Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2017 Volume 40 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 40 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells

  • Authors:
    • Yufeng Wang
    • Qiaoling Feng
    • Caixia Ji
    • Xiaohua Liu
    • Li Li
    • Jinyong Luo
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Diagnostic Medicine Designated by The Chinese Ministry of Education, Chongqing Medical University, Chongqing 400016, P.R. China
  • Pages: 1991-1999
    |
    Published online on: September 27, 2017
       https://doi.org/10.3892/ijmm.2017.3155
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Although bone morphogenetic protein 9 (BMP9) is highly capable of promoting the osteogenic differentiation of mesenchymal stem cells (MSCs) both in vitro and in vivo, the molecular mechanisms involved remain to be fully elucidated. Runt-related transcription factor (RUNX)3 is an essential regulator of osteoblast/chondrocyte maturation. However, the exact role of RUNX3 in BMP9 osteoinductive activity is unknown. In this study, we sought to investigate the functional role of RUNX3 in the BMP9-induced osteogenic differentiation of MSCs. We found that BMP9 upregulated the endogenous expression of RUNX3 in MSCs. The overexpression or/and knockdown of RUNX3 both increased the levels of alkaline phosphatase (ALP) a marker of BMP9-induced early osteogenic differentiation. Nevertheless, matrix mineralization, a marker of BMP9-induced late osteogenic differentiation was enhanced by the overexpression of RUNX3, whereas it was inhibited by the knockdown of RUNX3. The BMP9-induced expression of osteogenic pivotal transcription factors [inhibitor of differentiation (Id)3, distal-less homeobox 5 (DLX5) and RUNX2)] was further increased by the overexpression of RUNX3; however, it was reduced by the knockdown of RUNX3. However, the expression levels of Id1 and Id2 were both enhanced by the overexpression or/and knockdown of RUNX3. The BMP9-induced phosphorylation of Smad1/5/8 was increased with the overexpression of RUNX3, and yet was decreased with the knockdown of RUNX3. Collectively, our findings suggest that RUNX3 is an essential modulator of the BMP9-induced osteoblast lineage differentiation of MSCs.

Introduction

Mesenchymal stem cells (MSCs) are multipotent cells capable of differentiating into myogenic, osteoblastic, chondrogenic or adipogenic lineages. MSCs can be isolated from a number of tissues, such as trabecular bone, the periosteum, synovium, adipose tissue, skeletal muscle and deciduous teeth, as well as from placenta and umbilical cord blood (1–7). Due to their wide availability and the characteristic of multipotent differentiation, MSCs have been widely used in bone tissue engineering in the clinical setting (2–5,8).

Bone morphogenetic proteins (BMPs), which belong to the transforming growth factor-β superfamily, are important in stem cell biology and regulate cell proliferation and differentiation during development (9,10). Additionally, the roles of BMPs in bone and skeletal development are well recognized (6,11). More than 20 BMPs have been identified, and BMP2, BMP4, BMP6 and BMP7 are of more osteoinductive ability (11). Recombinant human BMP2 and BMP7 proteins have been used in the clinical setting (12–15). However, it remains unclear as to whether BMP2 and BMP7 are the most potent BMPs in inducing osteogenic differentiation and bone formation. It has previously been demonstrated that BMP9 is more potent in promoting the osteogenic differentiation of MSCs both in vitro and in vivo (16). Many pivotal transcription factors, such as inhibitor of differentiation (Id)1, Id2, Id3, distal-less homeobox 5 (DLX5) and runt-related transcription factor (RUNX)2, are pivotal mediators of the BMP9-induced differentiation of MSCs (16). A variety of signaling pathways, such as the canonical BMP/Smad signaling pathway and non-canonical mitogen-activated protein kinase (MAPKs), have been identified to meditate BMP9-induced osteogenic signaling (17–19). We have also previously found that BMP type I receptors, ALK1 and ALK2, are involved in BMP9-induced osteogenesis (20). Additionally, microRNAs (miRNAs or miRs) are important regulators of BMP9-induced osteogenesis (21–23). Despite these meaningful findings, BMP9 remains the least studied BMPs and the molecular mechanisms involved in BMP9 osteoinductive activity remain to be fully elucidated.

The RUNX proteins, which include RUNX1, RUNX2 and RUNX3, play an important role in cell growth and differentiation during embryonic development (24). The RUNX1 null phenotype leads to the early embryonic lethality of homozygous mice, demonstrating that RUNX1 is required for definitive hematopoiesis (25). RUNX2 acts as a key regulator during osteogenesis (26,27). RUNX2 knockout leads to the impaired hepertrophy of chondrocytes followed by the complete absence of mineralized bone (26,27). Previous studies on RUNX3 have mainly focused on the function of gastric tumor suppressor and central nervous system development (28,29). RUNX3 also plays an important role in chondrocyte differentiation and bone formation (30–32). The expression of RUNX3 increases at the stage of prehypertrophic chondrocytes and is maintained in hypertrophic chondrocytes (32). However, it decreases in terminal hypertrophic chondrocytes, and the expression pattern of RUNX3 overlaps with RUNX2 (32). RUNX genes and proteins share structural and organizational features and all RUNX proteins are co-expressed in many skeletal elements (33–35). We have validated in our previous studies that RUNX2 is involved in the BMP9-induced osteogenic differentiation of MSCs (16,36). In the present study, we examined the effect of RUNX3 on the BMP9-induced osteogenic differentiation of MSCs. Our results demonstrated that RUNX3 may play regulatory roles in the BMP9-induced osteogenic differentiation of MSCs by affecting the Smad signaling cascade.

