and its facilitating role in cell invasion and metastasis, two important hallmarks of cancer (18,23,24). In cultured cells, Malat1 promotes proliferation and cell motility by influencing the expression of oncogenic transcription factors (e.g., B-MYB) or motility-related genes through transcriptional and/or post-transcriptional regulation (23,25,26). Nevertheless, the direct causal contribution of Malat1 to carcinogenesis in vivo remains poorly investigated. In this study, we tested the hypothesis that absence of Malat1 impairs the development of liver carcinogenesis induced by the genotoxic agent DEN. Our results rather indicate that Malat1 ablation does not modify the susceptibility to DEN-associated hetapocarcinoma.

Materials and methods

Animals

Mutant Malat1 mice were generated using a gene-trapping technique (27) (Fig. 1A). Mice (strain C57BL/6) were cloned from an ES cell line (IST14461G11; Texas A&M Institute for Genomic Medicine, TIGM). The ES cell clone contained a retroviral insertion in the Malat1 gene identified from the TIGM gene trap database (Fig. 1B), and was microinjected into C57BL/6 host blastocysts to generate germline chimeras using standard procedures (28). The retroviral OmniBank Vector 74 contained a splice acceptor sequence (SA) followed by a 5′ selectable marker neomycin resistance genes, for identification of successful gene trap events followed by a polyadenylation signal (pA) (Fig. 1C). Insertion of the retroviral vector into the Malat1 gene led to the splicing of the endogenous upstream exons into this cassette to produce a fusion transcript and terminate expression of the RNA downstream. Chimeric males were bred to C57BL/6 females for germline transmission of the mutant Malat1 allele. The correct mutation was confirmed using PCR-based genotyping protocol using primers specific for genomic insertion site and for the vector 5′-AGAGCAGAGCAGCGTAGAGC-3′, 5′-TAACGGCCGTCAACTTAACC-3′, 5′-CCAATAAACCCTCTTGCAGTTGC-3′ (Fig. 1D). Malat1 expression levels were quantified in several tissues to confirm gene knockout (Fig. 1E). Compared to wild-type littermates, Malat1−/− mice showed an absence of Malat1 expression in all tissues studied (Fig. 1E). Notably, expression in the liver was reduced by 595-fold (Fig. 1E).

Figure 1.

Generation of the Malat1 knockout mice used in this study. (A) Basic strategy of the gene trap vectors used in C57BL/6 library (β-geo version shown). LTR, long terminal repeat; SA, splice acceptor sequence; β-geo, galactosidase/neomycin phosphotransferase fusion gene; pA, polyadenylation sequence. (B) The TIGM ES cell clone IST14461G11, found to carry mutation in Malat1, was expanded and the genomic sequence surrounding the gene trap insertion site determined [the insertion site is denoted with an asterisk (*)]. (C) Schematic representation of the mutated Malat1 locus. IST14461G11-F, IST14461G11-R and downstream rev are the primers used in genotyping [(C) and Table II]. Malat1-F and Malat1-R are primers used to confirm knockout via RT-PCR [(E) and Table II]. (D) Genotyping results showing wild-type (WT), heterozygous (Het) and homozygous (Hom) mutants using primer sets for wild-type (WT) and mutant (Mut) alleles in TIGM clone IST14461G11 for Malat1. (E) Fold change in Malat1 gene expression in knockout mice as compared to WT littermates. Assay performed with 20 ng total RNA. The assay was performed using a primer pair amplifying a 170-nt fragment of the transcript downstream of the gene trap insertion (C). Expression levels were normalized to GAPDH expression.

At 15-day-old, wild-type (WT) and Malat1−/− male littermates were injected with 5 µg/g of the potent genotoxic agent N-nitrosodiethylamine (DEN) (Sigma no. N0258) to induce liver tumors (29). Mice were weighed every day for the first 15 days and then weekly for the remaining of the protocol. Mice were exposed to a 12:12-h dark-light cycle and kept at ambient temperature of ± 2°C. Animals were euthanized by exsanguination (cardiac puncture) under ketamine/xylazine anesthesia. Tissues were collected, weighed, and snap frozen or fixed in 4% paraformaldehyde (PFA) until further processing. All mice were cared for and handled in conformance with the Canadian Guide for the Care and Use of Laboratory Animals, and protocols were approved by our institutional animal care committee.

