Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2016 Volume 13 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2016 Volume 13 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes

  • Authors:
    • Ke Jiang
    • Guo Chun
    • Ziming Wang
    • Quanyin Du
    • Aimin Wang
    • Yan Xiong
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Affiliated Hospital of North Sichuan Medical College, Nanchong, Sichuan 637000, P.R. China, Department of Medicine, Luohe Medical College, Luohe, Henan 462002, P.R. China, Department of Orthopedics, Daping Hospital, The Third Military Medical University, Chongqing 400042, P.R. China
  • Pages: 3567-3573
    |
    Published online on: February 29, 2016
       https://doi.org/10.3892/mmr.2016.4944
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Tendon adhesion is a common problem in the healing of injured tendons. The molecular mechanisms of the TGF-β/Smad signaling pathway have been determined, and the role of TGF-β has been well characterized in wound healing. However, the intracellular mechanism or downstream signals by which TGF-β3 modulates its effects on tendon healing have not been well elucidated. The aim of this study was to determine the effect of TGF‑β3 on the TGF-β/Smad signaling pathway in tenocytes. Quantitative polymerase chain reaction and western blot analysis were used to analyze the effect of TGF‑β3 on the regulation of the expression of Smad proteins in tenocytes. The results demonstrated that TGF‑β3 has no significant effect on the proliferation of tendon cells. The addition of TGF‑β3 to tenocytes can significantly downregulate the expression of Smad3 and upregulate the expression of Smad7 at the gene and protein levels. The results demonstrate that TGF‑β3 may regulate Smad3 and Smad7 proteins through the TGF-β/Smad signaling pathway to minimize extrinsic scarring. Thus, it may provide a novel approach to decrease tendon adhesion and promote tendon healing.

Introduction

One of the greatest challenges in tendon healing is adhesion formation, caused by tissue scarring around the injured tendon sheath, resulting in limited finger functions (1). Despite improvements in materials and surgical techniques, various pharmacological modalities and the evolution of rehabilitative therapies, the postoperative outcome of flexor tendon healing remains limited by flexor tendon adhesion. In particular, peritendinous adhesion formation continues to present a problem. Tendon healing often causes disorganization of the extracellular matrix (ECM) and the formation of scar tissue predominantly composed of dense collagenous fibers. Healed tendons often have inferior mechanical properties compared with undamaged tendons. Therefore, restoration of function and structure of injured tendons is an important problem in hand surgery (2).

Injured tendon healing relies on the levels of growth factors and cytokines to ensure that cellular responses are mediated in an appropriate manner. Among the numerous growth factors involved, transforming growth factor β (TGF-β) is suggested to be key in tendon healing. TGF-βs are a family of a number of isoforms, which have multiple roles in tissue morphogenesis and cell proliferation (3). The TGF-β isoforms have different effects during wound healing and scarring. TGF-β1 is found at high levels in the wound microenvironment and promotes myofibroblast differentiation, production of ECM components and fibroblast chemotaxis. In addition, TGF-β1 promotes the formation of scar tissue during adult wound healing. However, embryonic wound microenvironments contain low levels of TGF-β1 and high levels of TGF-β3 (4). Furthermore, the addition of exogenous TGF-β3 to an adult wound promotes scar-free healing in rats (5), and injuries obtained in utero heal scar free, possibly due to the relatively high levels of TGF-β3 compared with TGF-β1. In addition, developmental research in chickens has shown that the TGF-β3 isoform is existent throughout the morphogenesis of tendon tissue (6).

The role of TGF-β in wound healing has been well demonstrated and numerous cellular and molecular mechanisms underlying the TGF-β/Smad signaling pathway have been identified; however, the intracellular mechanisms and downstream signals of TGF-β in wound healing are poorly understood. Targeting the inhibition of TGF-β signaling pathway using therapeutic agents to reduce scarring and improve wound healing has been successful in pre-clinical studies (7,8). Despite these studies, the intracellular mechanism and downstream signals by which TGF-β3 adjusts these effects in healing tendons are poorly understood. A recent study has demonstrated that Smad proteins act as key transcription factors for the TGF-β signaling pathway (9). There are three groups of Smad proteins: Receptor activated Smads, common mediator Smads and inhibitory Smads (10). Smad3 is a receptor activated Smad and is phosphorylated in response to TGF-β signaling through the TGF-β type I and TGF-β type II transmembrane receptors (11). Once activated, Smad3 heterodimerizes with Smad4, which is a common mediator Smad, and translocates to the nucleus where Smad3 is hypothesized to modulate the transcription of genes involved in cell growth (12), inflammatory responses (13) and the formation of the ECM (14). Inhibitory Smad proteins, including Smad6 and Smad7, inhibit the phosphorylation of receptor Smad proteins via TGF-β3 receptors, and prevent the association of receptor Smad proteins with Smad4.