Materials and methods

Cell lines, cell culture and chemicals

293 (for amplification of adenoviruses), HCT116, C3H10T1/2, C2C12 cells were obtained from ATCC (Manassas, VA, USA) and maintained in complete Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 100 U/ml streptomycin/penicillin at 37°C in a humidified atmosphere of 5% CO2. Unless otherwise indicated, all chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Construction of recombinant adenovirus

Recombinant adenoviruses expressing exogenous BMP9 (Ad-BMP9) and RUNX3 (Ad-RUNX3), and recombinant adenovirus expressing small interfering RNA (siRNA) targeting RUNX3 (Ad-siRUNX3) was generated using hte AdEasy system as previously described (37). Adenoviruses only expressing GFP (Ad-GFP) and RFP (Ad-RFP) were used as controls. Ad-RUNX3 or Ad-BMP9 were used to infect the MSCs with a multiplicity of infection (MOI) of 5. An MOI of 5 indicates 5 active viral particles per cell. To obtain the indicated MOI, we first counted the quantity of the active viral particles, then counted the cell number and finally calculated the volume of viruses according to the indicated MOI.

Preparation of BMP9 conditioned medium

BMP9 conditioned medium (BMP9-CM) was prepared as follows: briefly, HCT116 cells were seeded in 100 mm dish and infected with an optimal titer of Ad-BMP9. The culture medium was changed into serum-free DMEM at 8 h following infection. BMP9 conditioned medium (BMP9-CM) was harvested at 24 and 48 h after infection and used immediately.

Total RNA isolation, semi-quantitative PCR and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from the cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and used to generate cDNA hexamer (Takara Bio Inc., Otsu, Japan) and MMLV transcription reverse transcriptase (Promega, Sunnyvale, CA, USA). RT-PCR was carried out as previously described (17–19) and PCR primers (Table I) were designed using the Primer3 program. A touchdown cycling program for RT-PCR was carried out as follows: 94°C for 5 min for 1 cycle, 94°C for 30 sec, 68°C for 30 sec, and 72°C for 12 cycles with decrease in 1°C/cycle and then at 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec for 18–27 cycles depending on the abundance of a given gene. qPCR based on SYBR Premix Ex Taq (Takara Bio Inc.) was carried out to amplify the interesting genes with Bio-Rad iQ5 instrument (Bio-Rad, Hercules, CA, USA). Gene expression results were analyzed using the ΔΔCt method. A RT-qPCR cycling program was carried out as follows: 95°C for 3 min, 95°C for 3 sec, 55°C for 30 sec (36 cycles), 95°C for 10 sec, 65°C for 10 sec and 95°C for 50 sec. Triplicate reactions were carried out for each sample.

Table I

Sequences of primers for RT-PCR and RT-qPCR.

Table I

Sequences of primers for RT-PCR and RT-qPCR.

Gene nameForward primerReverse primer
GAPDH GGCTGCCCAGAACATCAT CGGACACATTGGGGGTAG
Id1 ACGACATGAACGGCTGCT CAGCTGCAGGTCCCTGAT
Id2 CAGCATCCCCCAGAACAA TCTGGTGATGCAGGCTGA
Id3 CTACGAGGCGGTGTGCTG GCGCGAGTAGCAGTGGTT
DLX5 CTCAGCCACCACCCTCAT TGGCAGGTGGGAATTGAT
RUNX2 GGTGAAACTCTTGCCTCGTC AGTCCCAACTTCCTGTGCT
RUNX3 CACCGGCAGAAGATAGAAG GTCTGAGGAGCCTTGGATTG

[i] RT-qPCR, reverse transcription-quantitative polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Id1, inhibitor of differentiation 1; Id2, inhibitor of differentiation 2; DLX5, distal-less homeobox 5; RUNX3, runt-related transcription factor 3.

Western blot analysis

For western blot analysis, the cells were lysed with RIPA buffer and cleared total lysate was denatured by boiling and loaded onto an 8–15% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. Following electrophoretic separation, the proteins were transferred onto an Immobilon-P membrane and blocked by super-block blocking buffer and probed by primary antibodies, followed by incubation with secondary antibody. The proteins of interest were detected using a SuperSignal West Pico Chemiluminescent Substrate kit. The following primary antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) as follows, anti-β-actin (sc-47778), anti-RUNX3 (sc-30197), anti-RUNX2 (sc-12488), anti-DLX5 (sc-18151) and anti-Smad1/5/8 (sc-6031). The following primary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA) as follows, anti-phospho-p38 (#4511), anti-p38 (#9212), anti-phospho-ERK1/2 (#4370), anti-ERK1/2 (#4695). The dilution for all primary antibodies was 1:1,000. The following secondary antibodies were purchased from Zhongshan Golden Bridge (Guangzhou, China) as follows, peroxidase-conjugated rabbit anti-goat IgG (ZB-2306), peroxidase-conjugated goat anti-mouse IgG (ZB-2305) and peroxidase-conjugated goat anti-rabbit IgG (ZB-2301). The dilution for all secondary antibodies was 1:5,000.

