SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction

Boehringer,Tim; Bugert,Peter; Borggrefe,Martin; Elmas,Elif

doi:10.3892/mmr.2014.2401

SCN5A mutations and polymorphisms in patients with ventricular fibrillation during acute myocardial infarction

Authors:
- Tim Boehringer
- Peter Bugert
- Martin Borggrefe
- Elif Elmas
View Affiliations

Affiliations: Institute of Transfusion Medicine and Immunology, German Red Cross Blood Service Baden‑Württemberg, Hessen 68167, Germany, Medical Faculty Mannheim, Heidelberg University, Mannheim 68167, Germany
Published online on: July 21, 2014 https://doi.org/10.3892/mmr.2014.2401
Pages: 2039-2044

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )

Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )

Cited By (CrossRef): 0 citations Loading Articles...

Abstract

Mutations in the SCN5A gene encoding the Nav1.5 channel α-subunit are known to be risk factors of arrhythmia, including Brugada Syndrome and Long QT syndrome subtype 3. The present study focused on the role of SCN5A variants in the development of ventricular fibrillation (VF) during acute myocardial infarction (AMI). Since VF during AMI is the major cause of sudden death in the Western world, SCN5A mutations represent genetic risk factors for sudden death. By exon re-sequencing, the entire coding region and flanking intron regions were sequenced in 46 AMI/VF+ patients. In total, nine single nucleotide variants were identified of which four represented common single nucleotide polymorphisms (SNPs; 87G>A, 1673A>G, IVS16‑6C>T and 5457T>A). Only five rare variants were identified, each in only one patient. Only two of the rare variants represented missense mutations (3578G>A and 4786T>A). The common SNPs and the missense mutations were also genotyped using polymerase chain reaction methods in 79 AMI/VF‑ patients and 480 healthy controls. The SNPs did not demonstrate significant differences in allele and genotype frequencies between the study groups. The 3578G>A mutation was identified in one out of the 480 controls, whereas the 4786T>A mutation was not present in AMI/VF- patients and controls. In conclusion, the majority of AMI/VF+ patients demonstrated a wild type sequence or common SNPs in SCN5A. Only two out of 46 (4.3%) AMI/VF+ patients revealed mutations that may be involved in Nav1.5 dysfunction and VF. However, this requires further functional validation.

Introduction

In the Western world ventricular fibrillation (VF) during acute myocardial infarction (AMI) is the major cause of sudden cardiac death (SCD) (1). VF occurs in 10% of cases within the first hours following the symptoms of an AMI (2,3). In addition to established risk factors for VF, a significant genetic component may be detected using extensive observational population studies (4–7). In primary electrical heart diseases, including Long QT syndrome (LQTS), Short QT syndrome and Brugada syndrome, genes encoding ion channels are mutated.

The SCN5A gene encodes the major cardiac voltage-gated sodium channel α-subunit Nav1.5 and is located on chromosome 3p21–24 (8). Exons 2–28 contain the protein-coding sequence and several splice variants have been described (9). The major role of the sodium channel is the rapid depolarization at the beginning of an action potential and the transmission of electrical impulses in the heart myocardia (8,10). Mutations in SCN5A may affect different mechanisms, including channel activation, inactivation and reactivation or may lead to complete loss of function (11). Mutations were identified in different types of arrhythmias (12–15), i.e. in 10–20% of patients with Brugada syndrome and in 6% of patients with Long QT syndrome subtype 3 (LQTS3). Common polymorphisms in SCN5A modulate the biophysical defects of SCN5A mutations (16–19) or may be associated with an increased risk of SCD (20). The potential association of SCN5A variants with VF during AMI remains unclear. Among a small cohort of 19 patients suffering from VF during AMI, only one demonstrated a missense mutation in SCN5A (21). In our previous study on 240 AMI patients, including 73 patients with primary VF an association of the SCN5A-H558R polymorphism with the risk of VF or AMI was not identified (22).

The present study aimed to investigate the role of SCN5A mutations and polymorphisms in the development of VF during AMI. Screening for DNA sequence variation in the coding region of SCN5A was performed by exon re-sequencing in patients suffering from VF during AMI (AMI/VF+). For common single nucleotide polymorphisms (SNPs) and rare mutations identified in the AMI/VF+ patients polymerase chain reaction with sequence-specific primers (PCR-SSP) was developed. In order to estimate the role of these gene variants as risk factors for VF or AMI, the present study additionally genotyped AMI/VF− patients and healthy controls.

