Open Access

miRNA‑7515 suppresses pancreatic cancer cell proliferation, migration and invasion via downregulating IGF‑1 expression

  • Authors:
    • Shan Lei
    • Zhirui Zeng
    • Zhiwei He
    • Wenpeng Cao
  • View Affiliations

  • Published online on: July 22, 2021     https://doi.org/10.3892/or.2021.8151
  • Article Number: 200
  • Copyright: © Lei et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Pancreatic cancer (PC) is a lethal malignancy of the gastrointestinal tract. Previous studies have reported that microRNAs (miRNAs/miRs) are involved in the tumorigenesis of PC. Therefore, the present study aimed to determine the effects of miR‑7515 on PC cell proliferation, invasion and migration in vitro and in vivo, and investigate its underlying molecular mechanism using bioinformatics, double luciferase assay and western blotting. The results revealed that the expression levels of miR‑7515 were downregulated in PC, which predicted a poor clinical outcome. The overexpression of miR‑7515 significantly decreased the proliferation, invasive and migratory abilities of PC cells in vitro and in vivo, while the knockdown of miR‑7515 exerted the opposite effects. miR‑7515 was identified to directly bind to insulin‑like growth factor 1 (IGF‑1) and downregulate its expression, which subsequently downregulated the Ras/Raf/MEK/ERK signalling pathway. The overexpression of IGF‑1 reversed the inhibitory effects of miR‑7515 overexpression on PC cells. In conclusion, the findings of the present study indicated that miR‑7515 may act as a tumor suppressor in PC, as it repressed PC cell proliferation invasion and migration via downregulating the expression of IGF‑1 and the activity of the Ras/Raf/MEK/ERK signalling pathways.

Introduction

Pancreatic cancer (PC) is an aggressive malignant tumor with a 5-year survival rate of <5% (1,2). Although considerable efforts have been made in improving the effectiveness of surgical resection and chemotherapy for PC, the remission and survival rates remain poor (3,4). The most significant challenge for PC therapy is that the underlying molecular mechanism of its pathogenesis is largely unknown. Therefore, it remains an urgent priority to determine the molecular mechanisms underlying the development of PC.

MicroRNAs (miRNAs/miRs) are a class of non-coding RNAs consisting of 20–22 nucleotides in length, which regulate gene expression via directly binding to target mRNAs (5,6). Previous studies have reported the role of numerous miRNAs in the tumorigenesis of PC (710). For example, a previous study demonstrated that miR-221 induced autophagy and promoted PC cell apoptosis via downregulating the expression of histone deacetylase 1 (11). In another study, the expression levels of miR-661 were revealed to be upregulated in PC tissues, which predicted a poor clinical outcome in patients with PC (12). By inhibiting Beclin-1-induced autophagy, miR-216a also increased the radiosensitivity of PC cells (13). Moreover, miR-148a played a tumor-suppressive role in PC via suppressing the Wnt/β-catenin signaling pathway and inhibiting epithelial-mesenchymal transition (14). Insulin-like growth factor (IGF)-1 was revealed to be abundantly expressed in PC tissues, and could activate insulin/IGF-related signalling pathways to regulate the proliferation, migration and invasion of PC cells (15). Numerous previous studies have indicated that IGF-1 may function as an oncogene in PC and represent an effective target for treatment (1618).

The present study aimed to investigate the expression levels of miR-7515 in PC tissues and cell lines, and to determine whether its effects on the proliferation, migration and invasion of PC cells were mediated via regulation of IGF-1. The results of the present study may provide novel insights into whether miR-7515 and its target gene, IGF-1, may represent novel biomarkers for the diagnosis and clinical treatment of PC.

Materials and methods

Patients

PC and adjacent normal tissues were obtained from 82 patients with PC (age range, 35–73 years; 42 males and 40 females) at the Department of Hepatobiliary Surgery, Guizhou Medical University (Guiyang, China) between March 2017 and April 2020. None of patients enrolled in the present study had received neoadjuvant chemotherapy, radiotherapy or immunotherapy prior to surgery. Written informed consent was obtained from all patients prior to participation and the experimental protocol was approved (approval no. 31) by the Human Research Ethics Review Committee of Guizhou Medical University (Guiyang, China).

Cell lines and culture

The human PC cell lines, AsPC-1, BXPC-3, SW1990 and PANC-1, and a normal pancreatic epithelial cell line, HPDE, were obtained from the American Type Culture Collection. The cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), and maintained in an environment with 5% CO2 at 37°C. PD98059, a MEK inhibitor, was purchased from PharMingen; BD Biosciences. A solution of PD98059 (50 µM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich; Merck KGaA) was prepared and used after diluting with medium for each assay. DMSO was also used as a blank control.

Cell transfection

The miR-7515 inhibitor (GCCUGUUAGCAUGAAAAAA) and miR-negative control (NC) inhibitor (CGGAACAGAUCAUACUUGCCUU) were obtained from Shanghai GeneChem Co., Ltd. A 2nd-generation lentiviral system was used, miR-7515 expression lentivirus was generated by subcloning the PCR amplified full length human miR-7515 cDNA into the pMSCV retrovirus plasmid by transient transfection of 293T (GeneCopoeia, Inc.). Empty pMSCV retrovirus plasmid was used as a negative control for miR-7515 expression lentivirus. AsPC-1 and BXPC-3 cells were seeded into 6-well plates at a density of 1×105 cells/well. After the cells had adhered, a lentivirus was added according to manufacturer's protocol (2 µg/ml; MOI=5 for BXPC-3; and MOI=10 for AsPC-1). To obtain stably overexpressing miR-7515 cells or stable knockdown cells, cells were selected for 14 days using 1 g/ml puromycin 48 h after transfection. miR-7515 overexpression lentivirus and the lentivirus miRNA NC (LV-miR-NC) were obtained from GeneCopoeia, Inc. The IGF-1 overexpression and NC plasmids (5 µg/ml) were obtained from Sangon Biotech Co., Ltd. Cells were transfected 48 h after transfection at 37°C with the oligonucleotides and plasmids using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. After 48 h of transfection, the cells were collected for further use in the following experiments.