The aim of this study was to determine the influence of TGF-β3 in regulating the expression of Smad proteins in tenocytes, and to investigate the underlying TGF-β/Smad signaling pathway.

Materials and methods

Chemicals and reagents

TGF-β3 was purchased from Abcam (Cambridge, UK). Trypsin-EDTA and Dulbecco's modified Eagle's medium (DMEM) were obtained from Gibco; Thermo Fisher Scientific Inc. (Waltham, MA, USA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (St. Louis, MO, USA) and fetal bovine serum (FBS) was purchased from HyClone (Logan, UT, USA). All other analytical grade chemicals were received from typical commercial sources in China.

Tenocyte culture

Tendon tissue was obtained under sterile conditions from the flexor tendon of New Zealand white rabbits (n=3; age, 12 weeks; weight, 2 kg) obtained from the Experimental Animal Center of The Third Military Medical University (Chongqing, China). Animals were maintained in a room with a constant temperature (22±1°C), relative humidity (40–60%) with a 12 h light/dark cycle. The study was approved by the ethics Animal Health Trust Research Ethics Committee of The Third Military Medical University. Rabbits were sacrificed by anaesthetic injection of 3% pentobarbital sodium (1 ml/kg; Merck & Co., Inc., Kenilworth, NJ, USA) and venous air embolism. Three experimental repeats were performed using one line of tendon cells from each animal. The tendon tissue was rinsed with phosphate-buffered saline (PBS) separately 3 times, cut into 1-mm3 sections and then placed into sterile containers. The sections were transferred into 0.1% trypsin-DMEM. Mixtures were then placed on a shaker and digested by 0.1% trypsin-DMEM (Sigma-Aldrich) for 30 min, followed by centrifugation at 44.72 × g for 5 min at 4°C. The supernatant was then discarded and the resulting cell pellets were resuspended in 0.1% collagenase II (Sigma-Aldrich) with DMEM containing 10% FBS for 2 h at 37°C. Tenocytes were then centrifuged at 44.72 × g for 5 min at 4°C and washed twice with Hank's Buffer solution (Sigma-Aldrich), and then filtered through a 70 μm nylon sterile filter to remove debris. The samples were centrifuged at 44.72 × g for 5 min at 4°C to obtain tenocyte pellets and resuspended in a sterile culture bottle in 5 ml DMEM/F12 containing 10% FBS, 100 mg/ml streptomycin and 100 U/ml penicillin (Gibco; Thermo Fisher Scientific, Inc.). Samples were kept at 37°C in an incubator (Heal Force Bio-meditech Holdings Ltd.; Shanghai, China; HF90, CO2 Jacket Incubator) throughout the digestion process. Culture medium was checked and changed every third day until tenocytes were confluent (2×106 cells/cm2). Adherent tenocytes received short-term treatment with 0.25% trypsin in 0.2% EDTA. The growth of tenocytes was monitored under a microscope (Olympus 1X71; Olympus Corporation, Tokyo, Japan). Tenocytes were treated with, or without, TGF-β3 (10 ng/ml) for 1, 2, 4, 6 and 8 h. To evaluate the effect of blocking intracellular protein and mRNA synthesis on the expression of Smad7 and Smad3 induced by TGF-β3, cycloheximide (CHX; Sigma-Aldrich) or actinomycin D (Sigma-Aldrich) were added to tenocytes 2 h prior to the addition of TGF-β3 for 4 h.