Histology

Scoring of histologic parameters was performed by an anatomic pathologist with experience in pulmonary pathology, independently and blinded to experimental data, using an Olympus BX53 microscope. A semiquantitative scale was used to score bronchial/endobronchial, peribronchial, perivascular, interstitial, pleural and intra alveolar inflammation, capillary vascular congestion and pulmonary edema. When present, metastases were measured and photographed.

Plasma biochemistry

At sacrifice, blood was collected by intracardiac puncture and placed into a tube containing EDTA. Plasma was stored at −80°C for further biochemical analyses. Plasma cholesterol and triglycerides were measured using colorimetric assays (Thermo Fisher Scientific and Wako, respectively).

Glucose tolerance test

To evaluate glucose tolerance, mice were fasted for 12 h starting at 8 pm with free access to water. The following morning, mice were weighed, baseline glycemia was measured and mice were injected intraperitoneally with 2 g/kg of D-glucose. Glycemia was measured in blood from the tail vein at different intervals following glucose injection using an Accu-Chek performa glucometer (Roche).

RNA extraction and real-time quantitative PCR analysis

Total RNA was extracted using Aurum total RNA fatty and fibrous tissue kit (Bio-Rad). Purity, degradation state and concentration of the RNA samples were analyzed by the Experion automated electrophoresis system (Bio-Rad). cDNA was synthetized from 1 µg of RNA using qScript reverse transcriptase (Quanta Bioscience, USA) according to the manufacturer's instructions. Semi-quantitative PCR was carried using an ABI 7900. Chemical detection of the PCR products was achieved with SYBR Green Jumpstart Taq ReadyMix without MgCl2 (Sigma, Oakville, ON, USA) (30). All reactions were performed in duplicate and relative level of gene expression was determined by the standard curve method. Results were normalized to the expression level of the reference gene hypoxanthine-guanine phosphoribosyltransferase (HPRT), which did not differ between groups. PCR primers used are listed in Tables I and II.

Table I.

Primers used for the quantification of genes detailed in Fig. 5.

Table I.

Primers used for the quantification of genes detailed in Fig. 5.

Gene nameForwardReverse
HPRT AAACTTTGCTTTCCCTG AGGCTTTGTATTTGGCT
Ki67 AGGAGGCAGCTAAGGACACA ACACTTCCTTGGGGTCCTCT
P53 AGAGACCGCCGTACAGAAGAAG TTTTTATGGCGGGAAGTAGAC
HDAC3 CACCCGCATCGAGAATCAGAAC CAGCGTCGGCCTCGTCAGTC
TERT AGGGTAAGCTGGTGGAGGTT GATGCTCTGCTCGATGACAA
HDAC1 ACGGGAGGCTCTGTCGCAAGTG CCAGCCCCAATGTCCCGTAGG
NFκB GCTCAGCGGGCAGTATTCCT AGTCCCCGCGCTGCTCCTCTAT
Foxo3 GGCTCCCCAACCGGCTCCTTCAA CACGTTCCGGCGGGCATTCTGG
FoxoA1 CTCCCGGTACTTCTCTGCTG GTGGTCGAGTTGGACTGGTT
P27 CGAGCCTGGAGCGGATGGAC GCGCGGGGGCCTGTAGTAGAAC
P21 CAGGTCGGCAGGAGGCATATCTAG ATCCCAGATAAGCCCACCCC
TNFα AACTAGTGGTGCCAGCCGATG CGGACTCCGCAAAGTCTAAG
c-myc CTCGCCGCCGCTGGGAAACTT AGGGGCATCGTCGTGGCTGTCTG
CDK4 GTCAGTTTCTAAGCGGCCTG CACGGGTGTTGCGTATGTAG
IL-6 AGTTGCCTTCTTGGGACTGA CAGAATTGCCATTGCACAAC

Table II.

Primer used to assess the reduction in Malat1 expression in Malat1 knockout animals (Fig. 1E).

Table II.

Primer used to assess the reduction in Malat1 expression in Malat1 knockout animals (Fig. 1E).