Measurement of alkaline phosphatase (ALP)

ALP activity was assessed by a modified Great Escape SEAP Chemiluminescence assay (BD Clontech, Mountain View, CA, USA) as previously described (17–19). For the chemilluminescence assays, each assay condition was performed in triplicate, and the results were repeated in at least 3 independent experiments. ALP activity was normalized to the total cellular protein level.

Measurement of matrix mineralization

Mineralized matrix nodules were stained for calcium precipitation by means of Alizarin Red S staining, as previously described (19). The cells were fixed with 0.05% (v/v) glutaraldehyde at room temperature for 10 min. After being washed with distilled water, the fixed cells were incubated with 0.4% Alizarin Red S for 5 min, followed by extensive washing with distilled water. The staining of calcium mineral deposits was recorded under bright field microscopy. The results were repeated in at least 3 independent experiments.

Statistical analysis

Data were analyzed using One-way analysis of variance (ANOVA) followed by the Tukey's test. Data are presented as the means ± SEM and statistical significance was indicated by p-value <0.05.

Results

BMP9 upregulates the expression of endogenous RUNX3 in MSCs

First of all, we sought to determine whether BMP9 can affect the expression of endogenous RUNX3. We found that BMP9 effectively increased the mRNA and protein expression level of RUNX3 in C3H10T1/2 cells (Fig. 1A and C) and C2C12 cells (Fig. 1B and D). Subsequently, we successfully constructed recombinant adenovirus expressing RUNX3 (Ad-RUNX3) (Fig. 1E) and adenovirus expressing siRNA against RUNX3 (Ad-siRUNX3) (Fig. 1F). Our results indicate that BMP9 increases the expression of RUNX3 in MSCs.

Figure 1

Bone morphogenetic protein 9 (BMP9) increaseS the endogenous expression of runt-related transcription factor 3 (RUNX3). C3H10T1/2 and C2C12 CELLS were infected with adenovirus (Ad)-GFP or Ad-BMP9. (A) BMP9 increaseD RUNX3 mRNA expression in C3H10T1/2 cells, as detected by RT-qPCR. (B) BMP9 increaseD RUNX3 mRNA expression in C2C12 cells, as detected by RT-qPCR. (C) BMP9 increased RUNX3 protein expression in C3H10T1/2 cells, as detected by western blot analysis. (D) BMP9 increased RUNX3 protein expression in C3H10T1/2 cells, detected by western blot analysis. C3H10Tl1/2 cells were infected with Ad-RFP, Ad-RUNX3 or adenovirus expressing small interfering RNA (siRNA) targeted against RUNX3 (Ad-siRUNX3). (E) Ad-RUNX3 increased RUNX3 mRNA expression in C3H10T1/2 cells, as detected by RT-qPCR. (F) Ad-siRUNX3 decreased RUNX3 mRNA expression in C3H10T1/2 cells as detected by RT-qPCR. *P<0.05 vs. blank and RFP.

Effect of RUNX3 on the BMP9-induced increase in the level of the early osteogenic marker, ALP

BMP9 increased RUNX3 expression in MSCs, and this prompted us to evaluate the effect of RUNX3 on the BMP9-induced osteogenic differentiation of MSCs. We infected the C3H10T1/2 and C2C12 cells with Ad-RFP or Ad-RUNX3, followed by treatment with BMP9-CM. The results revealed that the BMP9-induced ALP activity was further increased following transfection of the C3H10T1/2 cells (Fig. 2A and B) and C2C12 cells (Fig. 2E and F) with Ad-RUNX3. To complement these results, we also infected the C3H10T1/2 and C2C12 cells with siRNA against RUNX3 (Ad-siRUNX3). Still, an increased level of ALP activity was observed in the C3H10T1/2 cells (Fig. 2C and D) and C2C12 cells (Fig. 2G and H). Collectively, both the overexpression and/or knockdown of RUNX3 enhanced the BMP9-induced early osteogenenic differentiation of MSCs.

Figure 2

Effect of runt-related transcription factor 3 (RUNX3) on bone morphogenetic protein 9 (BMP9)-induced alkaline phosphatase (ALP) activity in mesenchymal stem cells (MSCs). (A) Adenovirus (Ad)-RUNX3 enhanced BMP9-induced ALP activity in C3H10T1/2 cells, asdetected by staining assay, magnification, ×100. (B) Ad-RUNX3 enhanced BMP9-induced ALP activity in C3H10T1/2 cells, as detected by quantitive assay. (C) Adenovirus expressing small interfering RNA (siRNA) targeted against RUNX3 (Ad-siRUNX3) enhanced BMP9-induced ALP activity in C3H10T1/2 cells, as detected by staining assay. (D) Ad-siRUNX3 enhanced BMP9-induced ALP activity in C3H10T1/2 cells, as detected by quantitive assay. (E) Ad-RUNX3 enhanced BMP9-induced ALP activity in C2C12 cells, as detected by staining assay. (F) Ad-RUNX3 enhanced BMP9-induced ALP activity in C2C12 cells, as detected by quantitive assay. (G) Ad-siRUNX3 enhanced BMP9-induced ALP activity in C2C12 cells, as detected by staining assay. (H) Ad-siRUNX3 enhanced BMP9-induced ALP activity in C2C12 cells, as detected by quantitive assay. Magnification, ×100. *P<0.05 vs. BMP9 group.