Materials and methods

Patients and controls

Patients were recruited from the First Department of Medicine (Cardiology), University Medical Centre (Mannheim, Germany). The controls were recruited at the Institute of Transfusion Medicine and Immunology, German Red Cross Blood Service (Mannheim, Germany). In total 49 Patients who suffered from VF during AMI (AMI/VF+) and 74 AMI patients without VF (AMI/VF−) were included. Additionally, a control group of 480 healthy blood donors was analyzed. The baseline characteristics of the study individuals are summarized in Table I. All patients and controls provided written consent to use biological material for molecular genetic research purposes. The study was approved by the ethics committee of the Medical Faculty Mannheim, Heidelberg University (Mannheim, Germany). DNA was extracted from EDTA blood samples of all study individuals using commercial kits (QIAamp® DNA Blood Mini kit; Qiagen, Hilden, Germany).

Table I

Baseline characteristics of patients and controls.

Mutation screening and genotyping

SCN5A exons 2–28 were amplified from genomic DNA using flanking intron primers (Table II). Sequencing was performed on the two strands with the use of the amplification primers.

Table II

Primers for amplification and re-sequencing of SCN5A exons 2–28.

Table II

Primers for amplification and re-sequencing of SCN5A exons 2–28.

Target	Binding region	Direction	Sequence (5′-3′)	Final MgCl₂ conc. (mM)	Size (bp)
Exon 2 (part I)	Intron 1	Sense	ctgtccctgggcatagaatc	3.5	188
Exon 2 (part I)	Exon 2	Antisense	ttctctgccatgcgcttctc	3.5	188
Exon 2 (part II)	Exon 2	Sense	cagcttccgcaggttcacac	2.0	288
Exon 2 (part II)	Intron 2	Antisense	ggagttgcacagaagggtag	2.0	288
Exon 3	Intron 2	Sense	tctacacaagggcctaatgctac	2.0	274
Exon 3	Intron 3	Antisense	agggaatcagcgctactctc	2.0	274
Exon 4	Intron 3	Sense	cccatgctgctcagctttcc	2.0	152
Exon 4	Intron 4	Antisense	gtggagaagaggccctgaag	2.0	152
Exon 5	Intron 4	Sense	acgtaaggaacctggagaacc	3.5	306
Exon 5	Intron 5	Antisense	agggaggaagccagaaagag	3.5	306
Exon 6	Intron 5	Sense	caggcggtggttctgctttg	2.0	424
Exon 6	Intron 6	Antisense	aaggcccaggcatatccctc	2.0	424
Exon 7	Intron 6	Sense	cgtgcttgttcttgccttcc	3.5	299
Exon 7	Intron 7	Antisense	gctggtctcacaaagtcttc	3.5	299
Exon 8	Intron 7	Sense	cctggatgcaaggcggaaac	2.0	274
Exon 8	Intron 8	Antisense	gaagggtcctggcaggtaag	2.0	274
Exon 9	Intron 8	Sense	tggcactaggtttgtgaagc	2.0	325
Exon 9	Intron 9	Antisense	ctgagcccacacttgctgtc	2.0	325
Exon 10	Intron 9	Sense	cctggcacaactagactagg	3.5	332
Exon 10	Intron 10	Antisense	agtcaggtgagggcttagag	3.5	332
Exon 11	Intron 10	Sense	ggctgcacaaagtctcaatg	2.0	348
Exon 11	Intron 11	Antisense	aaacaggaagcgcagagatg	2.0	348
Exon 12	Intron 11	Sense	ccctctcctcatgcccttag	2.0	425
Exon 12	Intron 12	Antisense	tgctgtggtgcctgcatctc	2.0	425
Exon 13	Intron 12	Sense	cccaggctgacgcaaatctc	2.0	242
Exon 13	Intron 13	Antisense	tgggtcaggctgggataaag	2.0	242
Exon 14	Intron 13	Sense	gtcatctcccagagcaagtc	2.0	379
Exon 14	Intron 14	Antisense	caggatgcccatttgagagc	2.0	379
Exon 15	Intron 14	Sense	ggccagggagtctttccatc	2.0	283
Exon 15	Intron 15	Antisense	ttgggttgtgccgagccttc	2.0	283
Exon 16	Intron 15	Sense	ccagagcccttcacaaggtc	2.0	442
Exon 16	Intron 16	Antisense	gctgggtagatgagtggatg	2.0	442
Exon 18	Intron 17	Sense	gcatgggcagggtctgaaac	3.5	284
Exon 18	Intron 18	Antisense	gctggcttcagggacaaagg	3.5	284
Exon 21	Intron 20	Sense	ggcttcatgtccaccttgtc	2.0	256
Exon 21	Intron 21	Antisense	cggcaatgggtttctccttc	2.0	256
Exon 22	Intron 21	Sense	cccatttctactttgcctccc	3.5	172
Exon 22	Intron 22	Antisense	tgggaaggcagccacctc	3.5	172
Exon 23	Intron 22	Sense	aaagggcatgtgctctgg	2.0	378
Exon 23	Intron 23	Antisense	ccattgggaggaaggaagtc	2.0	378
Exon 24	Intron 23	Sense	gaagctcaagcgaggtacag	2.0	229
Exon 24	Intron 24	Antisense	acgagatcttgcccttgtgg	2.0	229
Exon 26	Intron 25	Sense	ggttggtgccttctctttgc	3.5	244
Exon 26	Intron 26	Antisense	ctcaggctgggctgaaagac	3.5	244
Exon 27	Intron 26	Sense	gggatgagaggcagcaacag	2.0	373
Exon 27	Intron 27	Antisense	gtccagctgacttgtatacc	2.0	373
Exon 28 (Part I)	Intron 27	Sense	gacagaggtgccaccagtag	3.5	450
Exon 28 (Part I)	Exon 28	Antisense	cccgagagccattgctgttg	3.5	450
Exon 28 (Part II)	Exon 28	Sense	acccatccaagatctcctac	3.5	494
Exon 28 (Part II)	Exon 28	Antisense	tggtggtgatgggctcgtag	3.5	494