Gene nameForwardReverse
Malat1 GGCAGAATGCCTTTGAAGAG (named Malat1-F in Fig. 1C) GGTCAGCTGCCAATGCTAGT (named Malat1-R in Fig. 1C)
GAPDH GGCATTGCTCTCAATGACAAC GCCATGTAGGCCATGAGGT
Data analysis

Data are presented as mean ± SEM. Statistical differences were analyzed by Chi-square, ANOVA, ANOVA repeated measures, and Fisher's tests (ad hoc) when appropriate. A p-value <0.05 was considered statistically significant.

Results

In untreated 2-month-old WT male mice, hepatic expression levels of Malat1 were lower when compared to those in other tissues (Fig. 2A). One year after DEN injection, an increase in Malat1 expression was observed in tumors when compared to that in healthy liver tissue (Fig. 2B). However, this increase in Malat1 levels was similar whether tumors developed spontaneously as function of age, or induced by DEN administration (Fig. 2B).

Figure 2.

(A) Tissue expression of Malat1 in 8-week-old C57BL/6J male mice. Data normalized to 18S levels. n=4. Sk, skeletal; vWAT, epididymal white adipose tissue; scWAT, inguinal white adipose tissue; BAT, interscapular brown adipose tissue. (B) Malat1 expression levels in the liver of 14 months old WT mice one year after injection with saline or DEN. Measures performed on RNA extracted from tumors or healthy liver tissue. *Significant effect of tissue type (2-way ANOVA, p<0.05). n=3-5.

In WT mice, DEN injection did not change total liver weight (Fig. 3A), but resulted in an increased number and prevalence of tumors (Fig. 3B). This resulted in a distorted tissue with increased number of lobes containing at least one tumor (Fig. 3C). These features equally developed in DEN-treated Malat1−/− animals (Fig. 3A-C) (no statistical difference between DEN-treated WT and Malat1−/− mice), indicating that absence of Malat1 had no impact on the incidence and severity of DEN-induced hepatocarcinoma.

Figure 3.

(A) Liver weight in WT and Malat1−/− male mice one year after saline or DEN injections. n=6. (B) Percentage of mice described in (A) with at least one tumor. *Significant effect of DEN compared to control saline group (Chi-square test, p<0.05). n=6. (C) Representative images of liver from mice described in (A). (D) Upper, from a DEN-treated WT mouse: microscopic foci of atypical cells with intra-alveolar macrophages and abundant cytoplasm, suspicious for a lung metastasis from a well-differentiated hepatocarcinoma. Size of the lesion, 0.2 mm (x200). Lower, from a DEN-treated Malat1−/− mouse: lung metastasis from a well-differentiated hepatocarcinoma. Size of the lesion, 1.5 mm (x100).

Histopathology examination of the lung and semi-quantitative histologic scaling between DEN-treated WT mice and Malat1−/− littermates revealed comparable prevalence of peribronchial (2 mice vs 0, respectively), perivascular (2 vs 4) interstitial (0 vs 0), pleural (0 vs 0), and intra-alveolar inflammation (1 vs 0). One DEN-treated WT mouse had atypical cell foci suggesting a lung metastasis, whereas one Malat1−/− mouse had well-defined, differentiated lung metastasis (Fig. 3D).

Beyond structural damage, deletion of Malat1 may have modulated hepatic metabolic functions upon DEN administration. Although DEN had no impact on plasma cholesterol levels in WT mice, it unexpectedly increased 2-fold those of Malat1−/− littermates (Fig. 4A). In contrast, no difference in triglyceride levels (Fig. 4B) or glucose tolerance (Fig. 4C) was observed between groups.

Figure 4.

(A) Plasma cholesterol and (B) triglycerides levels in overnight fasted mice one year after saline or DEN injections. Data are presented as mean ± SEM. *Significant effect of DEN compared to respective saline group (Fisher's post hoc test, p<0.05). n=4. (C) Glucose tolerance test in saline-treated mice. n=3-5. (D) Glucose tolerance test in DEN-treated mice. n=3-5.

Finally, the expression of genes involved in cell cycle and inflammation was quantified in liver tumors. Compared to their WT littermates, Malat1−/− mice showed significantly lower hepatic mRNA levels of Ki67, TERT, HDAC1, NFκB, Foxo3, p27, and IL-6 (Fig. 5). DEN treatment diminished TERT mRNA levels but increased those of IL-6 (Fig. 5). No significant interaction between genotype and DEN administration was observed, indicating that absence of Malat1 did not modify the transcriptional response to DEN in hepatic tumors.