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from PC tissues and cell lines using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). mRNA was reverse-transcribed into cDNA using the SuperScript IV Reverse Transcriptase kit (Thermo Fisher Scientific, Inc.), while miRNA was reverse transcribed into cDNA using TaqMan™ MicroRNA Reverse Transcription kit (Thermo Fisher Scientific, Inc.). qPCR was subsequently performed using a PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific, Inc.). All the kits were used according to the manufacturer's instructions. GAPDH was used as the reference gene for IGF-1 expression, while U6 was used as the reference gene for miR-7515 expression. The following primer sequences were used for the qPCR: miR-7515, 5′-AGAAGGGAAGATGGTGAC-3′; IGF-1 forward, 5′-GCTCTTCAGTTCGTGTGTGGA-3′ and reverse, 5′-GCCTCCTTAGATCACAGCTCC-3′; GAPDH forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′; U6 forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′. The reaction conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 1 sec and 60°C for 60 sec. Relative expression levels of the target mRNA or miRNA were determined using the 2−ΔΔCq method (19).

Cell Counting Kit-8 (CCK-8) assay

PC cells were seeded into 96-well plates at a density of 2×103 cells/well and incubated at 37°C for 6, 24, 48, 72 or 96 h. Following incubation, the medium was removed and 100 µl fresh DMEM containing 10 µl CCK-8 reagent (Wuhan Boster Biological Technology, Ltd.) was added to each well. The cells were subsequently incubated with 5% CO2 at 37°C for 2 h. The absorbance of each well was measured at a wavelength of 450 nm using a microplate spectrophotometer (Bio-Rad Laboratories, Inc.).

Colony formation assay

Following transfection, PC cells were plated into 6-well plates at a density of 1×103 cells/well. Following 14 days of incubation at 37°C, the medium was removed and the cell colonies were fixed with 4% paraformaldehyde for 15 min at room temperature (Wuhan Servicebio Technology Co., Ltd.) and stained with 0.5% crystal violet for 30 min at room temperature (Wuhan Servicebio Technology Co., Ltd.). The cells were washed with PBS to remove the excess crystal violet and images of the colonies were captured and the number of colonies (≥10 mm2) was counted under the naked eye.

Cell cycle distribution analysis

Cell cycle distribution was determined using flow cytometric analysis. Briefly, PC cells were harvested, washed with cold PBS and fixed with 70% ethyl alcohol at 4°C for 24 h. The PC cells were subsequently collected by centrifugation at 4°C, 300 × g for 30 min and resuspended in staining solution containing propidium iodide (Invitrogen; Thermo Fisher Scientific, Inc.). and 1X binding buffer at room temperature for 30 min. Following a 30-min incubation in the dark, the samples were analyzed using a flow cytometer (BD Biosciences). The results of the cell cycle distribution were analyzed using FlowJo software version 7.4.1 (FlowJo LLC).

Wound healing assay

PC cells were cultured in DMEM supplemented with 10% FBS at 37°C in 6-well plates until they reached 95% confluence. Then, artificial wounds were produced by scratching the cell monolayer with a 200-µl pipette tip. After removing the nonadherent cells with PBS, the cells were cultured in the serum-free DMEM and cultured for 24 h. The wound area was visualized at 0 and 24 h under a phase-contrast microscope at a magnification of ×100.

Transwell invasion assay

PC cells (1×105) were suspended in 200 µl serum-free DMEM and plated into the upper chambers of a Transwell plate (8 µm pore size; Corning, Inc.), which was precoated at 37°C with 100 µl Matrigel (BD Biosciences). A total of 700 µl DMEM supplemented with 10% FBS was plated into the lower chambers of the Transwell plate to act as a chemoattractant. Following incubation at 37°C for 24 h, the non-invasive cells were removed with a cotton swab, and the invasive cells were fixed for 15 min at room temperature with 4% paraformaldehyde and stained for 30 min at room temperature with 0.5% crystal violet solution. Invasive cells were visualized (magnification, ×40) in five randomly selected fields of view and the number of invasive cells/field was calculated under a phase-contrast microscope.

Animal studies

A total of 10 male BALB/c nude mice (weight, 16–18 g; 4–6 weeks old) were purchased from the Experimental Animal Centre of Guizhou Medical University (Guiyang, China). All nude mice were allowed free access to food and water and maintained on a 12-h light/dark cycle, with controlled temperature (22.5±2°C) and humidity (45±5%). To determine tumor cell proliferation, 1×106 with 100 µl of PANC-1 cell suspension overexpressing miR-7515 or transfected with LV-miR-NC were subcutaneously injected into the right axilla of the BALB/c nude mice. Tumor growth was assessed once a week, and after 5 weeks, the mice were anesthetized via an intraperitoneal injection of 50 mg/kg sodium pentobarbital and euthanized by cervical dislocation. Tumor tissues were collected for subsequent analysis; the maximum tumor volume observed in the present study was 400 mm3.