Effect of RUNX3 on the BMP9-induced increase of the late osteogenic marker, matrix mineralization

Although ALP is an early osteogenic marker, it is hardly an accurate late osteogenic marker. Thus, we sought to examine the effect of RUNX3 on the BMP9-induced late osteogenic marker, matrix mineralization. We found that transfection with Ad-RUNX3 increased BMP9-induced matrix mineralization in C3H10T1/2 cells (Fig. 3A–a) and C2C12 cells (Fig. 3B–a). On the contrary however, transfection with Ad-siRUNX3 decreased BMP9-induced matrix mineralization, as shown in the C3H10T1/2 cells (Fig. 3A–b) and C2C12 cells (Fig. 3B–b). These results suggest that RUNX3 affects the BMP9-induced osteogenic differentiation of MSCs.

Figure 3

Effect of runt-related transcription factor 3 (RUNX3) on bone morphogenetic protein 9 (BMP9)-induced matrix mineralization of mesenchymal stem cells (MSCs). (A–a) Adenovirus (Ad)-RUNX3 enhanced BMP9-induced matrix mineralization in C3H10T1/2 cells, as detected by Alizarin Red S staining. (b) Adenovirus expressing small interfering RNA (siRNA) targeted against RUNX3 (Ad-siRUNX3) inhibited BMP9-induced matrix mineralization in C3H10T1/2 cells, as detected by Alizarin Red S staining. (B–a) Ad-RUNX3 enhanced BMP9-induced matrix mineralization in C2C12 cells, as detected by Alizarin Red S staining. (b) Ad-siRUNX3 inhibited BMP9-induced matrix mineralization in C2C12 cells, as detected by Alizarin Red S staining. Magnification, ×100.

Effect of RUNX3 on the BMP9-induced expression of pivotal osteogenic transcription factors

It has previously been demonstrated that a number of pivotal osteogenic transcription factors, such as Id1, Id2, Id3, DLX5 and RUNX2 are involved in the BMP9-induced osteogenic differentiation of MSCs (39). Thus, in order to evaluate the effect of RUNX3 on the BMP9-induced expression of pivotal osteogenic transcription factors, we infected the C3H10T1/2 cells with Ad-RUNX3, Ad-siRUNX3 or Ad-RFP and then exposed the cells to BMP9-CM. The gene expression levels of Id1, Id2, Id3, DLX5 and RUNX2 were determined by RT-wPCR and the protein levels of DLX5 and RUNX2 were determined by western blot analysis. We found that the expression levels of Id3, DLX5 and RUNX2 were significantly increased by infection with Ad-RUNX3 and decreased by infection with Ad-siRUNX3 (Fig. 4C–E). However, infection with Ad-RUNX3 and Ad-siRUNX3 both increased the BMP9-induced expression of Id1, Id2 (Fig. 4A and B). Subsequently, we further examined the protein expression levels of DLX5 and RUNX2 by western blot analysis, and found that Ad-RUNX3 increased the BMP9-induced expression of DLX5 and RUNX2, while Ad-siRUNX3 decreased the expression of DLX5 and RUNX2 at the protein level (Fig. 4F). Collectively, these results suggest that RUNX3 is involved in regulating the BMP9-induced osteogenic differentiation of MSCs.

Figure 4

Effect of runt-related transcription factor 3 (RUNX3) on pivotal transcription factors during bone morphogenetic protein 9 (BMP9)-induced osteogenic differentiation of mesenchymal stem cells (MSCs). (A) Effect of RUNX3 on THE BMP9-induced gene expression level of Id1 in C3H10T1/2 cells measured by RT-qPCR. (B) Effect of RUNX3 on BMP9-induced gene expression level of Id2 in C3H10T1/2 cells measured by RT-qPCR. (C) Effect of RUNX3 on BMP9-induced gene expression level of Id3 in C3H10T1/2 cells measured by RT-qPCR. (D) Effect of RUNX3 on the BMP9-induced gene expression level of DLX5 measured by RT-qPCR. (E) Effect of RUNX3 on BMP9-induced gene expression level of RUNX2 measured by RT-qPCR. (F) Effect of RUNX3 on BMP9-induced protein level of DLX5 and RUNX2 measured by western blot analysis. Representative bands and a corresponding bar diagram are shown. *P<0.05 vs. BMP9 group.

Effect of RUNX3 on BMP9-induced classical Smad-dependent signaling and Smad-independent MAPK signaling

We then sought to examine the possible mechanisms behind the effect of RUNX3 on the BMP9-induced osteogenic differentiation of MSCs. Previous studies have reported that the Smad-dependent signaling pathway and Smad-independent MAPK pathways are crucial in regulating BMP9 osteoinductive signaling (17–19). Thus, we wished to confirm whether RUNX3 can affect BMP9-activated Smad signaling and MAPK signaling in MSCs. We infected the C3H10T1/2 cells with Ad-RUNX3 or/and Ad-siRUNX3 (Fig. 5A). We found that Ad-RUNX3 increased the BMP9-induced phosphorylation of Smad1/5/8, whereas Ad-siRUNX3 decreased the BMP9-induced phosphorylation of Smad1/5/8 (Fig. 5A and B). We also found that BMP9 simultaneously stimulated the phosphorylation of p38 and ERK1/2 in the osteogenic differentiation process of MSCs (Fig. 5C and D), consistent with previous results (18). However, RUNX3 did not alter the BMP9-induced activation of p38 and ERK1/2 (Fig. 5C and D). These results indicate that RUNX3 regulates the BMP9-induced differentiation of MSCs via canonical Smad signaling.