Immunohistochemistry assessment

Tenocytes were seeded onto sterile cover glass at a density of 2×106 cells/ml, and then incubated for 3 days. The cover glass was removed and washed with PBS. The tenocytes were fixed with 4% paraformaldehyde (Aladdin Reagent Co., Shanghai, China) for 20 min and washed 3 times for 2 min with PBS. Cells were then treated with 0.5% Triton X-100 (Aladdin Reagent Co.) for 20 min and washed with PBS 3 times for 2 min. Then, 3% H2O2 was applied for 30 min at room temperature, and washed with PBS 3 times for 2 min. After blocking for at least 1 h at room temperature, tenocytes were incubated with 1:100 rabbit polyclonal anti-collagen I (bs-10423R) and rabbit polyclonal anti-collagen III primary antibodies (bs-0549R) (both purchased from Beijing Biosynthesis Biotechnology Co., Ltd., Beijing, China) at 4°C overnight and washed with PBS 3 times for 2 min. Sections were then incubated with 1:100 horseradish peroxidase (HRP)-conjugated goat polyclonal anti-rabbit immunoglobulin G (IgG; bs-0295G-HRP; Beijing Biosynthesis Biotechnology Co., Ltd.) secondary antibody for at least 1 h at room temperature. The cover glass was washed with PBS three times for 10 min. The signal was developed using a HRP-DAB detection kit (Beijing Biosynthesis Biotechnology Co., Ltd.) and washed with water, counterstained with Harris hematoxylin (Beijing Biosynthesis Biotechnology Co., Ltd.) and washed again. Immunoreactivity was then observed under a microscope (Olympus 1X71; Olympus Corporation). The negative control group was treated with PBS. All the steps were the same as in the positive control group.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from the cultured tenocytes using TRIzol reagent (Invitrogen Life Technologies, Grand Island, NY, USA) and quantified using spectrophotometry at 260 nm (Eppendorf BioSpectrometer; Eppendorf AG, Hamburg, Germany). After isolation, 2 μg total RNA was reverse transcribed using the HiFi-MMLV cDNA kit (Beijing CoWin Biotech Co. Ltd., Beijing, China) according to the manufacturer's protocol. The primer sequences for Smad3, Smad7 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) are shown in Table I. Primers were purchased from Shanghai Generay Biotech Co., Ltd. (Shanghai, China). According to the manufacturer's protocol, qPCR was performed with an SYBR Premix Ex Taq [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China]. All qPCR reactions were performed using the ABI PRISM 7700 sequence detection system (Applied Biosystems, Grand Island, NY, USA). In each reaction, 1 μl cDNA, 10 μl SYBR Premix Ex Taq (Takara Biotechnology Inc., Dalian, China), and 0.4 μM forward and reverse primer in a total volume of 20 μl were used. The reaction conditions were as follows: 1 cycle at 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec, and 60–66°C for 30 sec. qPCR for each sample was run in triplicate. β-actin was used as an internal control, and all results were analyzed using the standard 2−ΔΔCq method described previously (15).

Table I

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

Table I

Sequences of primers used for reverse transcription-quantitative polymerase chain reaction.

GeneForward primerReverse primer
Smad3 AGGTCTTCGCAGAGTGCCTCA GGGTCAACTGGTAGACAGCCTCA
Smad7 CCATCACCTTAGCCGACTCTG CCATCGGGTATCTGG-AGTAAGGA
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA

[i] GAPDH, glyceraldehyde 3-phosphate dehyrogenase.

Western blot analysis

At the end, tenocytes culture medium was aspirated and tenocytes were detached by scrapping in PBS. Detached cells were centrifuged at 21,000 × g at 4°C for 5 min. Cell pellets were then lysed in 300 μl lysis buffer (Cytobuster protein extraction reagent; Beijing Biosynthesis Biotechnology Co., Ltd.) with 1 mM Na3VO4, 25 mM NaF and 1X protease inhibitor cocktail (Beijing Biosynthesis Biotechnology Co., Ltd.). Protein concentrations were quantified by spectrophotometry (Eppendorf BioSpectrometer, Eppendorf, Hamburg, Germany). For western blot analysis, equal quantities of protein were loaded onto 12% SDS-PAGE gels (Beijing Biosynthesis Biotechnology Co., Ltd.) and electrotransferred onto polyvinylidne difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). The membranes were then blocked with 5% (w/v) bovine serum albumin in TBST [10 mM Tris, 150 mM NaCl, and 0.1% (v/v) Tween 20, pH=7.5] for 1 h at room temperature, and incubated with 1:500 rabbit polyclonal anti-Smad3 (sc-8332), anti-Smad7 (sc-11392), anti-p-Smad3 (sc-130218) and anti-GAPDH (sc-59540) primary antibodies overnight at 4°C. The membranes were then incubated with 1:500 HRP-conjugated goat polyclonal anti-rabbit IgG (sc-2004) secondary antibody at room temperature for 2 h (Santa Cruz Biotechnology, Inc. Santa Cruz, CA, USA). Enhanced chemiluminescence (Beyotime Institute of Biotechnology, Shanghai, China) was used to observe immunoreactive protein signals. Protein signals were then visualized on films (Beijing Biosynthesis Biotechnology Co., Ltd.), and scanned and quantified using the Image J software (version 1.48; National Institutes of Health, Bethesda, MA, USA). For re-probing, PVDF membranes were stripped with 0.2 M NaOH for 10 min prior to blocking with another primary antibody. The expression of molecules of interest was determined relative to β-actin.