For live metastasis detection, 1×107 PANC-1 cells overexpressing miR-7515 or transfected with LV-miR-NC were resuspended in 100 µl PBS and injected into the spleen of the mice (n=5 mice/group). The health of nude mice was observed once a day, and after 12 weeks, mice were anesthetized via an intraperitoneal injection of 50 mg/kg sodium pentobarbital solution and euthanized by cervical dislocation. The liver tissues were separated and the metastatic foci were counted. Furthermore, metastasis foci in the liver tissues were also detected using hematoxylin and eosin (H&E) staining. Paraffin-embedded specimens were cut into serial sections of 5-µm thickness with a microtome. Sections were deparaffinized in xylene, rehydrated through a graded ethanol series and stained for 30 min at room temperature automatically with H&E. Then images were captured using an upright light microscope (magnification, ×200; Olympus Corporation). All animal experiments were performed in strict accordance with the Guide for the Care and Use of Laboratory Animals (20). The animal experimental protocols were approved (approval no. 2000025) by the Ethics Committee of Guizhou Medical University (Guiyang, China).

Immunohistochemical analysis

Tissues were fixed in 4% paraformaldehyde for 30 min at room temperature in formalin, embedded in paraffin and cut into 2-µm sections. The sections were incubated at 65°C for 30 min, deparaffinized with xylene and rehydrated using a gradient series of ethanol. Antigen retrieval was performed using sodium citrate (Wuhan Servicebio Technology Co., Ltd.) then endogenous peroxidase activity was blocked for 15 min at room temperature with 3% H2O2 (Wuhan Servicebio Technology Co., Ltd.). The sections were subsequently blocked for non-specific binding with 5% BSA for 15 min at room temperature (Wuhan Servicebio Technology Co., Ltd.), and incubated overnight at 4°C with anti-Ki67 (1:200; cat. no. 27309-1-AP; ProteinTech Group, Inc.) or anti-proliferating cell nuclear antigen (PCNA; 1:200; cat. no. 10205-2-AP; ProteinTech Group, Inc.) primary antibodies. Following the incubation, the sections were washed with PBS three times for 5 min and incubated with a goat anti-mouse/rabbit poly-HRP secondary antibody (1:500; cat. no. PR30009; ProteinTech Group, Inc.) for 2 h. A diaminobenzidine (DAB) kit (Wuhan Boster Biological Technology, Ltd.) was used to visualize the antibody-antigen binding. Images were captured using an upright metallurgical microscope (×200; Olympus Corporation).

Bioinformatics analysis

The expression of miR-7515 in pancreatic cancer tissues and adjacent tissues was first assessed by The Cancer Genome Atlas (TCGA) (https://www.cancer.gov/types) and Genotype-Tissue Expression (GTex) (http://commonfund.nih.gov/GTEx/) databases. The parameters were as follows: LogFC >1 and a P-value <0.05. The online database, TargetScan 7.2 (http://www.targetscan.org/vert_72/), was used to predict the target genes of miR-7515. The Database for Annotation, Visualization and Integrated Discovery (https://david.ncifcrf.gov/) was used to determine the significantly enriched Kyoto Encyclopedia of Genes and Genomes signaling pathway enrichment of miR-7515 target genes. Finally, RStudio software (version: 8.1.2; IBM Corp.) was used to visualize the pathway enrichment. Target genes of miR-7515 in the most significantly enriched pathway were further analyzed.

Dual-luciferase reporter assay

SW1990 and PANC-1 cells were plated into 24-well plates and cultured with 5% CO2 at 37°C until they reached 70% confluence. Then, the psiCHECK-2/IGF-1 3′-untranslated region (UTR) wild-type (WT) and psiCHECK-2/IGF-1 3′-UTR mutant type (Mut) reporter plasmids (Shanghai GeneChem Co., Ltd.) were transfected into 5×105 SW1990 and PANC-1 cells overexpressing miR-7515 or transfected with the LV-miR-NC using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Following 24 h of transfection, SW1990 and PANC-1 cells were collected, and the fluorescence activity was detected using a Dual Luciferase Reporter assay system (Promega Corporation). Subsequently, the luciferase activity was normalized to the firefly luciferase internal control.

