Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
February-2016 Volume 11 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 11 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells

  • Authors:
    • Xiaorong Yang
    • Wenlai Zhou
    • Shiqing Liu
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Renmin Hospital of Wuhan University, Wuhan, Hubei 430060, P.R. China, Department of Joints, Central Hospital of Tujia and Miao Autonomous Prefecture, Enshi, Hubei 445000, P.R. China
  • Pages: 637-644
    |
    Published online on: December 11, 2015
       https://doi.org/10.3892/etm.2015.2932
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Sperm‑associated antigen 9 (SPAG9) is an oncoprotein involved in the progression of various human malignancies; however, its role in osteosarcoma (OS) remains poorly evaluated. The present study used Matrigel™ cell migration and invasion assays, tube formation assay, Cell Counting kit‑8, quantitative polymerase chain reaction, western blotting, and enzyme‑linked immunosorbent assay to investigate the role of SPAG9 in OS cell motility, invasion and angiogenesis. The results of the present study demonstrated that SPAG9 expression was upregulated in OS tissues, as compared with adjacent normal tissues, and knockdown of SPAG9 in an OS cell line inhibited cell motility and invasion via inactivation of metalloproteinase (MMP)‑2 and MMP‑9. Furthermore, the present study demonstrated that silencing of SPAG9 in OS cells inhibited tube formation, the proliferation of human umbilical vascular endothelial cells, and suppressed vascular endothelial growth factor (VEGF) expression and secretion, contributing to a reduction in angiogenesis. The results of the present study indicated that SPAG9 may be an important regulator in OS and may be involved in metastasis. Therefore SPAG9 may be a promising target for the treatment of metastatic OS.

Introduction

Osteosarcoma (OS) is a type of primary mesenchymal tumor, which is histologically characterized as a malignant tumor that directly produces osteoid or immature bones (1). Although OS remains the most common type of primary bone tumor in children and adolescents (2,3), the 5-year survival rates of patients without metastases have reached 60–75% through the use of combined aggressive surgery and neoadjuvant chemotherapy (4). However, 40–50% of patients will develop metastatic disease, which is associated with a poor prognosis, particularly in patients with primary pulmonary metastases (5). Therefore, there is an urgent clinical need for novel therapies for the treatment of OS. Due to increased understanding regarding the molecular pathogenesis of OS, numerous genetic alterations have been associated with OS (6), which may represent novel therapeutic targets for the diagnosis and treatment of patients with OS.

Cancer testis (CT) antigens are a unique class of tumor antigens that are aberrantly expressed in various malignancies (7). It has been suggested that the aberrant expression of CT antigens in tumors may contribute to various malignant properties, including immortality, migration, invasion and metastatic capacity (8). As a novel member of the CT antigen family, sperm-associated antigen 9 (SPAG9) is a scaffolding protein that facilitates interactions between mitogen-activated protein kinases and their target transcription factors, in order to activate specific signaling pathways (9,10). SPAG9 was first suggested as a potential target for immunotherapy in human epithelial ovarian cancer (11). Previous studies have detected overexpression of SPAG9 in various types of human cancer including renal, breast, thyroid, colon and lung carcinomas (12–16), and SPAG9 small interfering (si)RNA treatment successfully inhibited tumor cell proliferation and invasion in a previous study (12). Furthermore, SPAG9 expression has been demonstrated to be associated with circulating anti-SPAG9 antibodies in patients with early stage and low grade breast cancer and cervical cancer, suggesting its potential application in the early detection of the disease (17,18). However, whether SPAG9 is involved in the development of OS remains to be elucidated. The present study aimed to determine the effects of SPAG9 knockdown on the proliferation, migration and invasiveness of OS cells in an in vitro cell culture system.

Materials and methods

Cell culture and tissue samples

The U2OS human OS cell line, and human umbilical vascular endothelial cells (HUVECs) were obtained from the Shanghai Academy of Life Sciences (Shanghai, China). The cells were cultured in Dulbecco's modified Eagle medium (DMEM) (HyClone; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA) at 37°C in a humidified atmosphere containing 95% air and 5% CO2.