Figure 5.

Gene mRNA levels in liver of WT and Malat1−/− mice one year after saline or DEN injections. Measures performed on RNA extracted from tumors. Bars represent mean ± SEM. G and D indicate a statistically significant difference (p<0.05) main effect of genotype and DEN, respectively, as analyzed by 2-way ANOVA. No G × D interaction detected. n=3-6.

Discussion

Many studies performed in cultured cells have demonstrated a stimulating role of Malat1 on cancer cell proliferation (20,31,32). Malat1 expression is increased during normal cell cycle progression in normal diploid human fibroblasts and has been found important for G1/S and mitotic division (23). Accordingly, Malat1 is overexpressed in various cancer types including lung, liver and breast cancer, and is associated with a poor prognostic (26). Moreover, Malat1 overexpression has been shown to predict tumor recurrence of hepatocellular carcinoma after liver transplantation (20). Despite these findings, the role of Malat1 in tumorigenesis in vivo is still not established. This study tested whether genetic deletion of Malat1 in mice impaired the development of hepatocarcinoma induced by the genotoxic agent DEN, a well-known regimen for the induction of hepatocellular carcinoma (29).

Compared to its levels in many tissues, Malat1 expression was low in liver of young and healthy WT mice. In tumors, Malat1 was 2- to 3-fold higher than in healthy liver tissue; however, no further increase was observed upon DEN treatment. This indicates that Malat1 expression may have reached a plateau in actively proliferating hepatocytes, perhaps due to mutual inhibition by YAP and SRSF1 (33). In this context, it was thus expected that genetic ablation of Malat1 would in theory translate into large, physiologically relevant impacts in a model in which increased expression of Malat1 normally occurs. However, the main finding of this study is that Malat1−/− mice are as susceptible to DEN-induced liver cancer as WT mice. Beyond this, Malat1 may be implicated in the development of cancer through its involvement in facilitating invasion and metastasis (23,24,34). However, we found no significant difference in the prevalence of pulmonary inflammation or lung metastases between WT and Malat1−/− mice. This could be attributable to the experimental regimen, as DEN is a powerful genotoxic agent that may bypass some of the tumorigenic pathways triggered by Malat1. In this view, it would be interesting to test the influence of Malat1 in other tumor-inducing contexts, such as tobacco-induced lung cancer.

Genetic deletion of Malat1 (complete germline knockout) in mice has very little impact on pre- and post-natal development and on adult phenotypes when tested in normal conditions, as shown by three independent groups (35–38). The findings observed in the mouse line used herein also show that the basal modulation of glucose and lipid metabolism, functions regulated by the liver, were not affected by the absence of Malat1, at least in the fasted state. Although triglyceridemia and glucose tolerance were similar between WT and Malat1−/− littermates in response to DEN, plasma cholesterol levels were robustly increased in DEN-treated Malat1−/− mice. Thus, Malat1 may play important roles in the regulation of cholesterol homeostasis. Interestingly, a recent report showed that, in contrast, Malat1 expression is high in the fatty liver of obese ob/ob mice, and that it promotes cholesterol accumulation in HepG2 hepatocytes by increasing SREBP1-c protein stability (39). Thus, these observations suggest that Malat1 may exert beneficial impacts on cholesterol metabolism in a manner dependent upon conditions in which liver functions are perturbed. The mechanisms for these divergent effects could be independent from obesity-associated, IL-6-induced liver inflammation and tumorigenesis (40), since Malat1 deficiency did not modify the increase in IL-6 expression triggered by DEN treatment. Therefore, the role of Malat1 on cholesterol homeostasis remains to be established in vivo in different settings, including non-alcoholic fatty liver disease (NAFLD).

In vitro (17, 25, 32) and in a mouse model of xenografts (18), Malat1 was shown to stimulate cytoskeleton components, cell proliferation, and cellular motility of cancer cells through impacting gene transcription, not alternative splicing per se (18). Consistent with these findings, our study shows that absence of Malat1 results in a significant downregulation of many genes involved in cell cycle and inflammation. Nonetheless, the observed changes in gene expression were not sufficient to induce a robust and specific phenotype. It remains to be investigated whether knockout of Malat1 modified the expression of genes through cis-regulatory mechanism as previously reported in other cell types (38).