Western blotting

Total protein was extracted from PC cells using RIPA lysis buffer (Wuhan Servicebio Technology Co., Ltd.) supplemented with 1% PMSF (Wuhan Servicebio Technology Co., Ltd.). Total protein was quantified using a BCA method and separated via 10% SDS-PAGE (Melone pharmaceutical Co., Ltd). The separated proteins (30 µg per lane) were subsequently transferred onto PVDF membranes (BD Biosciences) and blocked with 5% BSA for 2 h at room temperature. The membranes were then incubated with the following primary antibodies overnight at 4°C: Anti-IGF1 (1:1,000; cat. no. A12305; ABclonal Biotech Co., Ltd.), p-c-Raf (1:1,000; product code ab150365; Abcam), anti-c-Raf (1:1,000; product no. 53745; Cell Signaling Technology, Inc.), p-ribosomal protein S6 kinase α-1 (p-p90Rsk; 1:1,000; product no. 12032; Cell Signaling Technology, Inc.), anti-p90Rsk (1:1,000; product code ab32114; Abcam), anti-p-MEK1/2 (1:1,000; product no. 2338; Cell Signaling Technology, Inc.), anti-MEK1/2 (1:1,000; product no. 4694; Cell Signaling Technology, Inc.), anti-p-ERK1/2 (1:1,000; product no. 8544; Cell Signaling Technology, Inc.), anti-ERK1/2 (1:1,000; cat. no. 16443-1-AP; ProteinTech Group, Inc.), anti-cyclin D1 (1:1,000; cat. no. 26939-1-AP; ProteinTech Group, Inc.), anti-CDK2 (1:1,000; cat. no. 10122-1-AP; ProteinTech Group, Inc.), anti-MMP2 (1:1,000; cat. no. 10373-2-AP; ProteinTech Group, Inc.), anti-MMP9 (1:1,000; cat. no. 10375-2-AP; ProteinTech Group, Inc.) and anti-GAPDH (1:1,000; cat. no. 60004-1-Ig; ProteinTech Group, Inc.). Following the primary antibody incubation, the membranes were washed with TBST (TBS with 0.1% Tween-20) thrice and incubated with secondary antibodies at room temperature (1:5,000; cat. nos. BA1038 and BA1039; Wuhan Boster Biological Technology, Ltd.) for 2 h. Protein bands were visualized using ECL reagent (Wuhan Boster Biological Technology, Ltd.) on a Gel imager (Bio-Rad Laboratories, Inc.). The total c-Raf, p90Rsk, MEK and ERK1/2 antibodies were used on the same blots as the respective phosphorylated proteins after stripping (Bio-Rad Laboratories, Inc.). Image-Pro Plus 5.1 software was used to analyze the expression of protein, while GAPDH was used as a loading control.

Statistical analysis

All experiments were repeated 3 times and the data was averaged. The data are presented as the mean ± standard deviation (SD). Statistical analysis was performed using SPSS 20.0 software (IBM Corp.). The association between miR-7515 expression and clinicopathological characteristics of patients with PC was analyzed using a χ2 test. The correlation between miR-7515 and IGF-1 expression levels was analyzed using Pearson's correlation analysis. Comparisons were performed using a one-way ANOVA combined with LSD-t-test or a paired Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-7515 expression levels are downregulated in PC

TCGA and GTex databases were first used to analyze the expression levels of miR-7515 in human normal and PC tissues. The results revealed that miR-7515 expression levels were significantly downregulated in PC tissues (Fig. 1A). Next, the expression of miR-7515 in 82 PC and adjacent normal tissues was determined. RT-qPCR analysis demonstrated that the expression levels of miR-7515 were also downregulated in PC tissues compared with adjacent normal tissues (Fig. 1B). To determine the prognostic value of miR-7515, patients were divided into two groups (high and low expression levels of miR-7515) using the median expression value of 2.7; tissues with miR-7515 expression of >2.7 were defined as high expression, while tissues with miR-7515 expression of <2.7 were defined as low expression. The results revealed that low expression levels of miR-7515 predicted a lower survival rate (Fig. 1C). The expression levels of miR-7515 were also revealed to be negatively associated with tumor size, lymph node metastasis, TNM stage, distant metastasis, perineural invasion and blood vessel invasion (Table I). In addition, the expression levels of miR-7515 were significantly downregulated in PC cells compared with the normal pancreatic epithelial cell line, HPDE (Fig. 1D).

Table I.

Association between miR-7515 expression levels and the clinicopathological characteristics of patients with PC.

Table I.

Association between miR-7515 expression levels and the clinicopathological characteristics of patients with PC.

miR-7515 expression

FeaturesnLowHighχ2P-value
All cases824141
Age (years) 0.440.507
  <60392118
  ≥60432023
Sex 0.1950.695
  Males422220
  Females401921
Tumor size (cm) 7.130.008
  <2361224
  ≥2462917
Lymph node metastasis 10.630.001
  Negative28721
  Positive543420
TNM stage 12.424<0.001
  I and II27621
  III and IV553520
Distant metastasis 4.4810.027
  Negative401525
  Positive422616
Perineural invasion 14.233<0.001
  Negative451431
  Positive372710
Blood vessel invasion 8.2640.004
  Negative391326
  Positive432815

[i] miR, microRNA.

miR-7515 regulates PC cell proliferation in vitro

To determine the effects of miR-7515 on PC cell proliferation, miR-7515 overexpression lentivirus and miR-7515 inhibitor were used to construct miR-7515-overexpressing and -knockdown cells (Fig. 2A). CCK-8 assays were performed, and the results demonstrated that the overexpression of miR-7515 significantly decreased the proliferation rate of SW1990 and PANC-1 cells, while miR-7515 knockdown significantly increased the proliferation rate of AsPC-1 and BXPC-3 cells (Fig. 2B). Similarly, the results of the colony formation assays revealed that overexpression of miR-7515 decreased the colony formation of SW1990 and PANC-1 cells, while the knockdown of miR-7515 exerted the opposite effects on AsPC-1 and BXPC-3 cells (Fig. 2C). Furthermore, the overexpression of miR-7515 induced SW1990 and PANC-1 cell cycle arrest in the G1 phase, while miR-7515 knockdown promoted the progression from the G1 phase to the S phase in AsPC-1 and BXPC-3 cells (Fig. 2D). These results indicated that miR-7515 may regulate the proliferation of PC cells in vitro.

miR-7515 regulates PC cell migration and invasion in vitro

The effects of miR-7515 on PC cell migration and invasion were subsequently investigated. The results of the wound healing assay revealed that the migration rate was significantly decreased in the cells overexpressing miR-7515, while the knockdown of miR-7515 increased the cell migration rate (Fig. 3A). Moreover, the results of the Transwell assays demonstrated that the invasive abilities of SW1990 and PANC-1 cells overexpressing miR-7515 were decreased, while the invasive abilities of AsPC-1 and BXPC-3 cells were increased following knockdown of miR-7515 compared with the respective NC cells (Fig. 3B). These results indicated that miR-7515 may regulate PC cell migration and invasion in vitro.