Figure 5

Effect of runt-related transcription factor 3 (RUNX3) on bone morphogenetic protein 9 (BMP9)-induced Smad-dependent and Smad-independent MAPK pathways. (A) Adenovirus (Ad)-RUNX3 and adenovirus expressing small interfering RNA (siRNA) targeted against RUNX3 (Ad-siRUNX3) were transfected into the C3H10T1/2 cells (MOI=5). Magnification, ×100. (B) Effect of RUNX3 on BMP9-activitated Smad signaling. Representative bands and a corresponding bar diagram are shown. (C) Effect of RUNX3 on BMP9-induced p38 and ERK1/2. Representative bands and a corresponding bar diagram are shown in (D). *P<0.05 vs. BMP9 group.

Discussion

BMP9 [also known as growth differentiation factor-2 (GDF-2)], was originally isolated from fetal mouse liver and has been shown to stimulate hepatocyte proliferation (38). Other roles of BMP9 include regulating glucose and lipid metabolism in the liver (39), inducing the cholinergic phenotype of embryonic basal forebrain cholinergic neurons (40) and maintaining homeostasis of iron metabolism (41). Previously, BMP9 was identified as one of the most potent osteogenic BMPs both in vitro and in vivo (16), and yet it remains one of the least characterized BMPs. RUNX family members are similar in mRNA and protein structure and are co-distributed in skeletal elements (33–35). It also has been reported that RUNX2 is essential for osteogenesis and is involved in BMP9-induced osteogenesis (16,26,27,36). Although RUNX3 is an important regulator during chondrocyte differentiation and bone formation (42–44), the detailed role of RUNX3 in BMP9-induced osteogenesis is largely unknown. In the present study, we found RUNX3 regulated BMP9-induced osteogenesis via Smad signaling.

BMP9 was found to increase endogenous RUNX3 expression in MSCs in the present study. Notably, the overexpression of RUNX3 and the knockdown of RUNX3 both led to a potent promotion of ALP levels. RUNX1, RUNX2 and RUNX3 are all expressed in mesenchymal condensation (34). It has been previously demonstrated that after achieving the knockdown of one of the three RUNX members, the remaining RUNX proteins may compensate for the lack of the targeted one (32). Therefore, we speculate that this redundant function among the RUNX family may lead to the increased ALP activity following the knockdown of RUNX3. BMP9-induced late osteogenic marker matrix mineralization was enhanced by the overexpression of RUNX3, whereas it was inhibited by the knockdown of RUNX3. We noticed that the results of the ALP content and matrix mineralization were not consistent. We therefore hypothesized that this phenomenon may due to the following reasons: i) the sustained expression of RUNX3 and the knockdown of RUNX3 cannot reproduce the spatial and temporal expression pattern of RUNX3 during osteogenic differentiation; ii) the redundant function among the RUNX family may exert a differential influence on ALP and matrix mineralization.

Many pivotal transcription factors, such as Id, DLX5 and RUNX2 are involved in the BMP9-induced osteogenesis of MSCs (11). DLX5 and RUNX2 are also key transcription factors associated with osteogenesis (26,27,45). In this study, however, we find that the transcriptional levels of Id1 and Id2 were both upregulated by the overexpression and/or knockdown of RUNX3. We speculate that the redundant function among the RUNX family may have lead to this phenomenon. The results revealed that RUNX3 regulated important transcription factors involved in the BMP9-induced osteogenesis of MSCs.

We validated that Smad1/5/8, ERK1/2, p38 and JNKs are all involved in BMP9 osteoiductive signaling (17–19), implying that Smad-dependent and Smad-independent MAPK pathways are most important in regulating the BMP9-induced osteogenic differentiation of MSCs. In the present study, we found that the phosphorylation of Smad1/5/8 was increased by the overexpression of RUNX3 and was inhibited by the knockdown of RUNX3. This result suggests that RUNX3 may affect BMP9-induced Smad signaling. One possible explanation of the RUNX3 effect on Smad signaling is that RUNX3 may facilitate Smad1/5/8 to bind to BMP type I receptor which can directly phosphorylate Smad1/5/8. Additionally, nuclear export factor RanBP3 can regulate the phosphorylation of Smad1/5/8 by controlling the nucleocytoplasmic shuttling of Smad1, Smad5 and Smad8 (Smad1/5/8) (46,47). Nuclear phosphatases, such as PPM1A can also affect the phosphorylation of Smad1/5/8 by dephosphorylating Smad1/5/8 (48,49). Therefore another explanation of the RUNX3 effect on Smad signaling is that RUNX3 may interact with RanBP3 and/or PPM1A to affect Smad1/5/8 phosphorylation. BMP9 can simultaneously stimulate the phosphorylation/activation of p38 and ERK1/2 (18). However, RUNX3 did not affect the BMP9-induced phosphorylation of p38 and ERK1/2. Taken together, our results strongly indicate that RUNX3 is likely to play regulatory roles in the BMP9-induced osteogenic differentiation of MSCs mainly by affecting the Smad signaling cascade.