Four OS tissue samples and paired non-cancerous tissue samples were harvested from patients with OS of the extremities (three men, one woman; age, 48–74 years) who underwent surgery at the Renmin Hospital of Wuhan University (Wuhan, China). None of the patients had a history of previous treatment with antitumor agents or radiotherapy. The patients provided informed consent and the study was approved by the ethics committee of Enshi Renmin Hospital of Wuhan University (Enshi, China).

siRNA transfection

U2OS cells were grown to 50% confluence prior to transfection with nonspecific control siRNA (Qiagen, Inc., Mississauga, ON, Canada) or SPAG9 siRNA (Shanghai GenePharma Co., Ltd., Shanghai, China) using Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The siRNA sequences were as follows: Control, sense 5′-UUCUCCGAACGUGUCACGUTT-3′, anti-sense 5′-ACGUGACACGUUCGGAGAATT-3′; SPAG9, sense 5′-AGAUCUCAGUGGAUAUAAATT-3′, and anti-sense 5′-UUUAUAUCCACUGAGAUCUTT-3′.

Wound healing assay

For the wound healing assay, 1×105 cells/well were seeded on 6-well plates supplemented with culture medium. Cells were cultured in serum-free medium 12 h prior to the assay, and an artificial wound was subsequently scratched into the confluent cell monolayer using a P200 pipette tip. Photomicrograph images (TE2000; Nikon Corporation, Tokyo, Japan) were immediately captured (time 0 h), and the cells were subsequently incubated in DMEM supplemented with 1% FBS. The migration of the cells and the closing of the scratch wound were observed and microphotographs were captured every 4 h (TE2000; Nikon Corporation). The experiments were performed in triplicate and the whole assay was repeated three times.

Cell migration and invasion assay

Modified two-chamber migration apparatus (pore size, 8 µm) was used to perform cell migration and invasion assays (Corning Life Sciences, Lowell, MA, USA). The migration assay was completed as follows, the U2OS cells transfected with control or SPAG9 siRNA were seeded in serum-free medium in the upper chamber (1×106 cells). Following 12 h incubation at 37°C, the cells were carefully removed from the upper chamber using a cotton swab and the cells that had traversed the membrane were fixed. For the invasion assay, cells were trypsinized 48 h post-transfection and 2×105 cells were transferred in 100 µl serum-free medium to the upper Matrigel™ chamber (BD Biosciences, Franklin Lakes, NJ, USA) and incubated for 24 h. Medium supplemented with 10% FBS was added to the lower chamber as the chemoattractant. Following incubation, the non-invaded cells were removed from the upper membrane surface using a cotton tip, and the cells that passed through the filter were fixed with 4% paraformaldehyde and stained with hematoxylin (Sigma-Aldrich). Cells were observed under a light microscope (BX-51; Olympus Corporation, Tokyo, Japan) and images were captured using a Camedia Master C-3040 digital camera (Olympus Corporation).

Cell proliferation assay

In order to quantitatively evaluate cell viability, the effects of si-SPAG9 on the proliferation of HUVECs and U2OS cells (2×104 cells/well) were detected using a CCK-8 assay. U2OS cells and HUVECs were seeded in a 96-well culture plate and incubated at 37°C in a humidified atmosphere containing 5% CO2 for 24 h. Subsequently, 10 µl CCK-8 solution was added to each well and the cultures were incubated at 37°C for 1 h. Absorbance was measured at 450 nm using an ELx800 spectrometer reader (BioTek Instruments, Inc.).

Tube formation assay

A 96-well plate was pre-coated with Matrigel™ and incubated at 37°C for 2 h prior to the addition of 2×104 HUVECs/well suspended in 100 µl conditioned medium. Following incubation at 37°C for 24 h, three fields were chosen at random and the number of capillary-like tubes were counted. Images were captured using an inverted microscope (TE2000; Nikon Corporation).

Enzyme-linked immunosorbent assay (ELISA) for vascular endothelial growth factor (VEGF)

A total of 1×106 U2OS cells/well were plated in 6-well tissue culture plates and subsequently transfected with control siRNA or siRNA-SPAG9 with serum starvation. The supernatants were collected 24 h post-transfection and the concentrations of VEGF were determined using Human VEGF Quantikine ELISA kits according to the manufacturer's protocol (R&D Systems, Inc., Minneapolis, MN, USA).