Overexpression of miR-7515 inhibits PC cell proliferation and metastasis in vivo

The effects of miR-7515 on PC cell proliferation and metastasis in vivo were also determined. Establishment of a xenograft tumor model indicated that the tumors overexpressing miR-7515 grew slower compared with the tumors derived from cells transfected with LV-miR-NC (Fig. 4A and B), and also expressed downregulated levels of Ki67 and PCNA (Fig. 4C). The liver metastasis model revealed that the overexpression of miR-7515 inhibited the metastasis of PANC-1 cells in vivo compared with the tumors derived from cells transfected with LV-miR-NC (Fig. 4D-F). Furthermore, the findings indicated that mice with tumors overexpressing miR-7515 had a lower death rate compared with the mice with tumors derived from cells transfected with LV-miR-NC (Fig. 4G). These results indicated that miR-7515 may play a tumor-suppressive role in PC.

miR-7515 targets IGF-1 and regulates Ras/Raf/MEK/ERK signaling pathway

To determine the molecular mechanism underlying the role of miR-7515 in PC, bioinformatics analysis was performed. The results demonstrated that the target genes of miR-7515 were most significantly enriched in ‘Ras signaling pathway’ (Fig. 5A). Among the genes, IGF-1 was identified as a target gene of miR-7515 and had a high binding score for its involvement in the Ras signaling pathway (Fig. 5B). As previous studies revealed that the Ras signaling pathway played a key role in the progression of PC (2123), it was hypothesized that miR-7515 may regulate IGF-1 expression in PC cells. Results from the dual luciferase reporter assay demonstrated that the relative luciferase activity was significantly decreased in the cells co-transfected with the psiCHECK-2/IGF-1 3′-UTR WT plasmid and miR-7515 overexpression lentivirus, while the relative luciferase activity was not altered in the SW1990 and PANC-1 cells co-transfected with the psiCHECK-2/IGF-1 3′-UTR Mut plasmid and miR-7515 overexpression lentivirus (Fig. 5C). RT-qPCR and western blot analysis demonstrated that miR-7515 overexpression significantly downregulated the expression levels of IGF-1, while the knockdown of miR-7515 upregulated the expression levels of IGF-1 in SW1990 and PANC-1 (Fig. 5D and E). Similarly, SW1990 and PANC-1cells overexpressing miR-7515 had decreased expression levels of p-c-Raf, p-p90Rsk, p-MEK and p-ERK1/2 compared with the LV-miR-NC-transfected cells, while the knockdown of miR-7515 in SW1990 and PANC-1 cells upregulated the expression levels of p-c-Raf, p-p90Rsk, p-MEK and p-ERK1/2 (Fig. 5E). Moreover, the expression levels of IGF-1 were revealed to be upregulated in PC tissues compared with adjacent normal tissues (Fig. 6A), particularly in tumors from patients with III–IV stage disease (Fig. 6B). miR-7515 expression was also revealed to be negatively correlated with IGF-1 expression in PC tissues (Fig. 6C). Furthermore, the expression levels of IGF-1 were significantly upregulated in PC cell lines compared with the normal pancreatic epithelium cell line, HPDE (Fig. 6D and E). These results indicated that miR-7515 may target IGF-1 and the downstream Ras/Raf/MEK/ERK signaling pathway.

Overexpression of IGF-1 reverses the inhibitory effects of miR-7515 overexpression

To determine whether miR-7515 regulated the proliferation migration and invasion of PC cells via regulating IGF-1, the miR-7515 overexpression lentivirus and IGF-1 overexpression plasmid were co-transfected in SW1990 and PANC-1 cells (Fig. 7A). The results demonstrated that IGF-1 overexpression relieved the inhibitory effects of miR-7515 overexpression on the Ras/Raf/MEK/ERK signaling pathway (Fig. 7B). The results of the CCK-8 assay revealed that overexpression of IGF-1 in SW1990 and PANC-1 cells decreased the inhibitory effects of miR-7515 overexpression on cell proliferation (Fig. 8A). Similarly, the wound healing assay results demonstrated that the migratory rate of SW1990 and PANC-1 cells co-transfected with the miR-7515 overexpression lentivirus and IGF-1 overexpression plasmid was increased compared with cells only transfected with miR-7515 overexpression lentivirus (Fig. 8B). Furthermore, the overexpression of IGF-1 in miR-7515 overexpression cells upregulated the expression levels of cyclin D1 (G1 phase marker), CDK2 (G1 phase marker), MMP-2 (metastasis marker) and MMP-9 (metastasis marker) (Fig. 8C). These results indicated that IGF-1 may regulate the proliferation migration and invasion of PC cells via targeting the IGF-1-induced Ras/Raf/MEK/ERK signaling pathway.