A study performed in metastatic renal cell carcinoma has suggested Malat1 as a putative FoxP3 target gene (41). Interestingly, this family of transcription factors has been shown to be involved in the sexual dimorphism observed in the development of liver cancer (42). Since female mice are not affected by DEN exposure (29), it would be interesting to test whether this dimorphism exists in Malat1−/− mice using other types of carcinogens or by crossing Malat1−/− mice with susceptible transgenic strains.

In conclusion, we hypothesized that absence of Malat1 would confer resistance to liver carcinogenesis induced by DEN. As expected, DEN treatment stimulated an increase in liver tumors, and number of lobes with at least one tumor. However, these changes were completely similar to those observed in Malat1−/− mice, despite differences in their transcriptional mRNA profiles. In conclusion, gene deletion of Malat1 does not impact cell proliferation upon DEN-induced hepatocarcinoma in vivo. Thus, in this model, the role of Malat1 in the regulation of hepatocyte proliferation is either minimal or masked by redundant and/or overwhelming mechanisms, not present in in vitro settings, including hormonal cues. Since Malat1 has been found to be highly upregulated in many other types of cancer, the impact of Malat1 deficiency to the in vivo development of these diseases remains to be investigated.

Acknowledgements

This study was supported by a grant from the Natural Sciences and Engineering Research Council (NSERC) of Canada to F.P. M.J.G. was a recipient of an MSc studenship from the Fonds d'enseignement et de recherche - FER from Laval University/Faculty of Pharmacy. S.C. is the recipient of a PhD studentship award from the Fonds de Recherche du Québec-Santé (FRQS). F.P. holds a Senior Scholar Award from the FRQS.

References

1 

Ankö ML and Neugebauer KM: Long non-coding RNAs add another layer to pre-mRNA splicing regulation. Mol Cell. 39:833–834. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Rottiers V and Näär AM: MicroRNAs in metabolism and metabolic disorders. Nat Rev Mol Cell Biol. 13:239–250. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Stefani G and Slack FJ: Small non-coding RNAs in animal development. Nat Rev Mol Cell Biol. 9:219–230. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Li J, Meng H, Bai Y and Wang K: Regulation of lncRNA and its role in cancer metastasis. Oncol Res. 23:205–217. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Dhamija S and Diederichs S: From junk to master regulators of invasion: lncRNA functions in migration, EMT and metastasis. Int J Cancer. 139:269–280. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Betancur JG: Pervasive lncRNA binding by epigenetic modifying complexes - The challenges ahead. Biochim Biophys Acta. 1859:93–101. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Blythe AJ, Fox AH and Bond CS: The ins and outs of lncRNA structure: How, why and what comes next? Biochim Biophys Acta. 1859:46–58. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Sun M, Nie FQ, Wang ZX and De W: Involvement of lncRNA dysregulation in gastric cancer. Histol Histopathol. 31:33–39. 2016.PubMed/NCBI

9 

Kaikkonen MU, Lam MT and Glass CK: Non-coding RNAs as regulators of gene expression and epigenetics. Cardiovasc Res. 90:430–440. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Rinn JL and Chang HY: Genome regulation by long non-coding RNAs. Annu Rev Biochem. 81:145–166. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long non-coding RNAs. Cell. 136:629–641. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Wilusz JE, Sunwoo H and Spector DL: Long non-coding RNAs: Functional surprises from the RNA world. Genes Dev. 23:1494–1504. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Ji P, Diederichs S, Wang W, Böing S, Metzger R, Schneider PM, Tidow N, Brandt B, Buerger H, Bulk E, et al: MALAT-1, a novel non-coding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031–8041. 2003. View Article : Google Scholar : PubMed/NCBI

14 

Hutchinson JN, Ensminger AW, Clemson CM, Lynch CR, Lawrence JB and Chess A: A screen for nuclear transcripts identifies two linked non-coding RNAs associated with SC35 splicing domains. BMC Genomics. 8:392007. View Article : Google Scholar : PubMed/NCBI

