Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
March-2018 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2018 Volume 15 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis

  • Authors:
    • Lili Liu
    • Dan Wang
    • Ying Qiu
    • Hongyan Dong
    • Xuemei Zhan
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Linyi People's Hospital, Linyi, Shandong 276003, P.R. China
  • Pages: 2655-2660
    |
    Published online on: December 22, 2017
       https://doi.org/10.3892/etm.2017.5675
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Overcoming chemoresistance is a challenge in clinical treatment. It has been reported that microRNAs (miRNAs) are involved in regulating chemosensitivity. Therefore, the present study aimed to identify the effect and mechanism of miR‑15 on colon cancer chemotherapy. Reverse transcription‑quantitative polymerase chain reaction was performed to measure miR‑15 level sin62‑paired colon cancer and para‑cancerous colon tissues. The overexpression of miR‑15 in HCT116 cells was induced by transfection. The effect of miR‑15 on the chemosensitivity of colon cancer cells to 5‑fluorouracil (5‑FU) and Oxaliplatin (OX) was determined using a luminescent cell viability assay. Flow cytometry, dual‑luciferase assay and western blot analysis were used to determine the potential mechanism of miR‑15. The results suggested that the expression of miR‑15 was decreased in tumour tissues and that overexpression of miR‑15 increased the chemosensitivity of colon cancer cells to 5‑Fu and OX. miR‑15 promoted apoptosis in colon cancer cells treated with 5‑Fu and OX by inhibiting the expression of p50, which repressed the expression of B cell lymphoma‑2 and B cell lymphoma‑extra large; two direct target genes of nuclear factor‑κB with anti‑apoptotic functions. Thus, the current study demonstrated that miR‑15 increased the chemosensitivity of colon cancer cells to 5‑FU and OX by inhibiting the NF‑κB signalling pathway and inducing apoptosis.

Introduction

Colon cancer is one of the most common (1). In recent years, improvements in early screening techniques and treatment strategies has largely decreased the morbidity and mortality of colon cancer in the United States (1). However, these regions do not include developing countries such as China. Furthermore, the incidence is increased in younger patients (2). Previous studies have focussed on early diagnosis and clinical treatment of colon cancer (3,4), however, the mechanism of action remains unknown. Therefore, investigating the mechanism of colon cancer has important practical significance.

microRNAs (miRNAs) are a class of small non-coding RNAs that are 19–25 nucleotides long (5). They regulate gene expression by binding to their target mRNAs, resulting in the degradation of mRNA or repression of mRNA translation (6). Previous studies have reported that miRNAs are involved in the development of cancer (7) and serve a role in the development of chemotherapy resistance in different tumours (8,9). Therefore, targeting miRNAs may be developed as a novel method of treating cancer and improve the responses of patients to chemotherapy.

miR-15 is a miRNA that has been extensively studied. miR-15 is aberrantly regulated in various types of cancer and is associated with cell proliferation, angiogenesis and metastasis (10). However, the role of miR-15 in cancer remains unclear. Some studies have suggested that miR-15 functions as an oncogene, whereas others regard it as a tumour suppressor (11,12). The effects of miR-15 on chemotherapy are also inconsistent (13,14) and to the best of our knowledge, there have been no studies investigating the potential effect of miR-15 on colon cancer chemotherapy.

In the current study, miR-15 was detected in matching colon cancer and para-carcinoma tissues, the effect of miR-15 on colon cancer chemotherapy was analysed and its associated mechanism of action was investigated. These results may improve understanding of the process of chemotherapy resistance and the search for potential intervention targets.