Previous studies have demonstrated that RUNX3 is an important regulator of chondrocyte differentiation (30–32,50,51). The loss of osteoblastic RUNX3 produces severe congenital osteopenia (33). To date, little is known about RUNX3 during osteogenesis. In this study, we explored the detailed roles of RUNX3 during the BMP9-induced osteogenic differentiation of MSCs. We found that RUNX3 played an important role during BMP9-induced osteogenesis. These finding may contribute not only to enrich our understanding of the osteoinductive activity of BMP9, but may also provide a solid basis for the use of BMP9 in bone tissue engineering. Future studies are warranted to identity the direct target gene of RUNX3 during BMP9-induced osteogenesis and explore the precise mechanisms responsible for the effects of RUNX3 on the phosphorylation of Smad1/5/8.

Acknowledgments

This study was supported by grants from the National Natural Science Foundation of China (no. 81272006) and the Natural Science Foundation Project of Chongqing Science and Technology Commission (no. cstc2013jcyjA10061)

References

1 

Deschaseaux F, Pontikoglou C and Sensébé L: Bone regeneration: The stem/progenitor cells point of view. J Cell Mol Med. 14:103–115. 2010. View Article : Google Scholar

2 

Shenaq DS, Rastegar F, Petkovic D, Zhang BQ, He BC, Chen L, Zuo GW, Luo Q, Shi Q, Wagner ER, et al: Mesenchymal progenitor cells and their orthopedic applications: Forging a path towards clinical trials. Stem Cells Int. 2010:5190282010. View Article : Google Scholar

3 

Thakker R and Yang P: Mesenchymal stem cell therapy for cardiac repair. Curr Treat Options Cardiovasc Med. 16:3232014. View Article : Google Scholar : PubMed/NCBI

4 

Myers TJ, Granero-Molto F, Longobardi L, Li T, Yan Y and Spagnoli A: Mesenchymal stem cells at the intersection of cell and gene therapy. Expert Opin Biol Ther. 10:1663–1679. 2010. View Article : Google Scholar : PubMed/NCBI

5 

García-Gómez I, Elvira G, Zapata AG, Lamana ML, Ramírez M, Castro JG, Arranz MG, Vicente A, Bueren J and García-Olmo D: Mesenchymal stem cells: Biological properties and clinical applications. Expert Opin Biol Ther. 10:1453–1468. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Deng ZL, Sharff KA, Tang N, Song WX, Luo J, Luo X, Chen J, Bennett E, Reid R, Manning D, et al: Regulation of osteogenic differentiation during skeletal development. Front Biosci. 13:2001–2021. 2008. View Article : Google Scholar

7 

Arthur A, Zannettino A and Gronthos S: The therapeutic applications of multipotential mesenchymal/stromal stem cells in skeletal tissue repair. J Cell Physiol. 218:237–245. 2009. View Article : Google Scholar

8 

Stappenbeck TS and Miyoshi H: The role of stromal stem cells in tissue regeneration and wound repair. Science. 324:1666–1669. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Botchkarev VA: Bone morphogenetic proteins and their antagonists in skin and hair follicle biologyn. J Invest Dermatol. 120:37–47. 2003. View Article : Google Scholar

10 

Zhao GQ: Consequences of knocking out BMP signaling in the mouse. Genesis. 35:43–56. 2003. View Article : Google Scholar

11 

Luu HH, Song WX, Luo X, Manning D, Luo J, Deng ZL, Sharff KA, Montag AG, Haydon RC and He TC: Distinct roles of bone morphogenetic proteins in osteogenic differentiation of mesenchymal stem cells. J Orthop Res. 25:665–677. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Varady P, Li JZ, Alden TD, Kallmes DF, Williams MB and Helm GA: CT and radionuclide study of BMP-2 gene therapy-induced bone formation. Acad Radiol. 9:632–637. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Krebsbach PH, Gu K, Franceschi RT and Rutherford RB: Gene therapy-directed osteogenesis: BMP-7-transduced human fibroblasts form bone in vivo. Hum Gene Ther. 11:1201–1210. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Boraiah S, Paul O, Hawkes D, Wickham M and Lorich DG: Complications of recombinant human BMP-2 for treating complex tibial plateau fractures: A preliminary report. Clin Orthop Relat Res. 467:3257–3262. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Rutherford RB, Nussenbaum B and Krebsbach PH: Bone morphogenetic protein 7 ex vivo gene therapy. Drug News Perspect. 16:5–10. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Kang Q, Sun MH, Cheng H, Peng Y, Montag AG, Deyrup AT, Jiang W, Luu HH, Luo J, Szatkowski JP, et al: Characterization of the distinct orthotopic bone-forming activity of 14 BMPs using recombinant adenovirus-mediated gene delivery. Gene Ther. 11:1312–1320. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Zhao YF, Xu J, Wang WJ, Wang J, He JW, Li L, Dong Q, Xiao Y, Duan XL, Yang X, et al: Activation of JNKs is essential for BMP9-induced osteogenic differentiation of mesenchymal stem cells. BMB Rep. 46:422–427. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Zhao Y, Song T, Wang W, Wang J, He J, Wu N, Tang M, He B and Luo J: P38 and ERK1/2 MAPKs act in opposition to regulate BMP9-induced osteogenic differentiation of mesenchymal progenitor cells. PLoS One. 7:e433832012. View Article : Google Scholar : PubMed/NCBI