For the single nucleotide variations (mutations and SNPs) identified by mutation screening PCR-SSP methods were established according to standard protocols (23) and the primers are provided in Table III. In addition, PCR-SSP methods were developed for SCN5A variants 1062T>C, 354G>C, 287C>T and 1199G>C, which were associated with arrhythmia in previous studies (21,24). All patients and controls were genotyped for the SCN5A variants using PCR-SSP.

Table III

Primers for PCR-SSP typing of SCN5A variants.

Statistical analysis

Fisher exact and χ2 tests were performed to investigate differences between the study cohorts in the baseline characteristics as well as allele and genotype frequencies of the SCN5A polymorphisms. SPSS statistical software version 12.0 (SPSS, Inc., Chicago, IL, USA) was used for the statistical analysis.

Results and Discussion

Screening for SCN5A sequence variations in the entire coding region and flanking intron regions was achieved by exon re-sequencing in 46 AMI/VF+ patients. In total, nine single nucleotide variations were identified and were all listed in the Single Nucleotide Polymorphism Database and LQTS gene Leiden Open Variation Database (25) (Table IV). Four variants (87G>A, 1673A>G, IVS16-6C>T and 5457T>A) represented common SNPs of which only 1673A>G (His558Arg) was a missense variant. However, all SNPs have previously been described as normal variants without an association with arrhythmia (26–31).

Table IV

Single nucleotide variants identified in the SCN5A gene of AMI/VF+ patients.

The 630G>A variant is rare and was found in exon 6b of one AMI/VF+ patient. The amino acids encoded by exon 6b are present in the major ‘adult’ SCN5A isoform, whereas exon 6a is alternatively spliced in the ‘neonatal’ isoform (9). However, the nucleotide change 630G>A does not alter the encoded amino acid and no effect on protein function was assumed. The variants 3183G>A and 4509C>T also represent rare and silent variants, each found in only one AMI/VF+ patient. The rare and silent variants were not further investigated in the present study.

In one AMI/VF+ patient (79 year old, male) the missense mutation 3578G>A (R1193Q) was identified. The mutation was described as a normal variant with a frequency of 0.3% in Caucasians (32). However, the mutation conducts a longer QT-time and an association with LQTS has been discussed (33,34). Associations have also been described with Brugada syndrome, progressive cardiac conduction defect (PCCD) and sudden infant death syndrome (30,34,35). Recently, the R1193Q variant was described in a young Korean patient (3 year old, male) with LQTS (36).