Materials and methods

Patients

In the present study, miR-15 was detected in 62 paired colon cancer and para-cancerous colon tissues collected from patients who underwent surgical resection to treat colon cancer at Linyi People's Hospital (Shandong, China)between May 2011 and December 2014. The mean range of the enrolled patients was 50.8±16.4 years old (range, 34–65 years) and the male-female ratio was 42:20. The final diagnosis for each patient was confirmed by two double-blinded pathologists. Following resection, the tissues were rapidly frozen and stored in liquid nitrogen. All procedures performed in the present study that involved human participants were in accordance with the ethical standards of the institutional and/or national research committee, and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. The current study was approved by the Ethics Committee of Linyi People's Hospital (Linyi, China) and informed consent was obtained from all participants.

Cell culture and transfection

Human colorectal carcinoma HCT116 cells (Cell Center of Institute of Basic Medical Science, Chinese Academy of Medical Science, Shanghai, China) were cultured in Dulbecco's Modified Eagle's Medium (Hyclone; GE Healthcare, Logan, UT, USA) supplemented with 10% fetal bovine serum (GIBCO; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2 and 95% air.

HCT116 cells were plated in 6-well plates (1×105/per well) and the chemosynthetic miR-15 mimics (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) were transfected into cells using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific Inc.) following the manufacturer's protocol. The scrambled sequence was used as negative control (Invitrogen; Thermo Fisher Scientific Inc.). The concentration of miR-15/NC was 50 nmol/l in each well.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from frozen tissues or cells using TRIzol® (Invitrogen; Thermo Fisher Scientific Inc.) and reverse-transcribed into cDNA. In brief, 5× RT buffer (4 µl), primer (0.1 µg), 10 mM dNTPs (1 µl), RNA sample (1 µg), transcriptase (1 µl), and RNAase-free water (20 µl) were mixed. The mixture was incubated at 25°C for 5 min, 42°C for 30 min, 85°C for 5 min and then stored at 4°C. All above reagents were supplied by Takara Biotechnology Co. Ltd, (Dalian, China) SYBR Green PCR Mastermix (Takara Biotechnology Co. Ltd) was used to perform qPCR. PCR conditions were as follows: denaturation at 96°C for 3 min, 35 cycles of amplification at 94°C for 10 sec/cycle and then 58°C for 30 sec. miR-15 expression was normalized to that of U6, whereas levels of nuclear factor-κB (NF-κB), B cell lymphoma-2 (BCL-2) and B cell lymphoma-extra large (BCL-XL) mRNA were normalized to that of GAPDH. Expression level was analyzed using the 2−∆∆Cq method (15). The primers (Takara Biotechnology Co. Ltd) for PCR are presented in Tables I and II.

Table I.

Primers for reverse transcription.

Table I.

Primers for reverse transcription.

Primer namesPrimer sequence (5′-3′)
U6 AAAATATGGAACGCTTCACGAATTTG
miR-15 GTCGTATCCAGTGCAGGGTCCGAGGT
ATTCGCACTGGATACGACCACAAA

[i] miR-15, microRNA-15.

Table II.

Primers for qPCR.

Table II.

Primers for qPCR.

Primer namesPrimer sequence (5′-3′)
miR-15F: TAGCAGCACATAATGGTTTGTG
R: GTCGTATCCAGTGCAGGGTCCGAGGT
U6F: CTCGCTTCGGCAGCACATATACT
R: ACGCTTCACGAATTTGCGTGTC
GAPDHF: ATGGGGAAGGTGAAGGTCG
R: GGGGTCATTGATGGCAACAATA
BCL2F: GGTGGGGTCATGTGTGTGG
R: CGGTTCAGGTACTCAGTCATCC
BCL-XLF: GAGCTGGTGGTTGACTTTCTC
R: TCCATCTCCGATTCAGTCCCT
Luminescent cell viability assay

The cells transfected with miR-15/NC (1×104/per well) were seeded into a 96-well plate and treated with 5, 10, 20, 40 and 80 µg/ml 5-Fluorouracil (5-Fu, Tjkingyork company, Hangzhou, China) or 2.5, 5, 10, 20, 40 µg/ml Oxaliplatin (OX, Zhejian Hisun Pharmaceutical Co., Ltd, Zhejiang, China) for 48 h at 37°C. Cellular viability was measured using Cell Titer-Glo™ (Promega Corporation, Madison, WI, USA) following the manufacturer's protocol.