15 

Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, et al: The nuclear-retained non-coding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 39:925–938. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Wilusz JE, Freier SM and Spector DL: 3′ end processing of a long nuclear-retained non-coding RNA yields a tRNA-like cytoplasmic RNA. Cell. 135:919–932. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Ying L, Chen Q, Wang Y, Zhou Z, Huang Y and Qiu F: Upregulated MALAT-1 contributes to bladder cancer cell migration by inducing epithelial-to-mesenchymal transition. Mol Biosyst. 8:2289–2294. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Gutschner T, Hämmerle M, Eissmann M, Hsu J, Kim Y, Hung G, Revenko A, Arun G, Stentrup M, Gross M, et al: The non-coding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res. 73:1180–1189. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Wang SH, Zhang WJ, Wu XC, Zhang MD, Weng MZ, Zhou D, Wang JD and Quan ZW: Long non-coding RNA Malat1 promotes gallbladder cancer development by acting as a molecular sponge to regulate miR-206. Oncotarget. 7:37857–37867. 2016.PubMed/NCBI

20 

Lai MC, Yang Z, Zhou L, Zhu QQ, Xie HY, Zhang F, Wu LM, Chen LM and Zheng SS: Long non-coding RNA MALAT-1 overexpression predicts tumor recurrence of hepatocellular carcinoma after liver transplantation. Med Oncol. 29:1810–1816. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Luo F, Sun B, Li H, Xu Y, Liu Y, Liu X, Lu L, Li J, Wang Q, Wei S, et al: A MALAT1/HIF-2α feedback loop contributes to arsenite carcinogenesis. Oncotarget. 7:5769–5787. 2016.PubMed/NCBI

22 

Konishi H, Ichikawa D, Yamamoto Y, Arita T, Shoda K, Hiramoto H, Hamada J, Itoh H, Fujita Y, Komatsu S, et al: Plasma level of metastasis-associated lung adenocarcinoma transcript 1 is associated with liver damage and predicts development of hepatocellular carcinoma. Cancer Sci. 107:149–154. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Tripathi V, Shen Z, Chakraborty A, Giri S, Freier SM, Wu X, Zhang Y, Gorospe M, Prasanth SG, Lal A, et al: Long non-coding RNA MALAT1 controls cell cycle progression by regulating the expression of oncogenic transcription factor B-MYB. PLoS Genet. 9:e10033682013. View Article : Google Scholar : PubMed/NCBI

24 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Tano K, Mizuno R, Okada T, Rakwal R, Shibato J, Masuo Y, Ijiri K and Akimitsu N: MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett. 584:4575–4580. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Gutschner T, Hämmerle M and Diederichs S: MALAT1 - a paradigm for long non-coding RNA function in cancer. J Mol Med (Berl). 91:791–801. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Hansen GM, Markesich DC, Burnett MB, Zhu Q, Dionne KM, Richter LJ, Finnell RH, Sands AT, Zambrowicz BP and Abuin A: Large-scale gene trapping in C57BL/6N mouse embryonic stem cells. Genome Res. 18:1670–1679. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Hogan B, Beddington R, Costantini F and Lacy E: Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory Press; New York, NY: 1994

29 

Fausto N and Campbell JS: Mouse models of hepatocellular carcinoma. Semin Liver Dis. 30:87–98. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Miard S, Dombrowski L, Carter S, Boivin L and Picard F: Aging alters PPARgamma in rodent and human adipose tissue by modulating the balance in steroid receptor coactivator-1. Aging Cell. 8:449–459. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Guo F, Li Y, Liu Y, Wang J, Li Y and Li G: Inhibition of metastasis-associated lung adenocarcinoma transcript 1 in CaSki human cervical cancer cells suppresses cell proliferation and invasion. Acta Biochim Biophys Sin (Shanghai). 42:224–229. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Han Y, Liu Y, Nie L, Gui Y and Cai Z: Inducing cell proliferation inhibition, apoptosis, and motility reduction by silencing long non-coding ribonucleic acid metastasis-associated lung adenocarcinoma transcript 1 in urothelial carcinoma of the bladder. Urology. 81:209.e201–207. 2013. View Article : Google Scholar