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR)

Tissue samples were initially homogenized and total RNA was extracted from them using an mRNA Isolation kit (Qiagen, Inc., Valencia, CA, USA). An RNeasy kit (Qiagen, Inc., Valencia, CA, USA) was used to isolate mRNA from the cells. cDNA was synthesized from RNA extracted from cells and tissue samples using an iScript™ Select cDNA Synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA). PCR amplification of SPAG9, metalloproteinase (MMP)-2, MMP-9 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed as follows: 20 sec at 95°C, followed by 50 cycles at 95°C for 3 sec and annealing at 60°C for 30 sec, and a final extension step at 72°C for 5 min using 2X PCR Master Mix (Beyotime Institute of Biotechnology) and an ABI PRISM® 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The results were normalized to those of the GAPDH housekeeping gene and are expressed as a ratio of the percentage of individual genes to the GAPDH control. The specific primer sequences for each gene were as follows: SPAG9 forward, 5′-TCATAGTAGAATTATTCAAGAG-3′; and reverse 5′-ATAGTAGAATTATCTCTTGAA-3′; MMP-2 forward, 5′-CTGGCTTCTGGCATCCTGTT-3′; and reverse, 5′-GACGAGGTCGGAATTGCAGA-3′; MMP-9 forward, 5′-CCTCTGGAGGTTCGACGTGA-3′; and reverse, 5′-TAGGCTTTCTCTCGGTACTGGAA-3′; and GAPDH forward, TGAAGGTCGGAGTCAACGGATT; and reverse, CCTGGAAGATGGTGATGGGATT (Shanghai GenePharma Co., Ltd.). Expression levels were analyzed using the 2−ΔΔCq method (19).

Zymographic analysis

Cells were grown to 70–80% confluence on 10 cm plates, washed twice with phosphate-buffered saline and cultured in serum-free medium for 36 h. Total protein was extracted from the cells using radioimmunoprecipitation assay lysis buffer containing 60 µg/ml phenylmethylsulfonyl fluoiride (Beyotime Institute of Biotechnology). Protein concentrations were determined using a Bicinchoninic Acid Protein Assay kit (Boster Biological Technology, Ltd., Wuhan, China). An appropriate volume of medium with an equivalent amount of protein (80 µg) was subjected to electrophoresis in 10% gel supplemented with 0.1% gelatin. Following electrophoresis, the gelatin gel was washed twice with 2.5% Triton X-100 and incubated with Tris buffer (50 mM Tris-HCl; 200 mM NaCl; 0 mM CaCl2; pH 7.4) overnight at 37°C. Subsequently, the gel was stained with 0.5% Coomassie Brilliant Blue R-250 and destained using 5% acetic acid and 10% methanol (all Invitrogen; Thermo Fisher Scientific, Inc.).

Western blot analysis

Tissue samples were homogenized, the homogenates were centrifuged at 1,000 × g for 10 min at 4°C, and the supernatants were collected. Total protein was extracted from the cells and tissue supernatants using radioimmunoprecipitation assay lysis buffer supplemented with 60 µg/ml phenylmethylsulfonyl fluoride (Beyotime Institute of Biotechnology) 48 h post-transfection with siRNA. Protein concentrations were assessed using a Bicinchoninic Acid Protein Assay kit (Boster Biological Technology, Ltd.). Proteins (80 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes (EMD Millipore, Billerica, MA, USA) and incubated overnight at 4°C with the following antibodies: Rabbit anti-SPAG9 (1:1,000; cat. no. 5519), rabbit anti-MMP-2 (1:1,000; cat. no. 4022), rabbit anti-MMP-9 (1:1,000; cat. no. 3852) (all Cell Signaling Technology, Inc., Danvers, MA, USA), rabbit anti-VEGF (1:1,000; cat. no. sc-507) and mouse anti-β-actin (1:200; cat. no. sc-47778) (both Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Blots were washed four times with Tris-buffered saline supplemented with 0.1% Tween-20 and subsequently incubated with horseradish peroxidase-conjugated anti-rabbit (1:2,000; cat. no. 7074) or anti-mouse (1:20,000; cat. no. 7076) secondary antibodies (Cell Signaling Technology, Inc.) at 24°C for 2 h. The signals were detected using a Super Signal West Pico Chemiluminescent Substrate kit (Pierce Biotechnology, Inc., Rockford, IL, USA) according to the manufacturer's protocol. Western blots were analyzed using ImageJ 1.48u software (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

Data were expressed as the mean ± standard deviation. Between group statistical differences were evaluated using Instat software (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA) using one-way analysis of variance, whereas Student's t-test was used to analyze the cell proliferation assays. P<0.05 was considered to indicate a statistically significant difference.