Measurement of apoptosis by flow cytometry

Flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA) was used to detect the apoptosis of cells transfected with miR-15 or-NC and treated with 5-Fu or OX. The apoptosis kit was obtained from BD Biosciences. Propidium iodide and Annexin V-fluorescein-isothiocyonate stains were used to measure late and early apoptosis, respectively. The stains were incubated for 15 min at room temperature in the dark.

Plasmid construction and dual-luciferase assay

To generate the luciferase reporter with NF-κB activity, the canonical NF-κB recognising sequence (GGG RNN YYC CGG GRN NYY CC) was synthesized and inserted into the promoter region of the pGL3 basic vector (Promega Corporation) lined with MluI and XhoI. To measure the interaction between miR-15 and its target mRNAs, the sequence containing predicted target sites within the p50 or p65 mRNAs was synthesized and cloned downstream of the firefly luciferase coding region in the pGL3 control vector (Promega Corporation) lined with SacI and HindIII. The plasmids and miR-15 or NC were co-transfected into HCT116 cells using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific Inc.) following the manufacturer's protocol. At 24 h post-transfection, cells were lysed and luciferase activity was measured using a dual-luciferase reporter test kit (Promega Corporation, Madison, WI, USA). The normalization was completed by comparison with Renilla luciferase activity. The primers (Takara Biotechnology Co. Ltd, Dalian, China) were shown in Table III.

Table III.

Primers for reporter genes sequence.

Table III.

Primers for reporter genes sequence.

Primer namesPrimer sequence (5′-3′)
pMIR-reporter-P50F: CCATGTTTGCTGCTGCTGGTGA
R: AGCTTCACCAGCAGCAGCAAACATGGAGCT
pMIR-reporter-P65F: CCGAGTTTCAGCAGCTGCTGAA
R: AGCTTTCAGCAGCTGCTGAAACTCGGAGCT
NF-κB activity reporterF: CGCGTGGGACTTTCCGGGGAACCCCC
R: TCGAGGGGGTTCCCCGGAAAGTCCCA

[i] The primer sequences for pMIR-reporter-P50 and pMIR-reporter-P65 were used to synthesize the DNA fragment containing miR-15b binding sites within P50 and P56 mRNA, respectively. Whereas the primer sequence for NF-κB activity reporter were used to synthesize DNA fragment containing NF-κB binding sites, to detect the activity of NF-κB transcriptional activity. miRNA-15, microRNA-15; F, forward; R, reverse; BCL-2, B cell lymphoma-2; BCL-XL, B cell lymphoma-extra large; NF-κB, nuclear factor-κB.

Western blot analysis

Protein was extracted from cells transfected with miR-15 or NC using radioimmunoprecipitation assay lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and protein concentration was determined using the BCA assay kit (Beyotime Institute of Biotechnology). Equal amounts of protein (20 µg/per lane) were loaded onto 12% SDS-PAGE and transferred onto PVDF membranes. The membranes were blocked with 5% skimmed milk powder at 37°C for 2 h. Then, membranes were incubated with primary antibodies (all Santa Cruz Biotechnology, Inc., Dallas, TX, USA), including mouse anti-human p50 (cat no. sc-53744, 1:200), mouse anti-human BCL-2 (cat no. sc-509, 1:200), rabbit anti-human BCL-XL (cat no. sc-7195, 1:200) and mouse anti-human β-actin (cat no. sc-130300, 1:500) at 4°C overnight and they were subsequently incubated with horse radish peroxide-conjugated bovine anti-mouse/rabbit secondary antibody(Santa Cruz Biotechnology, Inc., 1:2,000; cat no. sc-2371/2370) at 37°C for 2 h. An immunoblot was generated using the ECL western blotting detection system (Thermo Fisher Scientific Inc.).