33 

Wang J, Wang H, Zhang Y, Zhen N, Zhang L, Qiao Y, Weng W, Liu X, Ma L, Xiao W, et al: Mutual inhibition between YAP and SRSF1 maintains long non-coding RNA, Malat1-induced tumourigenesis in liver cancer. Cell Signal. 26:1048–1059. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Gutschner T and Diederichs S: The hallmarks of cancer: A long non-coding RNA point of view. RNA Biol. 9:703–719. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Nakagawa S, Naganuma T, Shioi G and Hirose T: Paraspeckles are subpopulation-specific nuclear bodies that are not essential in mice. J Cell Biol. 193:31–39. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Nakagawa S, Ip JY, Shioi G, Tripathi V, Zong X, Hirose T and Prasanth KV: Malat1 is not an essential component of nuclear speckles in mice. RNA. 18:1487–1499. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Eissmann M, Gutschner T, Hämmerle M, Günther S, Caudron-Herger M, Gross M, Schirmacher P, Rippe K, Braun T, Zörnig M, et al: Loss of the abundant nuclear non-coding RNA MALAT1 is compatible with life and development. RNA Biol. 9:1076–1087. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Zhang B, Arun G, Mao YS, Lazar Z, Hung G, Bhattacharjee G, Xiao X, Booth CJ, Wu J, Zhang C, et al: The lncRNA Malat1 is dispensable for mouse development but its transcription plays a cis-regulatory role in the adult. Cell Rep. 2:111–123. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Yan C, Chen J and Chen N: Long non-coding RNA MALAT1 promotes hepatic steatosis and insulin resistance by increasing nuclear SREBP-1c protein stability. Sci Rep. 6:226402016. View Article : Google Scholar : PubMed/NCBI

40 

Park EJ, Lee JH, Yu GY, He G, Ali SR, Holzer RG, Osterreicher CH, Takahashi H and Karin M: Dietary and genetic obesity promote liver inflammation and tumorigenesis by enhancing IL-6 and TNF expression. Cell. 140:197–208. 2010. View Article : Google Scholar : PubMed/NCBI

41 

Schwarzer A, Wolf B, Fisher JL, Schwaab T, Olek S, Baron U, Tomlinson CR, Seigne JD, Crosby NA, Gui J, et al: Regulatory T-cells and associated pathways in metastatic renal cell carcinoma (mRCC) patients undergoing DC-vaccination and cytokine-therapy. PLoS One. 7:e466002012. View Article : Google Scholar : PubMed/NCBI

42 

Li Z, Tuteja G, Schug J and Kaestner KH: Foxa1 and Foxa2 are essential for sexual dimorphism in liver cancer. Cell. 148:72–83. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Miard S, Girard M, Joubert P, Carter S, Gonzales A, Guo H, Morpurgo B, Boivin L, Golovko A, Picard F, Picard F, et al: Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice. Oncol Rep 37: 2153-2160, 2017.
APA
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H. ... Picard, F. (2017). Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice. Oncology Reports, 37, 2153-2160. https://doi.org/10.3892/or.2017.5468
MLA
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H., Morpurgo, B., Boivin, L., Golovko, A., Picard, F."Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice". Oncology Reports 37.4 (2017): 2153-2160.
Chicago
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H., Morpurgo, B., Boivin, L., Golovko, A., Picard, F."Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice". Oncology Reports 37, no. 4 (2017): 2153-2160. https://doi.org/10.3892/or.2017.5468
Copy and paste a formatted citation
x
Spandidos Publications style
Miard S, Girard M, Joubert P, Carter S, Gonzales A, Guo H, Morpurgo B, Boivin L, Golovko A, Picard F, Picard F, et al: Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice. Oncol Rep 37: 2153-2160, 2017.
APA
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H. ... Picard, F. (2017). Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice. Oncology Reports, 37, 2153-2160. https://doi.org/10.3892/or.2017.5468
MLA
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H., Morpurgo, B., Boivin, L., Golovko, A., Picard, F."Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice". Oncology Reports 37.4 (2017): 2153-2160.
Chicago
Miard, S., Girard, M., Joubert, P., Carter, S., Gonzales, A., Guo, H., Morpurgo, B., Boivin, L., Golovko, A., Picard, F."Absence of Malat1 does not prevent DEN-induced hepatocarcinoma in mice". Oncology Reports 37, no. 4 (2017): 2153-2160. https://doi.org/10.3892/or.2017.5468
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team