CHX and actinomycin D

CHX was added to block intracellular protein synthesis. In each group, 2 ml CHX (10 μg/ml) was added to pre-process tenocytes 2 h prior to the addition of TGF-β3. Actinomycin D was added to block intracellular mRNA synthesis. In each group, 2 ml actinomycin D (5 pg/ml) was added to pre-process tenocytes 2 h prior to the addition of TGF-β3. Total RNA was isolated for RT-qPCR and statistical analysis as mentioned above.

Statistical analysis

Data are expressed as the mean ± standard deviation for three or more independent experiments. Significant differences were determined using factorial analysis of variance. Statistical analysis was performed using SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Tenocyte culture and immunohistochemistry assessment

Tenocytes were isolated and cultured, and following microscopic analysis were observed to be multi-angle shaped or spindle-shaped (Fig. 1). Immunohistochemical analysis was performed to distinguish between tenocytes and fibroblasts. Immunohistochemical assessment demonstrated that fibroblasts positively stained for collagen I, and stained negaitvely for collagen III (Fig. 2). This demonstrated that the cells were tenocytes.

Figure 1

Tenocytes were spindle-shaped or multi-angle shaped. Magnification ×100.

Figure 2

Immunohistochemical assessment. (A) Collagen I positively stained cells. (B) Collagen II megatively stained cells. Magnification ×200.

RT-qPCR and western blot analysis results

Tenocytes were treated with, or without TGF-β3 (10 ng/ml) for 1, 2, 4, 6 and 8 h (mRNA was detected with each 0.5 h). Addition of TGF-β3 (10 ng/ml) can significantly downregulate the expression of Smad3 mRNA and upregulate the expression of Smad7 mRNA (P<0.01; Fig. 3). After 4 h, treatment with TGF-β3 (10 ng/ml) was observed to significantly downregulate the expression of phosphorylated and non-phosphorylated Smad3 protein and upregulate the expression of Smad7 protein (P<0.01; Fig. 4).

Figure 3

Reverse transcription-quantitative polymerase chain reaction was used to demonstrate the levels of (A) Smad3 and (B) Smad7 following the addition of TGF-β3 (10 ng/ml) for 0, 1, 2, 4, 6 and 8 h. *P<0.05, **P<0.01 compared with control. TGF, transforming growth factor.

Figure 4

Effect of TGF-β3 on the protein expression of Smad3 and Smad7 in tenocytes using western blotting and quantification. (A and B) Protein expression of phosphorylated-Smad3, Smad3 or Smad7 at 1, 2, 4, 6 and 8 h. (C and D) Protein expression of Smad3 or Smad7 at 2, 4, 8 and 24 h. Four hours after the addition of TGF-β3 (10 ng/ml) the expression of phosphorylated and non-phosphorylated Smad3 protein was significantly downregulated and the expression of Smad7 protein was significantly upregulated. *P<0.05. TGF, transforming growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Addition of CHX and actinomycin D

Addition of CHX inhibited the downregulation of Smad3 protein induced by TGF-β3; however, it was not able to block the TGF-β3-induced upregulation of Smad7 (Fig. 5). Furthermore, the addition of actinomycin D inhibited the TGFβ3-induced downregulation of Smad3 protein, and inhibited the TGFβ3-induced upregulation of Smad7 in tenocytes (Fig. 6). The results show that addition of TGF-β3 can significantly downregulate the expression of Smad3 protein and upregulate the expression of Smad7 protein. The addition of CHX was shown to inhibit the downregulation of Smad3 mRNA and protein expression in tenocytes (P<0.01; Fig. 7), but not affect Smad7 mRNA or protein expression (Fig. 7).