Statistical analysis

All data were presented as the mean ± standard deviation. The gene expression level, apoptotic cells percent, NFKB and luminescence activity between two groups were compared using Student's t test. The chemosensitivity was compared by two-way analysis of variance. Multiple comparisons between the groups was completed using the Student-Newman-Keul's method. SPSS software was used to analyse data (version 10.0; SPSS, Inc., Chicago, IL, USA). P<0.05 was regarded as indicating a statistically significant difference.

Results

miR-15 is significantly downregulated in colon cancer

To determine the role of miR-15 in colon cancer chemotherapy, the expression of miR-15 in cancerous and para-cancerous tissues from 62 patients with colon cancer was measured. The results demonstrated that in the majority of cases (56/62), miR-15 was significantly decreased in cancerous tissue compared with matched para-cancerous tissue (P<0.0001, Fig. 1). The decrease in miR-15 expression in colon cancer tissue may affect the sensitivity of colon cancer tissue to chemotherapy.

Figure 1.

miR-15 expression in colon cancer tissues compared with para-cancerous tissues, as detected by reverse transcription-quantitative polymerase chain reaction. Values are presented as the mean ± standard deviation. miR-15, microRNA-15.

miR-15 improves the chemosensitivity of colon cancer cells

To determine the association between chemotherapeutics and miR-15 expression, HCT116 cells were treated with 5-Fu and OX, two reagents commonly used to treat colon cancer, and the change in expression of miR-15 was assessed (Fig. 2). The results demonstrated that miR-15 expression was significantly upregulated in HCT116 cells treated with 5-Fu and OX (P<0.01; Fig. 2A and P<0.05; Fig. 2C).

Figure 2.

miR-15 affects the chemosensitivity of colon cancer cells to 5-Fu and OX. (A) 5-Fu induced the expression of miR-15 as determined by RT-qPCR. (B) Overexpression of miR-15 increased the chemosensitivity of colon cancer cells to 5-Fu, as determined by the cell viability assay. (C) OX induced the expression of miR-15, as determined by RT-qPCR. (D) Overexpression of miR-15 increased the chemosensitivity of colon cancer cells to OX as determined by the cell viability assay. Values are presented as the mean ± standard deviation. miR-15, microRNA-15;5-FU, 5-fluorouracil; OX, oxaliplatin; RT-qPCR, quantitative reverse transcription polymerase chain reaction; Ctrol, control.

The effect of miR-15 on the response of HCT116 cells to 5-Fu and OX was detected using a luminescent cell viability assay. The results indicated that miR-15 significantly increased the inhibitory effect of 5-Fu or OX on HCT116 cell viability (both P<0.01; Fig. 2B and D). The half maximal inhibitory concentrations (IC50) for 5-Fu in NC and miR-15 transfected cells were 289.6 µM and 93.99 µM respectively, whereas the IC50 for OX in NC and miR-15 transfected cells were 50.27 µM and 20.07 µM, respectively. These results suggest that miR-15 increases the sensitivity of colon cancer cells to 5-Fu and OX chemotherapy.

miR-15 promotes 5-Fu- or OX-induced apoptosis in colon cancer cells

To determine the possible mechanism of miR-15 increasing chemosensitivity, the level of apoptosis induced by 5-Fu or OX in HCT116 cells transfected with miR-15 was measured. The results demonstrated that the rate of apoptosis was significantly increased in miR-15 transfected cells compared with control cells (P<0.05; Fig. 3) following treatment with OX or 5-Fu. This indicates that miR-15 promotes apoptosis induced by chemotherapeutic agents in HCT116 cells.

Figure 3.