Results

SPAG9 expression levels were upregulated in patients with osteosarcoma

In order to determine whether SPAG9 expression levels are altered in human patients with OS, RT-qPCR and western blotting were performed on four pairs of human OS tissue samples and pair-matched noncancerous tissue samples. The results demonstrated that SPAG9 expression levels were markedly increased in OS tissues, as compared with the noncancerous tissue samples (Fig. 1A and B).

Figure 1.

Sperm-associated antigen 9 (SPAG9) expression levels in normal (N) and cancerous osteosarcoma (T) tissues. (A) Whole-cell protein extracts were prepared from four pair-matched N and T tissues. SPAG9 protein expression levels were detected using western blot analysis. (B) SPAG9 mRNA expression levels in four pair-matched N and T tissues, as detected by reverse transcription quantitative-polymerase chain reaction analysis. Data are presented as the mean ± standard deviation. *P<0.05, as compared with N.

Knockdown of SPAG9 by siRNA in U2OS cells inhibits cell motility

In order to explore the biological function of SPAG9 in OS cells, siRNA knockdown was performed in U2OS cell lines, and western blotting and RT-qPCR were used to analyze SPAG9 expression levels. Protein and mRNA expression levels of SPAG9 were markedly decreased 48 h following siRNA transfection (Fig. 2A and B). Therefore, all subsequent experiments were performed using cells transfected with SPAG9 or control siRNA.

Figure 2.

Sperm-associated antigen 9 (SPAG9) knockdown inhibited cell motility. (A) Protein expression levels of SPAG9 in U2OS cells were evaluated by western blotting 24 h post-transfection. β-actin was used as an internal control. (B) mRNA expression levels of SPAG9 in U2OS cells were examined by reverse transcription quantitative-polymerase chain reaction. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. (C) Cell migration assay. Representative fields of migratory cells on the membrane (magnification, ×200) and the (D) average number of migratory cells per field. (E) A scratch was made across the confluent monolayer using a 20 µl pipette tip, and a subsequent wound healing assay demonstrated that there was a significant delay in wound closure following knockdown of SPAG9 expression (magnification, ×100). Data are presented as the mean ± standard deviation. *P<0.05, as compared with the control (Ctrl). U2OS, human osteosarcoma cell line; si, small interfering RNA.

The results of the cell migration assay demonstrated that transfection with SPAG9 siRNA decreased the migratory ability of U2OS cells through the Boyden chamber by 64% (Fig. 2C and D). Furthermore, the wound healing assay data demonstrated that there was a significant delay in wound closure following treatment with SPAG9 siRNA (Fig. 2E).

Knockdown of SPAG9 by siRNA in U2OS cells inhibits cell invasion

Invasion is the crucial step in the progression of cancer metastasis. The capacity of OS cells to invade through Matrigel™, an artificial extracellular matrix (ECM), was measured following transfection with control or SPAG9 siRNA. Knockdown of SPAG9 expression resulted in a 48% reduction in cell invasion (Fig. 3A), and histogram analysis demonstrated that significantly fewer cells (P<0.05) passed through the filters coated with an artificial ECM, suggesting that the invasive potential of SPAG9 siRNA-transfected OS cells was severely impaired. Downregulation of SPAG9 had no effect on the proliferation of OS cells (Fig. 3B).

Figure 3.

Sperm-associated antigen 9 (SPAG9) regulates cell invasion but not cell proliferation. (A) Matrigel™ cell invasion assay was performed following silencing of SPAG9 in U2OS cells (magnification, ×100). (B) Cell Counting kit-8 cell proliferation assay was used to measure the proliferation of osteosarcoma (OS) cells. Data are presented as the mean ± standard deviation in triplicate. *P<0.05, as compared with the control (Ctrl). si, small interfering RNA.