The missense mutation 4786T>A (F1596I) in exon 27 was found in one AMI/VF+ patient (54 year old, male). In a previous study the mutation was found in two out of 2,500 LQTS patients; however, not in the 1,300 individuals of the control group (37). An association with primary atrial fibrillation has been discussed; however, no evidence for an effect of the mutation on the channel function has been described (38).

In order to evaluate allele and genotype frequencies, the common SNPs (87G>A, 1673A>G, IVS16-6C>T and 5457T>A) were genotyped by PCR-SSP in all patients (49 AMI/VF+ and 74 AMI/VF−) and controls (480 healthy blood donors). The differences in allele and genotype frequencies between the study groups were not identified to be statistically significant (Table V). The rare missense mutations (3578G>A and 4786T>A) were screened by PCR-SSP in AMI/VF− patients and controls. None of the AMI/VF− 74 patients were positive for the two mutations, whereas, one of the 480 controls was positive for the 3578G>A mutation. All study individuals were also screened for the SCN5A variants (1062T>C, 354G>C, 287C>T and 1199G>C) that were associated with arrhythmia in previous studies (21,24). However, none of the patients or controls were positive for these variants.

Table V

Genotype frequency of SCN5A variants.

In conclusion, mutations in the SCN5A gene are relatively uncommon in AMI/VF+ patients. In the present study only two out of 49 AMI/VF+ patients (4.1%) demonstrated SCN5A variants that may be the cause of VF.

Acknowledgements

This study was supported by the DZHK (German Centre for Cardiovascular Research) and by the BMBF (German Ministry of Education and Research).