Upregulation of miR-15 promotes the apoptosis of colon cancer cells induced by chemotherapeutics, as determined flow cytometry. (A) Induction by 5-Fu. (B) Induction by OX. Values are presented as the mean ± standard deviation. miR-15, microRNA-15; 5-FU, 5-fluorouracil and OX, oxaliplatin.

miR-15 targets NF-κB and inhibits the expression of its target gene

The activation of NF-κB promotes the transcription of several anti-apoptotic factors including BCL-2 and BCL-XL (16) and it has been demonstrated that miR-15 inhibits the expression of BCL-2 (17). Thus, the current study investigated whether miR-15 inhibited the activation of NF-κB in colon cancer cells. It was demonstrated that the transcriptional activity of NF-κB was significantly decreased in miR-15 transfected cells compared with control cells (P<0.01; Fig. 4A). Following transfection with miR-15, levels of BCL-2 and BCL-XL mRNA, two direct targets of NF-κB exhibiting anti-apoptotic functions, were also significantly decreased (both P<0.01; Fig. 4B). These results suggest that miR-15 inhibits the activation of NF-κB in colon cancer. The potential binding sites for miR-15 within p50 and p65, two subunits of the transcription factor NF-κB, were screened and a potential binding site was identified within the open reading frame of either p50 or p65, which is located between 2,470 and 2,476 nucleotides (nt) and between 1,231 and 1,236 nt in the mRNA of p50 and p65. The results of the dual-luciferase assay demonstrated that miR-15 significantly inhibits the expression of p50 but not of p65 (Fig. 4C). The decrease in the expression of p50 protein following miR-15 transfection was confirmed by western blot analysis (Fig. 4D). Furthermore, the expression of BCL-2 and BCL-XL protein were also decreased in miR-15 transfected cells (Fig. 4D). Taken together, these results indicate that miR-15 increased the chemosensitivity of colon cancer cells to 5-Fu and OX by repressing the NF-κB signalling pathway and promoting apoptosis.

Figure 4.

miR-15 inhibits activation of the NF-κB signalling pathway. (A) miR-15 decreased the transcriptional activity of NF-κB. (B) Levels of BCL-2 and BCL-XL mRNA were decreased in miR-15 upregulated colon cancer cells as determined by RT-qPCR. (C) miR-15 inhibited the expression of p50 as determined by the dual-luciferase assay. (D) The expression of p50, BCL-2 and BCL-XL was decreased in miR-15 upregulated colon cancer cells as indicated by the results of western blot analysis. Values are presented as the mean ± standard deviation. miR-15, microRNA-15; NF-κB, nuclear factor κB; BCL-2, B cell lymphoma-2; BCL-XL, B cell lymphoma-extra large; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Discussion

Chemotherapy is an important method of treating cancer. A large number of patients with cancer have benefitted from tumour regression and increased survival following the development of various chemotherapeutic agents (18). However, the development of chemoresistance, in which cancer cells exhibit little or no response to chemotherapy drugs, poses a challenge to the treatment of cancer (19).

Previous studies have identified some of the mechanisms of chemoresistance, which include increased drug efflux (20), decreased drug activation (21) and increased DNA repair activity (22). Recently, several studies have indicated the regulatory role of miRNAs in response to chemotherapy (23–25). For example, miR-214 induces cisplatin resistance in certain types of ovarian cancer by targeting the phosphatase and tensin homolog/phosphoinositide 3-kinase/Akt pathway (26). In addition, high levels of miR-378 may reverse the chemoresistance of lung adenocarcinoma cells to cisplatin by inhibiting the expression of secreted clusterin (27). miRNA is therefore an appealing target to increase effectiveness of various drugs.