Knockdown of SPAG9 inhibits angiogenesis in vitro

In order to further elucidate the functional role of SPAG9 on the angiogenic potential of human OS cells, tube formation and HUVEC proliferation were investigated in vitro. When cultured in conditioned medium from SPAG9 siRNA cells the percentage of proliferating HUVECs was significantly reduced (52%; P<0.05), as compared with the control (Fig. 4A). Furthermore, the average number of complete tubular structures formed by HUVECs cultured in conditioned medium from U2OS si-SPAG9 cells was significantly decreased (P<0.05), as compared with the control group (Fig. 4B).

Figure 4.

Sperm-associated antigen 9 (SPAG9) knockdown induced inhibition of angiogenesis. (A) Cell Counting kit-8 cell proliferation assay was performed to detect the proliferation of HUVECs following incubation with conditioned medium from SPAG9 small interfering (si)RNA U2OS cells. (B) Representative images were captured in situ of tube formation of HUVECs treated with the supernatant of U2OS cells transfected with control siRNA and si-SPAG9 (magnification, ×100). All experiments were performed in triplicate and data are presented as the mean ± standard deviation *P<0.05, as compared with the control (Ctrl). U2OS, human osteosarcoma cell line.

Knockdown of SPAG9 suppresses MMP-2 and MMP-9 expression levels and activity in OS cells

MMPs, in particular MMP-2 and MMP-9, have important roles in the invasion and metastasis of OS cells. Therefore, RT-qPCR, western blot and gelatin zymography analyses were employed in order to determine the expression levels of MMP-2 and MMP-9 in si-SPAG9-transfected cancer cells. The results of the present study demonstrated that MMP-2 and MMP-9 mRNA and protein expression levels and activity were markedly reduced in U2OS cells transfected with si-SPAG9 (Fig. 5A–C), as compared with the control.

Figure 5.

Sperm-associated antigen 9 (SPAG9) knockdown suppressed metalloproteinase (MMP)-2 and MMP-9 expression and activity levels. (A) Reverse transcription quantitative-polymerase chain reaction analysis of MMP-2 and MMP-9 mRNA expression levels following knockdown of SPAG9. (B) Western blot analysis of MMP-2, MMP-9 and β-actin relative protein expression levels in in the U2OS SPAG9 knockdown and control groups. (C) Activity levels of MMP-2 and MMP-9 were evaluated using gelatin zymography. Data are presented as the mean ± standard deviation *P<0.05, as compared with the control (Ctrl). U2OS, human osteosarcoma cell line; si, small interfering RNA.

SPAG9 regulates VEGF expression and secretion in OS cells

VEGF is a key mitogen and survival factor in endothelial cells, as endothelial cells enter an active proliferative state in response to angiogenic stimulation. To evaluate whether depletion of SPAG9 contributes to VEGF expression and secretion in OS cells, a western blot analysis was performed in order to evaluate protein expression levels. A subsequent ELISA analysis was used to measure the secretion of VEGF in the conditioned medium from U2OS cells transfected with SPAG9 siRNA. A reduction in VEGF expression and secretion was detected in the conditioned medium from U2OS cells transfected with SPAG9 siRNA, as compared with the control cells (Fig. 6A and B).

Figure 6.

Sperm-associated antigen 9 (SPAG9) regulates vascular endothelial growth factor (VEGF) activity. (A) Western blot analysis of the relative protein expression levels of VEGF and β-actin in the U2OS SPAG9 knockdown and control groups. (B) VEGF secretion levels were evaluated using enzyme-linked immunosorbent assay. *P<0.05, as compared with the control (Ctrl). U2OS, human osteosarcoma cell line; si, small interfering RNA.

Discussion

SPAG9 is localized on the surface of the sperm and is only expressed in haploid germ cells during spermatogenesis (9). Previous studies have demonstrated that SPAG9 may promote sperm-egg fusion, which is characterized by an increase in intracellular Ca2+ and pH, and the tyrosine phosphorylation of several proteins (20,21). Since SPAG9 is highly expressed in cancer tissues, the role of SPAG9 in cancer has been well-studied. Previous studies have suggested that SPAG9 may be useful as a tumor marker for various types of human cancer, including breast, thyroid, colorectal and renal cell carcinoma (12,17,22). In addition, a previous study demonstrated that knockdown of SPAG9 inhibited tumor growth of renal cell carcinoma in vivo, indicating its potential role in the regulation of tumor development and metastasis (12). These observations indicated that SPAG9 may have an important role in the tumorigenesis of human cancer; however, the association between SPAG9 and OS has yet to be examined. In order to elucidate the role of SPAG9 in OS metastasis, tissue samples and an in vitro cell model were used to investigate whether SPAG9 is associated with the metastasis of OS. The results of the present study demonstrated that SPAG9 was highly expressed in OS tissues and knockdown of SPAG9 by siRNA in OS cells reduced cell migration, invasion and angiogenesis.