References

1	Zipes DP and Wellens HJ: Sudden cardiac death. Circulation. 98:2334–2351. 1998. View Article : Google Scholar
2	Spooner PM, Albert C, Benjamin EJ, et al: Sudden cardiac death, genes, and arrhythmogenesis: consideration of new population and mechanistic approaches from a National Heart, Lung, and Blood Institute workshop, Part II. Circulation. 103:2447–2452. 2001. View Article : Google Scholar
3	Zipes DP, Camm AJ, Borggrefe M, et al: European Heart Rhythm Association; Heart Rhythm Society; American College of Cardiology; American Heart Association Task Force; European Society of Cardiology Committee for Practice Guidelines: ACC/AHA/ESC 2006 guidelines for management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: a report of the American College of Cardiology/American Heart Association Task Force and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Develop Guidelines for Management of Patients With Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death). J Am Coll Cardiol. 48:e247–e346. 2006.
4	Friedlander Y, Siscovick DS, Weinmann S, et al: Family history as a risk factor for primary cardiac arrest. Circulation. 97:155–160. 1998. View Article : Google Scholar : PubMed/NCBI
5	Jouven X, Desnos M, Guerot C and Ducimetière P: Predicting sudden death in the population: the Paris Prospective Study I. Circulation. 99:1978–1983. 1999. View Article : Google Scholar : PubMed/NCBI
6	Kaikkonen KS, Kortelainen ML, Linna E and Huikuri HV: Family history and the risk of sudden cardiac death as a manifestation of an acute coronary event. Circulation. 114:1462–1467. 2006. View Article : Google Scholar : PubMed/NCBI
7	Novotny T, Kadlecova J, Raudenska M, et al: Mutation analysis ion channel genes ventricular fibrillation survivors with coronary artery disease. Pacing Clin Electrophysiol. 34:742–749. 2011. View Article : Google Scholar : PubMed/NCBI
8	Rook MB, Evers MM, Vos MA and Bierhuizen MF: Biology of cardiac sodium channel Nav1.5 expression. Cardiovasc Res. 93:12–23. 2012. View Article : Google Scholar
9	Schroeter A, Walzik S, Blechschmidt S, Haufe V, Benndorf K and Zimmer T: Structure and function of splice variants of the cardiac voltage-gated sodium channel Na(v)1.5. J Mol Cell Cardiol. 49:16–24. 2010. View Article : Google Scholar : PubMed/NCBI
10	Tfelt-Hansen J, Winkel BG, Grunnet M and Jespersen T: Inherited cardiac diseases caused by mutations in the Nav1.5 sodium channel. J Cardiovasc Electrophysiol. 21:107–115. 2010. View Article : Google Scholar : PubMed/NCBI
11	Kapplinger JD, Tester DJ, Alders M, et al: An international compendium of mutations in the SCN5A-encoded cardiac sodium channel in patients referred for Brugada syndrome genetic testing. Heart Rhythm. 7:33–46. 2010. View Article : Google Scholar
12	Remme CA, Wilde AA and Bezzina CR: Cardiac sodium channel overlap syndromes: different faces of SCN5A mutations. Trends Cardiovasc Med. 18:78–87. 2008. View Article : Google Scholar : PubMed/NCBI
13	Ruan Y, Liu N and Priori SG: Sodium channel mutations and arrhythmias. Nat Rev Cardiol. 6:337–348. 2009. View Article : Google Scholar : PubMed/NCBI
14	Wang DW, Desai RR, Crotti L, et al: Cardiac sodium channel dysfunction in sudden infant death syndrome. Circulation. 115:368–376. 2007. View Article : Google Scholar : PubMed/NCBI
15	Watanabe H, Nogami A, Ohkubo K, et al: Electrocardiographic characteristics and SCN5A mutations in idiopathic ventricular fibrillation associated with early repolarization. Circ Arrhythm Electrophysiol. 4:874–881. 2011. View Article : Google Scholar
16	Park JK, Martin LJ, Zhang X, Jegga AG and Benson DW: Genetic variants in SCN5A promoter are associated with arrhythmia phenotype severity in patients with heterozygous loss-of-function mutation. Heart Rhythm. 9:1090–1096. 2012. View Article : Google Scholar : PubMed/NCBI
17	Marangoni S, Di Resta C, Rocchetti M, et al: A Brugada syndrome mutation (p. S216L) and its modulation by pH558R polymorphism: standard and dynamic characterization. Cardiovasc Res. 91:606–616. 2011. View Article : Google Scholar : PubMed/NCBI
18	Cheng J, Tester DJ, Tan BH, et al: The common African American polymorphism SCN5A-S1103Y interacts with mutation SCN5A-R680H to increase late Na current. Physiol Genomics. 43:461–466. 2011. View Article : Google Scholar : PubMed/NCBI
19	Shinlapawittayatorn K, Du XX, Liu H, Ficker E, Kaufman ES and Deschênes I: A common SCN5A polymorphism modulates the biophysical defects of SCN5A mutations. Heart Rhythm. 8:455–462. 2011. View Article : Google Scholar : PubMed/NCBI
20	Lahtinen AM, Noseworthy PA, Havulinna AS, et al: Common genetic variants associated with sudden cardiac death: the FinSCDgen study. PLoS One. 7:e416752012. View Article : Google Scholar : PubMed/NCBI
21	Hu D, Viskin S, Oliva A, et al: Novel mutation in the SCN5A gene associated with arrhythmic storm development during acute myocardial infarction. Heart Rhythm. 4:1072–1080. 2007. View Article : Google Scholar : PubMed/NCBI
22	Elmas E, Bugert P, Popp T, Lang S, Weiss C, Behnes M, Borggrefe M and Kälsch T: The P-selectin gene polymorphism Val168Met: a novel risk marker for the occurrence of primary ventricular fibrillation during acute myocardial infarction. J Cardiovasc Electrophysiol. 21:1260–1265. 2010. View Article : Google Scholar
23	Bugert P, Lese A, Meckies J, Zieger W, Eichler H and Klüter H: Optimized sensitivity of allele-specific PCR for prenatal typing of human platelet alloantigen single nucleotide polymorphisms. Biotechniques. 35:170–174. 2003.
24	Bezzina CR, Shimizu W, Yang P, et al: Common sodium channel promoter haplotype in asian subjects underlies variability in cardiac conduction. Circulation. 113:338–344. 2006. View Article : Google Scholar
25	Zhang T, Moss A, Cong P, et al: LQTS gene LOVD database. Hum Mutat. 31:E1801–E1810. 2010. View Article : Google Scholar : PubMed/NCBI
26	Ackerman MJ, Siu BL, Sturner WQ, Tester DJ, Valdivia CR, Makielski JC and Towbin JA: Postmortem molecular analysis of SCN5A defects in sudden infant death syndrome. JAMA. 286:2264–2269. 2001. View Article : Google Scholar : PubMed/NCBI
27	Takahata T, Yasui-Furukori N, Sasaki S, Igarashi T, Okumura K, Munakata A and Tateishi T: Nucleotide changes in the translated region of SCN5A from Japanese patients with Brugada syndrome and control subjects. Life Sci. 72:2391–2399. 2003. View Article : Google Scholar : PubMed/NCBI
28	Gouas L, Nicaud V, Berthet M, Forhan A, Tiret L, Balkau B and Guicheney P: Association of KCNQ1, KCNE1, KCNH2 and SCN5A polymorphisms with QTc interval length in a healthy population. Eur J Hum Genet. 13:1213–1222. 2005. View Article : Google Scholar : PubMed/NCBI
29	Lai LP, Su YN, Hsieh FJ, et al: Denaturing high-performance liquid chromatography screening of the long QT syndrome-related cardiac sodium and potassium channel genes and identification of novel mutations and single nucleotide polymorphisms. J Hum Genet. 50:490–496. 2005. View Article : Google Scholar
30	Arnestad M, Crotti L, Rognum TO, et al: Prevalence of long-QT syndrome gene variants in sudden infant death syndrome. Circulation. 115:361–367. 2007. View Article : Google Scholar : PubMed/NCBI
31	Zhang Y, Chang B, Hu S, et al: Single nucleotide polymorphisms and haplotype of four genes encoding cardiac ion channels in Chinese and their association with arrhythmia. Ann Noninvasive Electrocardiol. 13:180–190. 2008. View Article : Google Scholar : PubMed/NCBI
32	Ackerman MJ, Splawski I, Makielski JC, et al: Spectrum and prevalence of cardiac sodium channel variants among black, white, Asian, and Hispanic individuals: implications for arrhythmogenic susceptibility and Brugada/long QT syndrome genetic testing. Heart Rhythm. 1:600–607. 2004. View Article : Google Scholar
33	Wang Q, Chen S, Chen Q, et al: The common SCN5A mutation R1193Q causes LQTS-type electrophysiological alterations of the cardiac sodium channel. J Med Genet. 41:e662004. View Article : Google Scholar : PubMed/NCBI
34	Sun A, Xu L, Wang S, et al: SCN5A R1193Q polymorphism associated with progressive cardiac conduction defects and long QT syndrome in a Chinese family. J Med Genet. 45:127–128. 2008. View Article : Google Scholar : PubMed/NCBI
35	Huang H, Zhao J, Barrane FZ, Champagne J and Chahine M: Nav1.5/R1193Q polymorphism is associated with both long QT and Brugada syndromes. Can J Cardiol. 22:309–313. 2006. View Article : Google Scholar : PubMed/NCBI
36	Kwon HW, Lee SY, Kwon BS, et al: Long QT syndrome and dilated cardiomyopathy with SCN5A p. R1193Q polymorphism: cardioverter-defibrillator implantation at 27 months. Pacing Clin Electrophysiol. 35:e243–e246. 2012. View Article : Google Scholar : PubMed/NCBI
37	Kapplinger JD, Tester DJ, Salisbury BA, et al: Spectrum and prevalence of mutations from the first 2,500 consecutive unrelated patients referred for the FAMILION long QT syndrome genetic test. Heart Rhythm. 6:1297–1303. 2009. View Article : Google Scholar : PubMed/NCBI
38	Olesen MS, Yuan L, Liang B, et al: High prevalence of long QT syndrome-associated SCN5A variants in patients with early-onset lone atrial fibrillation. Circ Cardiovasc Genet. 5:450–459. 2012. View Article : Google Scholar : PubMed/NCBI