It has been demonstrated that miR-15 serves an important role in the tumourigenesis of colorectal cancer (10). However, its expression and function remain unclear. Xi et al (28) determined that miR-15 was significantly overexpressed in colorectal cancer tissues and thus may function as an oncogene. By contrast, Wang et al (29) identified that miR-15 was downregulated in colorectal cancer tissues and may act as a tumour suppressor. In the present study, the expression of miR-15 was decreased in the majority of colon cancer tissues compared with para-cancerous tissues, supporting the role of miR-15 as a tumour suppressor in colon cancer.

miR-15 is able to regulate chemoresistance in addition to regulating cell proliferation, apoptosis, angiogenesis and metastasis (30–33). Xia et al (34) identified that miR-15 may enhance the sensitivity of gastric cancer cells to anticancer drugs by targeting BCL2 and promoting apoptosis. Reduced levels of miR-15 are also associated with chemotherapeutic resistance in human tongue cancer cells by targeting BMI1 (14). However, it has also been identified that increased expression of miR-15 is associated with decreased sensitivity to cisplatin and the poor prognosis of patients with lung adenocarcinoma by suppressing the expression of phosphatidylethanolamine-binding protein 4 (13). The results of the present study indicate that the upregulation of miR-15 may increase the sensitivity of colon cancer cells to 5-Fu and OX by promoting apoptosis.

To determine the action of miRNA and the role of apoptosis in the development of colon cancer, the target mRNAs of miR-15 associated with apoptosis were detected and analysed. The results demonstrated that NF-κB was a target of miR-15 and that miR-15 inhibits the activation of NF-κB by repressing the expression of p50. Previous studies have demonstrated that NF-κB inhibits apoptosis by transcriptionally activating anti-apoptotic proteins (35,36). This includes BCL-2 and BCL-XL, members of the BCL-2 family of apoptosis regulators (37,38). In the present study, it was demonstrated that the downregulation of NF-κB decreased the expression of BCL-2 and BCL-XL, which may contribute to the induction of apoptosis in colon cancer cells by miR-15.

In conclusion, the current study demonstrated that miR-15 was downregulated in colon cancer tissues and may act as a tumour suppressor. Exogenous overexpression of miR-15 may increase the response of colon cancer cells to 5-Fu and OX by inhibiting the NF-κB/BCL-2/BCL-XL signalling pathway and inducing apoptosis.

References

1 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Li L and Ma BB: Colorectal cancer in Chinese patients: Current and emerging treatment options. Onco Targets Ther. 7:1817–1828. 2014.PubMed/NCBI

3 

Loree JM and Kopetz S: Recent developments in the treatment of metastatic colorectal cancer. Ther Adv Med Oncol. 9:551–564. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Boland PM and Ma WW: Immunotherapy for colorectal cancer. Cancers. 9:pii: E502017. View Article : Google Scholar

5 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Ha M and Kim VN: Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol. 15:509–524. 2014. View Article : Google Scholar : PubMed/NCBI

7 

King TD, Suto MJ and Li Y: The Wnt/β-catenin signaling pathway: A potential therapeutic target in the treatment of triple negative breast cancer. J Cell Biochem. 113:13–18. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Calin GA and Croce CM: MicroRNA signatures in human cancers. Nat Rev Cancer. 6:857–866. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Magee P, Shi L and Garofalo M: Role of microRNAs in chemoresistance. Ann Transl Med. 3:3322015.PubMed/NCBI

10 

Zhao C, Wang G, Zhu Y, Li X, Yan F, Zhang C, Huang X and Zhang Y: Aberrant regulation of miR-15b in human malignant tumors and its effects on the hallmarks of cancer. Tumour Biol. 37:177–183. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Zhang WL, Zhang JH, Wu XZ, Yan T and Lv W: miR-15b promotes epithelial-mesenchymal transition by inhibiting SMURF2 in pancreatic cancer. Int J Oncol. 47:1043–1053. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Lovat F, Fassan M, Gasparini P, Rizzotto L, Cascione L, Pizzi M, Vicentini C, Balatti V, Palmieri D, Costinean S and Croce CM: miR-15b/16-2 deletion promotes B-cell malignancies. Proc Natl Acad Sci USA. 112:pp. 11636–11641. 2015; View Article : Google Scholar : PubMed/NCBI