MEK inhibitors block the effects of miR-7515 knockdown on proliferation invasion and migration of PC cells

To determine whether miR-7515 regulated the proliferation invasion and migration of PC cells via regulating IGF-1 expression, AsPC-1 and BXPC-3 cells were transfected with the miR-7515 inhibitor and treated with the MEK inhibitor PD98059. The results of the CCK-8 assays demonstrated that the treatment of AsPC-1 and BXPC-3 cells with the MEK inhibitor decreased the promoting effects of the miR-7515 inhibitor on cell proliferation (Fig. 9A). The results of the wound healing assay revealed that the migration rate in AsPC-1 and BXPC-3 cells transfected with the miR-7515 inhibitor and treated with the MEK inhibitor, PD98059, was decreased compared with cells only transfected with the miR-7515 inhibitor (Fig. 9B). Furthermore, compared to the group only transfected with the MEK inhibitor, the inhibition of MEK in miR-7515 inhibitor-transfected cells upregulated the expression levels of cyclin D1, CDK2, MMP-2 and MMP-9 (Fig. 9C). These findings indicated that IGF-1 may regulate the proliferation, migration and invasion of PC cells via targeting the IGF-1-induced Ras/Raf/MEK/ERK signaling pathway.

Discussion

PC is a lethal malignant tumor of the digestive system that is accompanied by high mortality rates. At present, the successful treatment for PC remains a significant challenge (2,21). Previous studies have reported the role of numerous miRNAs in the occurrence and the development of PC (2224). However, to the best of our knowledge, the molecular mechanisms underlying the role of miRNAs in PC remain largely unknown.

miR-7515 is a novel miRNA identified by Lee et al in 2013 (25). A previous study demonstrated that miR-7515 expression levels were downregulated in lung cancer cells, which inhibited lung cancer cell proliferation via targeting c-Met (25). Similarly, Chong et al (26) revealed that the expression levels of miR-7515 were downregulated in recurrent ovarian cancer compared with primary ovarian cancer. However, to the best of our knowledge, the role of miR-7515 in PC remains unknown. The results of the present study revealed that the expression levels of miR-7515 were downregulated in PC tissues and cell lines, and the low expression of miR-7515 predicted a poor clinical outcome. The overexpression of miR-7515 in PC cells inhibited cell proliferation, migration and invasion both in vitro and in vivo, while miR-7515 knockdown increased cell proliferation, invasion and migration in vitro. To the best of our knowledge, this is the first evidence to suggest that miR-7515 may play a tumor-suppressive role in PC by inhibiting the proliferation, migration and invasion of PC cells.

Accumulating evidence indicates that IGF-related signaling pathways promote the progression of PC to an advanced stage via stimulating the proliferation, metastasis and chemoresistance of PC cells (27). IGF-1 is a member of IGF family, and previous studies have demonstrated that the expression levels of IGF-1 were upregulated in PC tissues, which indicates its potential as a diagnostic biomarker in PC (28,29). The upregulated expression of IGF-1 also predicted a poor clinical outcome in patients with PC. Moreover, the IGF-1 receptor (IGF-1R) was revealed to have tyrosine kinase activity (30). Upon IGF-1R binding with IGF-1, the receptor is activated and increases the phosphorylation levels of AKT and MEK proteins, leading to the activation of intracellular signaling pathways, such as the PI3K/Akt/mTOR pathway and RAS/RAF/MEK/ERK signaling pathway (31). Therefore, the knockdown of IGF-1 expression may represent a potential strategy for the treatment of PC. In the present study, the target genes of miR-7515 were demonstrated to be most enriched in the Ras signaling pathway. In particular, IGF-1 was identified as a target gene of miR-7515, and was revealed to have a high binding score and to be involved in the Ras signaling pathway. Thus, it was hypothesized that miR-7515 may play a tumor-suppressive role in PC via targeting IGF-1 expression, as well as the Ras/RAF/MEK/ERK signaling pathway. Consistent with this hypothesis, the results of the present study revealed that miR-7515 directly bound with IGF-1 and regulated its expression, in addition to regulating the Ras/Raf/MEK/ERK signaling pathway. However, the exact mechanism whereby miRNA-7515 inhibits the Ras/RAF/MEK/ERK signaling pathway requires further investigation. IGF-1 expression levels were revealed to be upregulated in PC tissues and negatively co-expressed with miR-7515 expression. In addition, the overexpression of IGF-1 blocked the inhibitory effects of miR-7515 overexpression on proliferation, migration and invasion of PC cells. Treatment with the MEK inhibitor, PD98059, also blocked the effects of knockdown of miR-7515 on proliferation, migration and invasion of PC cells. To the best of our knowledge, the present study was the first to determine the potential molecular mechanism of miR-7515 in PC. In fact, miRNAs could exhibit powerful effects on the development of malignancy due to their potential to control numerous target genes (32). However, this phenomenon is also a limitation in miRNA research, and future studies are needed to further explore whether there are other pathways involved in PC progression.

In conclusion, the findings of the present study indicated that miR-7515 may be a novel tumor suppressor in PC, and it may suppress proliferation, migration and invasion of PC cells by targeting the IGF-1-induced Ras/Raf/MEK/ERK signaling pathway. Although miRNA-based therapeutics are still under development, our results are encouraging, and suggest that miR-7515 and IGF-1 could serve as clinical targets for the treatment of PC or other tumor types in the future.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant. no. 81960433) and the National Natural Science Foundation of Guizhou Medical University (grant. no. 19NSP034).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

SL and ZZ confirmed the authenticity of all the raw data. WC and ZZ designed the study. WC, ZZ and ZH performed the experiments and analyzed the data. ZZ and WC wrote the manuscript and were responsible for language revisions. SL made substantial contributions to conception and design, acquisition of data, and analysis and interpretation of the data. All the authors have read and approved the final manuscript.