Figure 5

Effect of CHX on the protein expression of Smad3 and Smad7 induced by TGF-β3 for 4 h in tenocytes using western blotting. Protein expression of (A) Smad3 and (B) Smad7 at 4 h. TGF, transforming growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; CHX, cyclohexamide.

Figure 6

Effect of actinomycin D on the protein expression of Smad3 and Smad7 induced by TGFβ3 in tenocytes using western blotting. TGF, transforming growth factor; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Figure 7

Effect of CHX on the mRNA expression of Smad3 and Smad7 induced by TGF-β3 in tenocytes using reverse transcription-quantitative polymerase chain reaction. **P<0.01, compared with control. TGF, transforming growth factor; CHX, cyclohexamide.

Discussion

The postoperative outcome of injured flexor tendon healing remains limited by tendon adhesion. Despite improvements in materials and surgical technique, various pharmacological modalities and the evolution of rehabilitative therapies, tendon adhesion remains one of the most unpredictable results of flexor tendon injury. In particular, peritendinous adhesion formation continues to present a problem. The aims of tendon healing after repair are to promote intrinsic tendon healing and to optimize the tendon range of motion (16). In recent years, studies have shown TGF-βs is regulated after tendon injury (17–19). Addition of TGF-β3 induces tenogenic differentiation of in vitro cultures of mesenchymal stem cells (20,21), equine embryo-derived stem cells (17) and micro mass cultures of undifferentiated limb mesenchyme (22). This suggests that TGF-β signaling is important in triggering the initiation of tenocyte differentiation from tendon progenitors. Although the role of TGF-β in fibrosis has been determined, little is known regarding the circulating levels of this cytokine in the injured tendon. In addition, the role of the TGF-β/Smad signaling pathway in tenocyte differentiation remains largely unknown.

TGF-β3, an isoform of the TGF-β superfamily, initiates cellular actions by binding to specific cell-surface receptor complexes typically composed of TGF-β type I (TβRI) and II receptors. Binding of TGF-β to TβRII activates the intrinsic serine/threonine kinase activity of TβRI, which phosphorylates transcription factors Smad2 and Smad3. p-Smad2 or p-Smad3 combine with Smad4, then the Smad2/Smad4 and/or Smad3/Smad4 complexes translocate into the nucleus, where they function to regulate the transcription of specific genes that possess TGF-β response elements in their promoters (23,24). Smad3 knockout mice have been shown to exhibit reduced collagen levels and decreased scarring, as well as increased MMP9 gene and protein expression (7). TGF-β3 is antagonized by Smad7, which interacts stably with TβRI to prevent phosphorylation and activation of receptor-regulated Smad2/3, therefore inhibiting TGF-β signaling (25).

Previous studies have established a role for TGF-β signaling in tendon healing by demonstrating that inhibition of neutralization of TGF-β1 and β2, or the addition of TGF-β3 can decrease adhesion formation (8,26,27). A novel TGF-β3 controlled-released chitosan scaffold has been developed for tissue engineering of the synovial sheath (28). The present study focused on the effect of TGF-β3, and the underlying the TGF-β/Smad signaling pathway on wound healing.

In the present study, Smad3 increased collagen levels and decreased MMP9 gene and protein expression. Smad7 inhibited the phosphorylation of receptor Smads via the TGF-β3 receptors and prevented the association of receptor Smads with Smad4. If TGF-β3 is able to dowregulate the expression of Smad3 protein expression and upregulate the expression of Smad7 protein, it may be used to promote intrinsic tendon healing and reduce adhesion. RT-qPCR and western blot analysis revealed that TGF-β3 downregulated the expression of Smad3 mRNA and upregulated the expression of Smad7 mRNA. Adding CHX and actinomycin D demonstrated that TGF-β3 can significantly downregulate the expression of Smad3 protein and upregulate the expression of Smad7 protein. These results supported the above speculation. Thus, the present study provides important information regarding the specific role of the canonical TGF-β signaling pathway in the process of reducing adhesion formation. The results revealed that adding TGF-β3 is an effective way to promote intrinsic tendon healing, and result in optimized a tendons range of motion.