13 

Zhao Z, Zhang L, Yao Q and Tao Z: miR-15b regulates cisplatin resistance and metastasis by targeting PEBP4 in human lung adenocarcinoma cells. Cancer Gene Ther. 22:108–114. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Sun L, Yao Y, Liu B, Lin Z, Lin L, Yang M, Zhang W, Chen W, Pan C, Liu Q, et al: miR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene. 31:432–445. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Konishi T, Sasaki S, Watanabe T, Kitayama J and Nagawa H: Overexpression of hRFI inhibits 5-fluorouracil-induced apoptosis in colorectal cancer cells via activation of NF-kappaB and upregulation of BCL-2 and BCL-XL. Oncogene. 25:3160–3169. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, et al: miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA. 102:pp. 13944–13949. 2005; View Article : Google Scholar : PubMed/NCBI

18 

Cunningham D, Allum WH, Stenning SP, Thompson JN, Van de Velde CJ, Nicolson M, Scarffe JH, Lofts FJ, Falk SJ, Iveson TJ, et al: Perioperative chemotherapy versus surgery alone for resectable gastroesophageal cancer. N Engl J Med. 355:11–20. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Wilson TR, Longley DB and Johnston PG: Chemoresistance in solid tumours. Ann Oncol. 17 Suppl 10:x315–x324. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Gottesman MM, Fojo T and Bates SE: Multidrug resistance in cancer: Role of ATP-dependent transporters. Nat Rev Cancer. 2:48–58. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Barnes MJ, Estlin EJ, Taylor GA, Aherne GW, Hardcastle A, McGuire JJ, Calvete JA, Lunec J, Pearson AD and Newell DR: Impact of polyglutamation on sensitivity to raltitrexed and methotrexate in relation to drug-induced inhibition of de novo thymidylate and purine biosynthesis in CCRF-CEM cell lines. Clin Cancer Res. 5:2548–2558. 1999.PubMed/NCBI

22 

Dabholkar M, Vionnet J, Bostick-Bruton F, Yu JJ and Reed E: Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy. J Clin Invest. 94:703–708. 1994. View Article : Google Scholar : PubMed/NCBI

23 

Amirkhah R, Farazmand A, Irfan-Maqsood M, Wolkenhauer O and Schmitz U: The role of microRNAs in the resistance to colorectal cancer treatments. Cell Mol Biol (Noisy-le-grand). 61:17–23. 2015.PubMed/NCBI

24 

Dehghanzadeh R, Jadidi-Niaragh F, Gharibi T and Yousefi M: MicroRNA-induced drug resistance in gastric cancer. Biomed Pharmacother. 74:191–199. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Wang G, Zhao R, Zhao X, Chen XI, Wang D, Jin Y, Liu XI, Zhao CI, Zhu Y, Ren C, et al: MicroRNA-181a enhances the chemotherapeutic sensitivity of chronic myeloid leukemia to imatinib. Oncol Lett. 10:2835–2841. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Yang H, Kong W, He L, Zhao JJ, O'Donnell JD, Wang J, Wenham RM, Coppola D, Kruk PA, Nicosia SV and Cheng JQ: MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res. 68:425–433. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Chen X, Jiang Y, Huang Z, Li D, Chen X, Cao M, Meng Q, Pang H, Sun L, Zhao Y and Cai L: miRNA-378 reverses chemoresistance to cisplatin in lung adenocarcinoma cells by targeting secreted clusterin. Sci Rep. 6:194552016. View Article : Google Scholar : PubMed/NCBI

28 

Xi Y, Formentini A, Chien M, Weir DB, Russo JJ and Ju J, Kornmann M and Ju J: Prognostic values of microRNAs in colorectal cancer. Biomarker Insights. 2:113–121. 2006.PubMed/NCBI