Ethics approval and consent to participate

Written informed consent was obtained from all patients prior to participation and the patient experimental protocol was approved by the Human Research Ethics Review Committee of Guizhou Medical University (Guiyang, China). All animal experiments were performed in strict accordance with the Guide for the Care and Use of Laboratory Animals and the Principles for the Utilization and Care of Vertebrate Animals. The animal experimental protocols were approved (approval. no. 2000025) by the Ethics Committee of Guizhou Medical University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Riquelme E, Zhang Y, Zhang L, Montiel M, Zoltan M, Dong W, Quesada P, Sahin I, Chandra V, Lucas AS, et al: Tumor microbiome diversity and composition influence pancreatic cancer outcomes. Cell. 178:795–806. 2019. View Article : Google Scholar : PubMed/NCBI

2 

McGuigan A, Kelly P, Turkington RC, Jones C, Coleman HG and McCain RS: Pancreatic cancer: A review of clinical diagnosis, epidemiology, treatment and outcomes. World J Gastroenterol. 24:4846–4861. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Mendt M, Kamerkar S, Sugimoto H, McAndrews KM, Wu CC, Gagea M, Yang S, Blanko EV, Peng Q, Ma X, et al: Generation and testing of clinical-grade exosomes for pancreatic cancer. JCI Insight. 19:e992632018. View Article : Google Scholar : PubMed/NCBI

4 

Liu GF, Li GJ and Zhao H: Efficacy and toxicity of different chemotherapy regimens in the treatment of advanced or metastatic pancreatic cancer: A network meta-analysis. J Cell Biochem. 119:511–523. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Srikok S, Patchanee P, Boonyayatra S and Chuammitri P: Potential role of MicroRNA as a diagnostic tool in the detection of bovine mastitis. Prev Vet Med. 182:1051012020. View Article : Google Scholar : PubMed/NCBI

6 

Kagiya T: MicroRNAs: Potential biomarkers and therapeutic targets for alveolar bone loss in periodontal disease. Int J Mol Sci. 17:13172016. View Article : Google Scholar : PubMed/NCBI

7 

Aslan M, Shahbazi R, Ulubayram K and Ozpolat B: Targeted therapies for pancreatic cancer and hurdles ahead. Anticancer Res. 38:6591–6606. 2018. View Article : Google Scholar : PubMed/NCBI

8 

Qu K, Zhang X, Lin T, Liu T, Wang Z, Liu S, Zhou L, Wei J, Chang H, Li K, et al: Circulating miRNA-21-5p as a diagnostic biomarker for pancreatic cancer: Evidence from comprehensive miRNA expression profiling analysis and clinical validation. Sci Rep. 7:16922017. View Article : Google Scholar : PubMed/NCBI

9 

Tu MJ, Ho PY, Zhang QY, Jian C, Qiu JX, Kim EJ, Bold RJ, Gonzalez FJ, Bi H and Yu AM: Bioengineered miRNA-1291 prodrug therapy in pancreatic cancer cells and patient-derived xenograft mouse models. Cancer Lett. 442:82–90. 2019. View Article : Google Scholar : PubMed/NCBI

10 

Yu Z, Zhao S, Wang L, Wang J and Zhou J: miRNA-339-5p plays an important role in invasion and migration of pancreatic cancer cells. Med Sci Monit. 25:7509–7517. 2019. View Article : Google Scholar : PubMed/NCBI

11 

Yang Y, Sun Y, Wang H, Li H, Zhang M, Zhou L, Meng X, Wu Y, Liu P, Liu X, et al: MicroRNA-221 induces autophagy through suppressing HDAC6 expression and promoting apoptosis in pancreatic cancer. Oncol Lett. 16:7295–7301. 2018.PubMed/NCBI

12 

Lv F, Zheng K, Yu J and Huang Z: MicroRNA-661 expression is upregulated in pancreatic ductal adenocarcinoma and promotes cell proliferation. Oncol Lett. 16:6293–6298. 2018.PubMed/NCBI

13 

Zhang X, Shi H, Lin S, Ba M and Cui S: MicroRNA-216a enhances the radiosensitivity of pancreatic cancer cells by inhibiting beclin-1-mediated autophagy. Oncol Rep. 34:1557–1564. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Sun Y, Zhu Q, Zhou M, Yang W, Shi H, Shan Y, Zhang Q and Yu F: Restoration of miRNA-148a in pancreatic cancer reduces invasion and metastasis by inhibiting the wnt/β-catenin signaling pathway via downregulating maternally expressed gene-3. Exp Ther Med. 17:639–648. 2019.PubMed/NCBI

15 

Mutgan AC, Besikcioglu HE, Wang S, Friess H, Ceyhan GO and Demir IE: Insulin/IGF-driven cancer cell-stroma crosstalk as a novel therapeutic target in pancreatic cancer. Mol Cancer. 17:662018. View Article : Google Scholar : PubMed/NCBI

16 

Rozengurt E: Mechanistic target of rapamycin (mTOR): A point of convergence in the action of insulin/IGF-1 and G protein-coupled receptor agonists in pancreatic cancer cells. Front Physiol. 5:3572014. View Article : Google Scholar : PubMed/NCBI