In conclusion, the present study demonstrates that the addition of TGF-β3 to tenocytes can significantly downregulate the expression of Smad3, and upregulate the expression of Smad7, at the gene and protein level. The results suggest that TGF-β3 may regulate Smad3 and Smad7 protein expression through the TGF-β/Smad signaling pathway to minimize extrinsic scarring. Thus, it may provide a novel approach to decrease tendon adhesion and promote tendon healing. In vivo studies are required in order to provide further evidence of the potential benefits in clinical practice. In the future, the delivery of TGF-β3 may be a novel application in the field of hand flexor tendon surgery.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (grant no. 81000807).

References

1 

Wong JK, Lui YH, Kapacee Z, Kadler KE, Ferguson MW and McGrouther DA: The cellular biology of flexor tendon adhesion formation: An old problem in a new paradigm. Am J Pathol. 175:1938–1951. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Renstrom P, Woo SL-Y and Arnoczky SP: Tendinopathy: A major medical problem in sport. Tendinopathy in Athletes. Blackwell Publishing; Hoboken, NJ: pp. 1–9. 2007, View Article : Google Scholar

3 

Cox DA: Transforming growth factor-beta 3. Cell Biol Int. 19:357–371. 1995. View Article : Google Scholar : PubMed/NCBI

4 

Ferguson MW and O'Kane S: Scar-free healing: From embryonic mechanisms to adult therapeutic intervention. Philos Trans R Soc Lond B Biol Sci. 359:839–850. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Shah M, Foreman DM and Ferguson MW: Neutralisation of TGF-beta1 and TGF-beta2 or exogenous addition of TGF-b3 to cutaneous rat wounds reduces scarring. J Cell Sci. 108:985–1002. 1995.

6 

Kuo CK, Petersen BC and Tuan RS: Spatiotemporal protein distribution of TGF-betas, their receptors and extracellular matrix molecules during embryonic tendon development. Dev Dyn. 237:1477–1489. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Katzel EB, Wolenski M, Loiselle AE, Basile P, Flick LM, Langstein HN, Hilton MJ, Awad HA, Hammert WC and O'Keefe RJ: Impact of Smad3 loss of function on scarring and adhesion formation during tendon healing. J Orthop Res. 29:684–693. 2011. View Article : Google Scholar :

8 

Bates SJ, Morrow E, Zhang AY, Pham H, Longaker MT and Chang J: Mannose-6-phosphate, an inhibitor of transforming growth factor-beta, improves range of motion after flexor tendon repair. J Bone Joint Surg Am. 88:2465–2472. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Kretzschmar M and Massagué J: Smads: Mediators and regulators of TGF-beta signaling. Curr Opin Genet Dev. 8:103–111. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Derynck R and Zhang YE: Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 425:577–584. 2003. View Article : Google Scholar : PubMed/NCBI

11 

Brown KA, Pietenpol JA and Moses HL: A tale of two proteins: Differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling. J Cell Biochem. 101:9–33. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Moustakas A, Pardali K, Gaal A and Heldin CH: Mechanisms of TGF-beta signaling in regulation of cell growth and differentiation. Immunol Lett. 82:85–91. 2002. View Article : Google Scholar : PubMed/NCBI

13 

Dennler S, Goumans MJ and ten Dijke P: Transforming growth factor beta signal transduction. J Leukoc Biol. 71:731–740. 2002.PubMed/NCBI

14 

Arany PR, Flanders KC, Kobayashi T, Kuo CK, Stuelten C, Desai KV, Tuan R, Rennard SI and Roberts AB: Smad3 deficiency alters key structural elements of the extracellular matrix and mechanotransduction of wound closure. Proc Natl Acad Sci USA. 103:9250–9255. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