29 

Wang X, Wang J, Ma H, Zhang J and Zhou X: Downregulation of miR-195 correlates with lymph node metastasis and poor prognosis in colorectal cancer. Med Oncol. 29:919–927. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Wu CS, Yen CJ, Chou RH, Chen JN, Huang WC, Wu CY and Yu YL: Downregulation of microRNA-15b by hepatitis B virus X enhances hepatocellular carcinoma proliferation via fucosyltransferase 2-induced Globo H expression. Int J Cancer. 134:1638–1647. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Kedmi M, Ben-Chetrit N, Körner C, Mancini M, Ben-Moshe NB, Lauriola M, Lavi S, Biagioni F, Carvalho S, Cohen-Dvashi H, et al: EGF induces microRNAs that target suppressors of cell migration: miR-15b targets MTSS1 in breast cancer. Sci Signal. 8:ra292015. View Article : Google Scholar : PubMed/NCBI

32 

Zheng X, Chopp M, Lu Y, Buller B and Jiang F: miR-15b and miR-152 reduce glioma cell invasion and angiogenesis via NRP-2 and MMP-3. Cancer Lett. 329:146–154. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Li J, Chen Y, Guo X, Zhou L, Jia Z, Tang Y, Lin L, Liu W and Ren C: Inhibition of miR-15b decreases cell migration and metastasis in colorectal cancer. Tumour Biol. 37:8765–8773. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Xia L, Zhang D, Du R, Pan Y, Zhao L, Sun S, Hong L, Liu J and Fan D: miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 123:372–379. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Rayet B and Gelinas C: Aberrant rel/nfkb genes and activity in human cancer. Oncogene. 18:6938–6947. 1999. View Article : Google Scholar : PubMed/NCBI

36 

Barkett M and Gilmore TD: Control of apoptosis by Rel/NF-kappaB transcription factors. Oncogene. 18:6910–6924. 1999. View Article : Google Scholar : PubMed/NCBI

37 

Cheng Q, Lee HH, Li Y, Parks TP and Cheng G: Upregulation of Bcl-x and Bfl-1 as a potential mechanism of chemoresistance, which can be overcome by NF-kappaB inhibition. Oncogene. 19:4936–4940. 2000. View Article : Google Scholar : PubMed/NCBI

38 

Xia Y, Shen S and Verma IM: NF-κB, an active player in human cancers. Cancer Immunol Res. 2:823–830. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu L, Wang D, Qiu Y, Dong H and Zhan X: Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis. Exp Ther Med 15: 2655-2660, 2018.
APA
Liu, L., Wang, D., Qiu, Y., Dong, H., & Zhan, X. (2018). Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis. Experimental and Therapeutic Medicine, 15, 2655-2660. https://doi.org/10.3892/etm.2017.5675
MLA
Liu, L., Wang, D., Qiu, Y., Dong, H., Zhan, X."Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis". Experimental and Therapeutic Medicine 15.3 (2018): 2655-2660.
Chicago
Liu, L., Wang, D., Qiu, Y., Dong, H., Zhan, X."Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis". Experimental and Therapeutic Medicine 15, no. 3 (2018): 2655-2660. https://doi.org/10.3892/etm.2017.5675
Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, Wang D, Qiu Y, Dong H and Zhan X: Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis. Exp Ther Med 15: 2655-2660, 2018.
APA
Liu, L., Wang, D., Qiu, Y., Dong, H., & Zhan, X. (2018). Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis. Experimental and Therapeutic Medicine, 15, 2655-2660. https://doi.org/10.3892/etm.2017.5675
MLA
Liu, L., Wang, D., Qiu, Y., Dong, H., Zhan, X."Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis". Experimental and Therapeutic Medicine 15.3 (2018): 2655-2660.
Chicago
Liu, L., Wang, D., Qiu, Y., Dong, H., Zhan, X."Overexpression of microRNA-15 increases the chemosensitivity of colon cancer cells to 5-fluorouracil and oxaliplatin by inhibiting the nuclear factor-κB signalling pathway and inducing apoptosis". Experimental and Therapeutic Medicine 15, no. 3 (2018): 2655-2660. https://doi.org/10.3892/etm.2017.5675
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team