Metastasis is a complex multistep process that requires detachment from the primary tumor mass, migration through the ECM and the colonization of surrounding sites; therefore, cell motility and invasion are essential for this process (23). The present study demonstrated that knockdown of SPAG9 suppressed the motility and invasion of OS cells, as assessed by wound healing and transwell assays. One of the key factors associated with the invasion and metastasis of cancer cells is the degradation of ECM, as this allows cancer cells to invade and migrate. MMPs have an important role in this process (24), and MMP-2 and MMP-9 are postulated to promote the invasion and metastasis of OS cells to the lymph nodes (25). In order to determine how SPAG9 siRNA inhibits the motility and invasion of OS cells, the present study aimed to elucidate the effects of SPAG9 siRNA on MMP-2 and MMP-9 activity levels. Knockdown of SPAG9 expression significantly inhibited the expression levels and bioactivities of MMP-2 and MMP-9 in OS cells. The results of the present study indicated that SPAG9 may promote cell motility and invasion by increasing MMP-2 and MMP-9 expression levels and enzyme activity. However, it remains to be elucidated how SPAG9 regulates MMP-2 and MMP-9 expression and activity levels, and signaling pathway in order to regulate OS cell metastasis.

Angiogenesis is essential for the growth and metastasis of cancer cells. Previous studies have indicated that angiogenesis is associated with tumor metastasis in various types of cancer, including breast, lung, prostate, head, neck and melanoma (26–28). Therefore, the suppression of angiogenesis is emerging as a promising therapeutic strategy for the treatment of cancer (29). However, the effects of SPAG9 on angiogenesis are yet to be reported. The present study demonstrated that the transfection of SPAG9 siRNA reduced the capacity of OS cell supernatant to stimulate tube formation and proliferation of HUVECs, as compared with the control cells, suggesting that knockdown of SPAG9 expression levels significantly impaired the angiogenic potential of OS cells in vitro. However, the molecular bases for this hypothesis remain unclear. VEGF is considered a key mediator of tumor angiogenesis associated with the development of tumor blood supply and the progression of cancer (30). VEGF expression levels are downregulated by tumor suppressor genes, including p53, p75 and von Hippel-Lindau, which most likely occurs via the formation of complexes with Sp1, and the inhibition of its binding and subsequent transcriptional activation of the VEGF promoter (31,32). The present study investigated whether SPAG9 regulated VEGF expression and activity levels in vitro. The results demonstrated that VEGF expression and secretion levels were decreased following SPAG9 knockdown, suggesting that decreased SPAG9 expression suppresses blood vessel formation by regulating VEGF expression and activity levels. Previous studies have demonstrated that SPAG9 participates in c-Jun N-terminal kinases (JNK) pathway activation, and JNK signaling may induce c-Jun phosphorylation at the VEGF promoter and result in its activation (12,33); therefore it is possible that JNK signaling is involved in the angiogenesis-promoting function of SPAG9.

In conclusion, the key findings of the present study demonstrated that SPAG9 may be involved in promoting OS cell motility, invasion and angiogenesis. Silencing of SPAG9 led to the inhibition of motility and invasion in OS cells due to the inactivation of MMP-2 and MMP-9. Furthermore, knockdown of SPAG9 suppressed blood vessel formation and the proliferation of HUVECs, which may be associated with decreased secretion and expression of VEGF. These findings will not only advance our knowledge of OS biology, but may also help determine if SPAG9 has potential as a novel therapeutic target for the treatment of patients with OS.