16 

Elliot D, Barbieri CH, Evans RB, Mass D and Tang JB: IFSSH flexor tendon committee report 2007. J Hand Surg Eur Vol. 32:346–356. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Barsby T and Guest D: Transforming growth factor beta3 promotes tendon differentiation of equine embryo-derived stem cells. Tissue Eng Part A. 19:2156–2165. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Chan KM, Fu SC, Wong YP, Hui WC, Cheuk YC and Wong MW: Expression of transforming growth factor beta isoforms and their roles in tendon healing. Wound Repair Regen. 16:399–407. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Chen CH, Cao Y, Wu YF, Bais AJ, Gao JS and Tang JB: Tendon healing in vivo: Gene expression and production of multiple growth factors in early tendon healing period. J Hand Surg Am. 33:1834–1842. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Kapacee Z, Yeung CY, Lu Y, Crabtree D, Holmes DF and Kadler KE: Synthesis of embryonic tendon-like tissue by human marrow stromal/mesenchymal stem cells requires a three-dimensional environment and transforming growth factor β3. Matrix Biol. 29:668–677. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Barsby T, Bavin EP and Guest DJ: Three-dimensional culture and transforming growth factor beta3 synergistically promote tenogenic differentiation of equine embryo-derived stem cells. Tissue Eng Part A. 20:2604–2613. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Lorda-Diez CI, Montero JA, Martinez-Cue C, Garcia-Porrero JA and Hurle JM: Transforming growth factors beta coordinate cartilage and tendon differentiation in the developing limb mesenchyme. J Biol Chem. 284:29988–29986. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Wrana JL, Attisano L, Wieser R, Ventura F and Massagué J: Mechanism of activation of the TGF-beta receptor. Nature. 370:341–347. 1994. View Article : Google Scholar : PubMed/NCBI

24 

Finnson KW, McLean S, Di Guglielmo GM and Philip A: Dynamics of transforming growth factor beta signaling in wound healing and scarring. Adv Wound Care (New Rochelle). 2:195–214. 2013. View Article : Google Scholar

25 

Wang W, Huang XR, Li AG, Liu F, Li JH, Truong LD, Wang XJ and Lan HY: Signaling mechanism of TGF-beta1 in prevention of renal inflammation: Role of Smad7. J Am Soc Nephrol. 16:1371–1383. 2005. View Article : Google Scholar : PubMed/NCBI

26 

Chang J, Thunder R, Most D, Longaker MT and Lineaweaver WC: Studies in flexor tendon wound healing: Neutralizing antibody to TGF-beta1 increases postoperative range of motion. Plast Reconstr Surg. 105:148–155. 2000. View Article : Google Scholar : PubMed/NCBI

27 

Jorgensen HG, McLellan SD, Crossan JF and Curtis AS: Neutralisation of TGF beta or binding of VLA-4 to fibronectin prevents rat tendon adhesion following transection. Cytokine. 30:195–202. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Jiang K, Wang Z, Du Q, Yu J, Wang A and Xiong Y: A new TGF-β3 controlled released chitosan scaffold for tissue engineering synovial sheath. J Biomed Mater Res A. 102:801–807. 2014. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jiang K, Chun G, Wang Z, Du Q, Wang A and Xiong Y: Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes. Mol Med Rep 13: 3567-3573, 2016.
APA
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., & Xiong, Y. (2016). Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes. Molecular Medicine Reports, 13, 3567-3573. https://doi.org/10.3892/mmr.2016.4944
MLA
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., Xiong, Y."Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes". Molecular Medicine Reports 13.4 (2016): 3567-3573.
Chicago
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., Xiong, Y."Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes". Molecular Medicine Reports 13, no. 4 (2016): 3567-3573. https://doi.org/10.3892/mmr.2016.4944
Copy and paste a formatted citation
x
Spandidos Publications style
Jiang K, Chun G, Wang Z, Du Q, Wang A and Xiong Y: Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes. Mol Med Rep 13: 3567-3573, 2016.
APA
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., & Xiong, Y. (2016). Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes. Molecular Medicine Reports, 13, 3567-3573. https://doi.org/10.3892/mmr.2016.4944
MLA
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., Xiong, Y."Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes". Molecular Medicine Reports 13.4 (2016): 3567-3573.
Chicago
Jiang, K., Chun, G., Wang, Z., Du, Q., Wang, A., Xiong, Y."Effect of transforming growth factor-β3 on the expression of Smad3 and Smad7 in tenocytes". Molecular Medicine Reports 13, no. 4 (2016): 3567-3573. https://doi.org/10.3892/mmr.2016.4944
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team