17 

Yakovenko A, Cameron M and Trevino JG: Molecular therapeutic strategies targeting pancreatic cancer induced cachexia. World J Gastrointest Surg. 10:95–106. 2018. View Article : Google Scholar : PubMed/NCBI

18 

Takahashi T, Ichikawa H, Morimoto Y, Tsuneyama K and Hijikata T: Inhibition of EP2/EP4 prostanoid receptor-mediated signaling suppresses IGF-1-induced proliferation of pancreatic cancer BxPC-3cells via upregulating γ-glutamyl cyclotransferase expression. Biochem Biophys Res Commun. 516:388–396. 2019. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals, . Guide for the Care and Use of Laboratory Animals. National Academies Press (US); Washington, DC: 2011

21 

Lei S, He Z, Chen T, Guo X, Zeng Z, Shen Y and Jiang J: Long noncoding RNA 00976 promotes pancreatic cancer progression through OTUD7B by sponging miR-137 involving EGFR/MAPK pathway. J Exp Clin Cancer Res. 38:4702019. View Article : Google Scholar : PubMed/NCBI

22 

Nagathihalli NS, Castellanos JA, Lamichhane P, Messaggio F, Shi C, Dai X, Rai P, Chen X, Vansaun MN and Merchant NB: Inverse correlation of STAT3 and MEK signaling mediates resistance to RAS pathway inhibition in pancreatic cancer. Cancer Res. 78:6235–6246. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Wu SZ, Xu HC, Wu XL, Liu P, Shi YC, Pang P, Deng L, Zhou GX and Chen XY: Dihydrosanguinarine suppresses pancreatic cancer cells via regulation of mut-p53/WT-p53 and the Ras/Raf/Mek/Erk pathway. Phytomedicine. 59:1528952019. View Article : Google Scholar : PubMed/NCBI

24 

Xu L, Yuan X, Ni J, Shen L, Cai M and Jiang D: Gain of microRNA-103 triggers metastatic behavior by targeting ubiquitin specific peptidase 10 in pancreatic cancer. Int J Clin Exp Pathol. 12:1214–1223. 2019.PubMed/NCBI

25 

Lee JM, Yoo JK, Yoo H, Jung HY, Lee DR, Jeong HC, Oh SH, Chung HM and Kim JK: The novel miR-7515 decreases the proliferation and migration of human lung cancer cells by targeting c-Met. Mol Cancer Res. 11:43–53. 2013. View Article : Google Scholar : PubMed/NCBI

26 

Chong GO, Jeon HS, Han HS, Son JW, Lee YH, Hong DG, Lee YS and Cho YL: Differential MicroRNA expression profiles in primary and recurrent epithelial ovarian cancer. Anticancer Res. 35:2611–2617. 2015.PubMed/NCBI

27 

Dey S, Liu S, Factora TD, Taleb S, Riverahernandez P, Udari L, Zhong X, Wan J and Kota J: Global targetome analysis reveals critical role of miR-29a in pancreatic stellate cell mediated regulation of PDAC tumor microenvironment. BMC Cancer. 20:6512020. View Article : Google Scholar : PubMed/NCBI

28 

Yang SY, Miah A, Pabari A and Winslet M: Growth factors and their receptors in cancer metastases. Front Biosci (Landmark Ed). 16:531–538. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Hwang HJ, Oh MS, Lee DW and Kuh HJ: Multiplex quantitative analysis of stroma-mediated cancer cell invasion, matrix remodeling, and drug response in a 3D co-culture model of pancreatic tumor spheroids and stellate cells. J Exp Clin Cancer Res. 38:2582019. View Article : Google Scholar : PubMed/NCBI

30 

Kopantzev EP, Kopantseva MR, Grankina EV, Mikaelyan A, Egorov VI and Sverdlov ED: Activation of IGF/IGF-IR signaling pathway fails to induce epithelial-mesenchymal transition in pancreatic cancer cells. Pancreatology. 19:390–396. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Bertrand FE, Steelman LS, Chappell WH, Abrams SL, Shelton JG, White ER, Ludwig DL and McCubrey JA: Synergy between an IGF-1R antibody and Raf/MEK/ERK and PI3K/Akt/mTOR pathway inhibitors in suppressing IGF-1R-mediated growth in hematopoietic cells. Leukemia. 20:1254–1260. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Catalanotto C, Cogoni C and Zardo G: MicroRNA in control of gene expression: An overview of nuclear functions. Int J Mol Sci. 17:17122016. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

September-2021
Volume 46 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Lei S, Zeng Z, He Z and Cao W: miRNA‑7515 suppresses pancreatic cancer cell proliferation, migration and invasion via downregulating IGF‑1 expression. Oncol Rep 46: 200, 2021.
APA
Lei, S., Zeng, Z., He, Z., & Cao, W. (2021). miRNA‑7515 suppresses pancreatic cancer cell proliferation, migration and invasion via downregulating IGF‑1 expression. Oncology Reports, 46, 200. https://doi.org/10.3892/or.2021.8151
MLA
Lei, S., Zeng, Z., He, Z., Cao, W."miRNA‑7515 suppresses pancreatic cancer cell proliferation, migration and invasion via downregulating IGF‑1 expression". Oncology Reports 46.3 (2021): 200.
Chicago
Lei, S., Zeng, Z., He, Z., Cao, W."miRNA‑7515 suppresses pancreatic cancer cell proliferation, migration and invasion via downregulating IGF‑1 expression". Oncology Reports 46, no. 3 (2021): 200. https://doi.org/10.3892/or.2021.8151