References

1 

Longhi A, Errani C, De Paolis M, Mercuri M and Bacci G: Primary bone osteosarcoma in the pediatric age, State of the art. Cancer Treat Rev. 32:423–436. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Nau JY: New techniques in bone and joint imaging (2). Rev Med Suisse. 1:6512005.(In French). PubMed/NCBI

3 

Klein MJ and Siegal GP: Osteosarcoma: Anatomic and histologic variants. Am J Clin Pathol. 125:555–581. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Hawkins DS and Arndt CA: Pattern of disease recurrence and prognostic factors in patients with osteosarcoma treated with contemporary chemotherapy. Cancer. 98:2447–2456. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Wu PK, Chen WM, Chen CF, Lee OK, Haung CK and Chen TH: Primary osteogenic sarcoma with pulmonary metastasis, Clinical results and prognostic factors in 91 patients. Jpn J Clin Oncol. 39:514–522. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Tan ML, Choong PF and Dass CR: Osteosarcoma. Conventional treatment vs. Histopathology. Cancer Biol Ther. 8:106–117. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Simpson AJ, Caballero OL, Jungbluth A, Chen YT and Old LJ: Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer. 5:615–625. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Zendman AJ, Ruiter DJ and Van Muijen GN: Cancer/testis-associated, genes. Identification, expression profile and putative function. J Cell Physiol. 194:272–288. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Jagadish N, Rana R, Selvi R, Mishra D, Garg M, Yadav S, Herr JC, Okumura K, Hasegawa A, Koyama K and Suri A: Characterization of a novel human sperm-associated antigen 9 (SPAG9) having structural homology with c-Jun N-terminal kinase-interacting protein. Biochem J. 389:73–82. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Jagadish N, Rana R, Mishra D, Kumar M and Suri A: Sperm associated antigen 9 (SPAG9): A new member of c-Jun NH2 -terminal kinase (JNK) interacting protein exclusively expressed in testis. Keio J Med. 54:66–71. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Garg M, Chaurasiya D, Rana R, Jagadish N, Kanojia D, Dudha N, Kamran N, Salhan S, Bhatnagar A, Suri S, et al: Sperm-associated antigen 9, a novel cancer testis antigen, is a potential target for immunotherapy in epithelial ovarian cancer. Clin Cancer Res. 13:1421–1428. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Garg M, Kanojia D, Khosla A, Dudha N, Sati S, Chaurasiya D, Jagadish N, Seth A, Kumar R, Gupta S, et al: Sperm-associated antigen 9 is associated with tumor growth, migration and invasion in renal cell carcinoma. Cancer Res. 68:8240–8248. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Sinha A, Agarwal S, Parashar D, Verma A, Saini S, Jagadish N, Ansari AS, Lohiya NK and Suri A: Down regulation of SPAG9 reduces growth and invasive potential of triple-negative breast cancer cells, Possible implications in targeted therapy. J Exp Clin Cancer Res. 32:692013. View Article : Google Scholar : PubMed/NCBI

14 

Volard B, Krieger S, Planchard G, Hardouin A, Vaur D, Rame JP and Bardet S: Assessment of SPAG9 transcript in fine needle aspirates of thyroid nodules. Eur Thyroid J. 1:118–121. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Kanojia D, Garg M, Gupta S, Gupta A and Suri A: Sperm-associated antigen 9 is a novel biomarker for colorectal cancer and is involved in tumor growth and tumorigenicity. Am J Pathol. 178:1009–1020. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Wang Y, Dong Q, Miao Y, Fu L, Lin X and Wang E: Clinical significance and biological roles of SPAG9 overexpression in non-small cell lung cancer. Lung Cancer. 81:266–272. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Kanojia D, Garg M, Gupta S, Gupta A and Suri A: Sperm-associated antigen 9, a novel biomarker for early detection of breast cancer. Cancer Epidemiol Biomarkers Prev. 18:630–639. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Garg M, Kanojia D, Suri S and Suri A: Small interfering RNA-mediated down-regulation of SPAG9 inhibits cervical tumor growth. Cancer. 115:5688–5699. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Burks DJ, Carballada R, Moore HD and Saling PM: Interaction of a tyrosine kinase from human sperm with the zona pellucida at fertilization. Science. 269:83–86. 1995. View Article : Google Scholar : PubMed/NCBI

21 

Luconi M, Krausz C, Forti G and Baldi E: Extracellular calcium negatively modulates tyrosine phosphorylation and tyrosine kinase activity during capacitation of human spermatozoa. Biol Reprod. 55:207–216. 1996. View Article : Google Scholar : PubMed/NCBI