19 

Xu DJ, Zhao YZ, Wang J, He JW, Weng YG and Luo JY: Smads, p38 and ERK1/2 are involved in BMP9-induced osteogenic differentiation of C3H10T1/2 mesenchymal stem cells. BMB Rep. 45:247–252. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Luo J, Tang M, Huang J, He BC, Gao JL, Chen L, Zuo GW, Zhang W, Luo Q, Shi Q, et al: TGFbeta/BMP type I receptors ALK1 and ALK2 are essential for BMP9-induced osteogenic signaling in mesenchymal stem cells. J Biol Chem. 285:29588–29598. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Zhang W, Zhang L, Zhou Y, Ji X, Liu J, Liu D, Yin P, Peng Y, Hao M, Zhang L, et al: Synergistic effects of BMP9 and miR-548d-5p on promoting osteogenic differentiation of mesenchymal stem cells. Biomed Res Int. 2015:3097472015. View Article : Google Scholar : PubMed/NCBI

22 

Zhang R, Weng Y, Li B, Jiang Y, Yan S, He F, Chen X, Deng F, Wang J and Shi Q: BMP9-induced osteogenic differentiation is partially inhibited by miR-30a in the mesenchymal stem cell line C3H10T1/2. J Mol Histol. 46:399–407. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Song Q, Zhong L, Chen C, Tang Z, Liu H, Zhou Y, Tang M, Zhou L, Zuo G, Luo J, et al: miR-21 synergizes with BMP9 in osteogenic differentiation by activating the BMP9/Smad signaling pathway in murine multilineage cells. Int J Mol Med. 36:1497–1506. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Choi JY, Pratap J, Javed A, Zaidi SK, Xing L, Balint E, Dalamangas S, Boyce B, van Wijnen AJ, Lian JB, et al: Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue-specific differentiation during embryonic development. Proc Natl Acad Sci USA. 98:8650–8655. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe AH and Speck NA: Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci USA. 93:3444–3449. 1996. View Article : Google Scholar : PubMed/NCBI

26 

Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, et al: Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell. 89:765–771. 1997. View Article : Google Scholar : PubMed/NCBI

27 

Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, et al: Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 89:755–764. 1997. View Article : Google Scholar : PubMed/NCBI

28 

Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R, Bernstein Y, Goldenberg D, Xiao C, Fliegauf M, et al: The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons. EMBO J. 21:3454–3463. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Brenner O, Levanon D, Negreanu V, Golubkov O, Fainaru O, Woolf E and Groner Y: Loss of Runx3 function in leukocytes is associated with spontaneously developed colitis and gastric mucosal hyperplasia. Proc Natl Acad Sci USA. 101:16016–16021. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Soung Y, Dong Y, Wang Y, Zuscik MJ, Schwarz EM, O'Keefe RJ and Drissi H: Runx3/AML2/Cbfa3 regulates early and late chondrocyte differentiation. J Bone Miner Res. 22:1260–1270. 2007. View Article : Google Scholar

31 

Yoshida CA and Komori T: Role of Runx proteins in chondrogenesis. Crit Rev Eukaryot Gene Expr. 15:243–254. 2005. View Article : Google Scholar

32 

Stricker S, Fundele R, Vortkamp A and Mundlos S: Role of Runx genes in chondrocyte differentiation. Dev Biol. 245:95–108. 2002. View Article : Google Scholar : PubMed/NCBI

33 

Bauer O, Sharir A, Kimura A, Hantisteanu S, Takeda S and Groner Y: Loss of osteoblast Runx3 produces severe congenital osteopenia. Mol Cell Biol. 35:1097–1109. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Levanon D and Groner Y: Structure and regulated expression of mammalian RUNX genes. Oncogene. 23:4211–4219. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Levanon D, Brenner O, Negreanu V, Bettoun D, Woolf E, Eilam R, Lotem J, Gat U, Otto F, Speck N, et al: Spatial and temporal expression pattern of Runx3 (Aml2) and Runx1 (Aml1) indicates non-redundant functions during mouse embryogenesis. Mech Dev. 109:413–417. 2001. View Article : Google Scholar : PubMed/NCBI

36 

Sharff KA, Song WX, Luo X, Tang N, Luo J, Chen J, Bi Y, He BC, Huang J, Li X, et al: Hey1 basic helix-loop-helix protein plays an important role in mediating BMP9-induced osteogenic differentiation of mesenchymal progenitor cells. J Biol Chem. 284:649–659. 2009. View Article : Google Scholar :

37 

He TC, Zhou S, da Costa LT, Yu J, Kinzler KW and Vogelstein B: A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA. 95:2509–2514. 1998. View Article : Google Scholar : PubMed/NCBI

38 

Song JJ, Celeste AJ, Kong FM, Jirtle RL, Rosen V and Thies RS: Bone morphogenetic protein-9 binds to liver cells and stimulates proliferation. Endocrinology. 136:4293–4297. 1995. View Article : Google Scholar : PubMed/NCBI