October 2014
Volume 10 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Recommend to Library

Journal Metrics
Impact Factor: 3.4
Ranked Medicine Research and Experimental
(total number of cites)
CiteScore: 7.6
CiteScore Rank: Q1: #82/347 Biochemistry, Genetics and Molecular Biology
Source Normalized Impact per Paper (SNIP): 0.647
SCImago Journal Rank (SJR): 0.781

Characteristic	AMI/VF⁺ patients (n=49)	AMI/VF⁻ patients (n=74)	Controls (n=480)	Significance (P-value)a
No. of males (%)	44 (91.8)	53 (71.6)	288 (60.0)	0.045a
				<0.001b
Age (mean ± SD)	60.7±10.0	61.0±12.0	57.3±6.7	0.903a
				0.001b
CAD, n (%)
1-vessel disease	28 (57.1)	27 (36.5)	-	0.028a
2-vessel disease	18 (36.7)	22 (29.7)	-	0.438a
3-vessel disease	3 (6.1)	25 (33.8)	-	<0.001a
No. of patients with hypertension (%)	27 (55.1)	40 (54.1)	-	0.909a
No. of patients with hyperlipoproteinemia (%)	26 (53.1)	47 (63.5)	-	0.266a
No. of smokers (%)	26 (53.1)	38 (51.4)	-	0.853a
No. of patients with diabetes mellitus (%)	11 (22.4)	17 (23.0)	-	0.946a
No. of patients with a family history of myocardial infarction (%)	12 (24.5)	17 (23.0)	-	0.830a