22 

Garg M, Kanojia D, Salhan S, Suri S, Gupta A, Lohiya NK and Suri A: Sperm-associated antigen 9 is a biomarker for early cervical carcinoma. Cancer. 115:2671–2683. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Hynes RO: Metastatic potential: Generic predisposition of the primary tumor or rare metastatic variants-or both? Cell. 113:821–823. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Halbersztadt A, Haloń A, Pajak J, Robaczynski J, Rabczynski J and St Gabryś M: The role of matrix metalloproteinases in tumor invasion and metastasis. Ginekol Pol. 77:63–71. 2006.(In Polish). PubMed/NCBI

25 

Zhang XY, Hong BF, Chen GF, Lu YL and Zhong M: Significance of MMP2 and MMP9 expression in prostate cancer. Zhonghua Nan Ke Xue. 11:359–361. 2005.(In Chinese). PubMed/NCBI

26 

Weidner N, Semple JP, Welch WR and Folkman J: Tumor angiogenesis and metastasis-correlation in invasive breast carcinoma. N Engl J Med. 324:1–8. 1991. View Article : Google Scholar : PubMed/NCBI

27 

Weidner N: Intratumor microvessel density as a prognostic factor in cancer. Am J Pathol. 147:9–19. 1995.PubMed/NCBI

28 

Czubayko F, Schulte AM, Berchem GJ and Wellstein A: Melanoma angiogenesis and metastasis modulated by ribozyme targeting of the secreted growth factor pleiotrophin. Proc Natl Acad Sci USA. 93:14753–14758. 1996. View Article : Google Scholar : PubMed/NCBI

29 

Folkman J: Tumor angiogenesis: T herapeutic implications. N Engl J Med. 285:1182–1186. 1971. View Article : Google Scholar : PubMed/NCBI

30 

Cao YEG, Wang E, Pal K, Dutta SK, Bar-Sagi D and Mukhopadhyay D: VEGF exerts an angiogenesis-independent function in cancer cells to promote their malignant progression. Cancer Res. 72:3912–3918. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Xie K, Wei D, Shi Q and Huang S: Constitutive and inducible expression and regulation of vascular endothelial growth factor. Cytokine Growth Factor Rev. 15:297–324. 2004. View Article : Google Scholar : PubMed/NCBI

32 

Pal S, Datta K and Mukhopadhyay D: Central role of p53 on regulation of vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) expression in mammary carcinoma. Cancer Res. 61:6952–6957. 2001.PubMed/NCBI

33 

Guma M, Rius J, Duong-Polk KX, Haddad GG, Lindsey JD and Karin M: Genetic and pharmacological inhibition of JNK ameliorates hypoxia-induced retinopathy through interference with VEGF expression. Proc Natl Acad Sci USA. 106:8760–8765. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang X, Zhou W and Liu S: SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells. Exp Ther Med 11: 637-644, 2016.
APA
Yang, X., Zhou, W., & Liu, S. (2016). SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells. Experimental and Therapeutic Medicine, 11, 637-644. https://doi.org/10.3892/etm.2015.2932
MLA
Yang, X., Zhou, W., Liu, S."SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells". Experimental and Therapeutic Medicine 11.2 (2016): 637-644.
Chicago
Yang, X., Zhou, W., Liu, S."SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells". Experimental and Therapeutic Medicine 11, no. 2 (2016): 637-644. https://doi.org/10.3892/etm.2015.2932
Copy and paste a formatted citation
x
Spandidos Publications style
Yang X, Zhou W and Liu S: SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells. Exp Ther Med 11: 637-644, 2016.
APA
Yang, X., Zhou, W., & Liu, S. (2016). SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells. Experimental and Therapeutic Medicine, 11, 637-644. https://doi.org/10.3892/etm.2015.2932
MLA
Yang, X., Zhou, W., Liu, S."SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells". Experimental and Therapeutic Medicine 11.2 (2016): 637-644.
Chicago
Yang, X., Zhou, W., Liu, S."SPAG9 controls the cell motility, invasion and angiogenesis of human osteosarcoma cells". Experimental and Therapeutic Medicine 11, no. 2 (2016): 637-644. https://doi.org/10.3892/etm.2015.2932
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team