39 

Chen C, Grzegorzewski KJ, Barash S, Zhao Q, Schneider H, Wang Q, Singh M, Pukac L, Bell AC, Duan R, et al: An integrated functional genomics screening program reveals a role for BMP-9 in glucose homeostasis. Nat Biotechnol. 21:294–301. 2003. View Article : Google Scholar : PubMed/NCBI

40 

López-Coviella I, Berse B, Krauss R, Thies RS and Blusztajn JK: Induction and maintenance of the neuronal cholinergic phenotype in the central nervous system by BMP-9. Science. 289:313–316. 2000. View Article : Google Scholar : PubMed/NCBI

41 

Truksa J, Peng H, Lee P and Beutler E: Bone morphogenetic proteins 2, 4, and 9 stimulate murine hepcidin 1 expression independently of Hfe, transferrin receptor 2 (Tfr2), and IL-6. Proc Natl Acad Sci USA. 103:10289–10293. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Smith N, Dong Y, Lian JB, Pratap J, Kingsley PD, van Wijnen AJ, Stein JL, Schwarz EM, O'Keefe RJ, Stein GS, et al: Overlapping expression of Runx1(Cbfa2) and Runx2 (Cbfa1) transcription factors supports cooperative induction of skeletal development. J Cell Physiol. 203:133–143. 2005. View Article : Google Scholar

43 

Yoshida CA, Yamamoto H, Fujita T, Furuichi T, Ito K, Inoue K, Yamana K, Zanma A, Takada K, Ito Y, et al: Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog. Genes Dev. 18:952–963. 2004. View Article : Google Scholar : PubMed/NCBI

44 

Kim EJ, Cho SW, Shin JO, Lee MJ, Kim KS and Jung HS: Ihh and Runx2/Runx3 signaling interact to coordinate early chondrogenesis: A mouse model. PLoS One. 8:e552962013. View Article : Google Scholar : PubMed/NCBI

45 

Ferrari D, Harrington A, Dealy CN and Kosher RA: Dlx-5 in limb initiation in the chick embryo. Dev Dyn. 216:10–15. 1999. View Article : Google Scholar : PubMed/NCBI

46 

Chen F, Lin X, Xu P, Zhang Z, Chen Y, Wang C, Han J, Zhao B, Xiao M and Feng XH: Nuclear export of smads by ranBP3L regulates bone morphogenetic protein signaling and mesenchymal stem cell differentiation. Mol Cell Biol. 35:1700–1711. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Dai F, Lin X, Chang C and Feng XH: Nuclear export of Smad2 and Smad3 by RanBP3 facilitates termination of TGF-beta signaling. Dev Cell. 16:345–357. 2009. View Article : Google Scholar : PubMed/NCBI

48 

Lin X, Duan X, Liang YY, Su Y, Wrighton KH, Long J, Hu M, Davis CM, Wang J, Brunicardi FC, et al: PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125:915–928. 2006. View Article : Google Scholar : PubMed/NCBI

49 

Dai F, Shen T, Li Z, Lin X and Feng XH: PPM1A dephosphorylates RanBP3 to enable efficient nuclear export of Smad2 and Smad3. EMBO Rep. 12:1175–1181. 2011. View Article : Google Scholar : PubMed/NCBI

50 

Wigner NA, Soung Y, Einhorn TA, Drissi H and Gerstenfeld LC: Functional role of Runx3 in the regulation of aggrecan expression during cartilage development. J Cell Physiol. 228:2232–2242. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Dalcq J, Pasque V, Ghaye A, Larbuisson A, Motte P, Martial JA and Muller M: RUNX3, EGR1 and SOX9B form a regulatory cascade required to modulate BMP-signaling during cranial cartilage development in zebrafish. PLoS One. 7:e501402012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Feng Q, Ji C, Liu X, Li L and Luo J: RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells. Int J Mol Med 40: 1991-1999, 2017.
APA
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., & Luo, J. (2017). RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells. International Journal of Molecular Medicine, 40, 1991-1999. https://doi.org/10.3892/ijmm.2017.3155
MLA
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., Luo, J."RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells". International Journal of Molecular Medicine 40.6 (2017): 1991-1999.
Chicago
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., Luo, J."RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells". International Journal of Molecular Medicine 40, no. 6 (2017): 1991-1999. https://doi.org/10.3892/ijmm.2017.3155
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Feng Q, Ji C, Liu X, Li L and Luo J: RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells. Int J Mol Med 40: 1991-1999, 2017.
APA
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., & Luo, J. (2017). RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells. International Journal of Molecular Medicine, 40, 1991-1999. https://doi.org/10.3892/ijmm.2017.3155
MLA
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., Luo, J."RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells". International Journal of Molecular Medicine 40.6 (2017): 1991-1999.
Chicago
Wang, Y., Feng, Q., Ji, C., Liu, X., Li, L., Luo, J."RUNX3 plays an important role in mediating the BMP9-induced osteogenic differentiation of mesenchymal stem cells". International Journal of Molecular Medicine 40, no. 6 (2017): 1991-1999. https://doi.org/10.3892/ijmm.2017.3155
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team