SCN5A variation	Gene region	Direction	Specificity	Sequence (5′-3′)	Size (bp)
−1062T>C	Promoter	Sense	1062T	ccccataggtcctgggcat	127
		Sense	1062C	ccccataggtcctgggcac	127
		Antisense		cagagcctggagtcacatac
−354G>C	Promoter	Sense	−354G	ccgcggacagacagacatag	138
		Sense	−354C	gtatactctggcgggtgctgg	138
		Antisense		gtatactctggcgggtgctgc
287C>T	Intron 1	Sense	287C	gtccctgcgtgctcctcc	145
		Sense	287T	gtccctgcgtgctcctct	145
		Antisense	Generic	ggcgcacggtgtttagagac
87G>A	Exon 2	Sense	87G	catcgagaagcgcatggcg	168
		Sense	87A	catcgagaagcgcatggca	168
		Antisense	Generic	ggctctccgatgagctcttg
1199G>C (G400A)	Exon 10	Sense	Generic	cctggcacaactagactagg
		Antisense	1199G	gttcaccaggtagaaggacc	166
		Antisense	1199C	gttcaccaggtagaaggacg	166
1673A>G (H558R)	Exon 12	Sense	1673A	ggagagcgagagccacca	139
		Sense	1673G	ggagagcgagagccaccg	139
		Antisense	Generic	ttgcagtccacagtgctgttc
IVS16C>T	Intron 16	Sense	IVS16-6C	gtgagcctgacccattatctc
		Sense	IVS16-6T	gtgagcctgacccattatct	299
		Antisense	Generic	tggtggtgatgggctcgtag	299
3578G>A (R1193Q)	Exon 20	Sense	3578G	agggaaggtctggtggcg	304
		Sense	3578A	agggaaggtctggtggca	304
		Antisense	Generic	tcctgctctggcctccatac
4786T>A (F1596I)	Exon 27	Sense	4786T	caacagctggaatatcttcgact	148
		Sense	4786A	caacagctggaatatcttcgaca	148
		Antisense	Generic	gaagctagggttgtacatgg
5457T>A	Exon 28	Sense	5457T	tcctgtctgactttgccgat	180
		Sense	5457A	tcctgtctgactttgccgac	180
		Antisense	Generic	tcttcagggcgtccatctcc

Variant	Genotypea	AMI/VF⁺ n (%)	AMI/VF⁻ n (%)	Controls n (%)	Significance (P-value)
−1062T>C	TT	49 (100)	74 (100)	480 (100)	-
−354G>C	GG	49 (100)	74 (100)	480 (100)	-
287C>T	CC	49 (100)	74 (100)	480 (100)	-
87G>A	GG	31 (68.9)	50 (69.4)	294 (63.0)	0.188b
	GA	12 (26.7)	22 (30.6)	158 (33.8)	0.568c
	AA	2 (4.4)	0 (0)	15 (3.2)	0.378d
1199G>C	GG	49 (100)	74 (100)	480 (100)	-
1673A>G	AA	34 (69.4)	46 (62.2)	283 (59.3)	0.712b
	AG	14 (28.6)	26 (35.1)	168 (35.2)	0.345c
	GG	1 (2.0)	2 (2.7)	26 (5.5)	0.277d
IVS16-6C>T	CC	45 (93.9)	-	444 (92.7)	-
	CT	3 (6.1)	-	34 (7.1)	0.919c
	TT	0 (0)	-	1 (0.2)	-
3578G>A	GG	48 (98.0)	74 (100)	479 (99.8)	-
	GA	1 (2.0)	0 (0)	1 (0.2)	0.046c
	AA	0 (0)	0 (0)	0 (0)	-
4786T>A	TT	48 (98.0)	74 (100)	480 (100)	-
	TA	1 (2.0)	0 (0)	0 (0)	-
	AA	0 (0)	0 (0)	0 (0)	-
5457T>A	TT	20 (42.6)	30 (44.8)	208 (44.3)	0.669b
	TA	20 (42.6)	32 (47.8)	209 (44.6)	0.801c
	AA	7 (14.8)	5 (7.4)	52 (11.1)	0.973d

Molecular
Medicine
Reports