Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism

  • Authors:
    • Heqi Gao
    • Mingming Zhai
    • Pan Wang
    • Xuhui Zhang
    • Jing Cai
    • Xiaofei Chen
    • Guanghao Shen
    • Erping Luo
    • Da Jing
  • View Affiliations / Copyright

    Affiliations: Department of Biomedical Engineering, Fourth Military Medical University, Xi'an, Shaanxi 710032, P.R. China, Department of Endocrinology, Xijing Hospital, Fourth Military Medical University, Xi'an, Shaanxi 710032, P.R. China, Department of Biomedical Engineering, Bethune International Peace Hospital, Shijiazhuang, Hebei 050082, P.R. China
  • Pages: 317-324
    |
    Published online on: May 19, 2017
       https://doi.org/10.3892/mmr.2017.6608
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Osteoporosis is a skeletal metabolic disease characterized by reduced bone mass and a high susceptibility to fractures, in which osteoblasts and osteoclasts are highly involved in the abnormal bone remodeling processes. Recently, low‑magnitude, high‑frequency whole‑body vibration has been demonstrated to significantly reduce osteopenia experimentally and clinically. However, the underlying mechanism regarding how osteoblastic activity is altered when bone tissues adapt to mechanical vibration remains elusive. The current study systematically investigated the effect and potential molecular signaling mechanisms in mediating the effects of mechanical vibration (0.5 gn, 45 Hz) on primary osteoblasts in vitro. The results of the present study demonstrated that low‑level mechanical stimulation promoted osteoblastic proliferation and extracellular matrix mineralization. In addition, it was also revealed that mechanical vibration induced improved cytoskeleton arrangement in primary osteoblasts. Furthermore, mechanical vibration resulted in significantly increased gene expression of alkaline phosphatase, bone morphogenetic protein 2 and osteoprotegerin, and suppressed sclerostin gene expression, as determined by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) analyses. Mechanical vibration was observed to upregulate gene and protein expression levels of osteogenesis‑associated biomarkers, including osteocalcin and Runt‑related transcription factor 2. In addition, RT‑qPCR and western blotting analysis demonstrated that mechanical vibration promoted gene and protein expression of canonical Wnt signaling genes, including Wnt3a, low‑density lipoprotein receptor‑related protein 6 and β‑catenin. In conclusion, the present study demonstrated that mechanical vibration stimulates osteoblastic activities and may function through a potential canonical Wnt signaling‑associated mechanism. These findings provided novel information that improves the understanding of the molecular mechanisms involved in osteoblastic activities in response to mechanical vibration, which may facilitate the scientific application of mechanical vibration for the treatment of osteoporosis in the clinic.

Introduction

The skeleton has the capacity to continuously remodeling its own mass and architecture in response to external mechanical stimuli (1,2). It is well established that increased mechanical loading, such as through exercise or resistance training, may promote bone formation (1,3), and that loss of weight-bearing activities (prolonged bed rest or microgravity) causes a significant decrease in bone mass and bone strength (4). The process of mechanical loading that regulates bone quality and bone remodeling involves the coordinated action of bone-resorbing osteoclasts and bone-forming osteoblasts (5). However, the mechanisms by which the skeleton and bone cells sense and transduce external mechanical stimulation have not yet been fully elucidated. Understanding the mechanisms of bone mechanotransduction and mechanobiology is significant for determining the etiology of osteoporosis, which may potentially lead to improved treatment of clinically-associated bone diseases.

Since the findings by Rubin et al (6) demonstrating the enhancement of bone mass in normal and osteoporotic animals following low-intensity, high-frequency whole-body vibration (WBV) in 2001 (7), numerous studies and increasing experimental evidence substantiates that WBV may be able to improve bone microarchitecture and regulate bone metabolism (8–14). In addition, several clinical investigations have indicated the positive effect of WBV on promoting bone mass in normal and osteoporosis patients (11,14). Compared with traditional physical exercise, WBV demonstrates prominent superiority, as it is simple, safe, convenient and noninvasive. Despite observing significant inhibitory effects of WBV on osteopenia/osteoporosis, no explicit mechanisms have yet been established that explain WBV-induced regulation of bone remodeling. It has been speculated that WBV may affect bone cells via vibration-induced direct bone matrix strain (15) or interstitial fluid shear stress (16). Despite these plausible experimental hypotheses and promising conclusions concerning mechanical vibration-induced bone tissue transfer to individual cells, it remains necessary to explore the responses of osteoblasts directly subjected to WBV stimulation in vitro. This has the potential to increasing the understanding of how bone cells respond to mechanical vibration, and may therefore provide additional scientific applications of mechanical vibration for the treatment of osteoporosis in the clinic.

The canonical Wnt signaling pathway, also known as the Wnt/β-catenin pathway, has been implicated in promoting osteoblastic differentiation and proliferation, and inhibiting osteoblastic apoptosis (17,18). Extracellular Wnt proteins bind to the Frizzled and low-density lipoprotein receptor-related protein (Lrp) 5/6 co-receptors on the cell membrane, which subsequently leads to the stabilization of β-cateninin the cytoplasm, and may promote further Wnt-targeted gene transcription in the cell nucleus. Substantial evidence has indicated that activation of the canonical Wnt signaling pathway has the capacity of enhancing the expression of osteogenesis-associated cytokines, including bone morphogenetic protein 2 (BMP2) and Runt-related transcription factor 2 (Runx2) (19,20). Previous studies have demonstrated that Wnt, Lrp6 or β-catenin gene knockout mice exhibit an abnormal bone remodeling phenotype (21–23). Therefore, accumulating evidence confirms the essential role of the canonical Wnt signaling pathway in promoting osteoblastogenesis and regulating bone remodeling (21,24–26). However, it remains necessary to investigate the role of the canonical Wnt signaling in WBV-regulated osteogenesis and bone anabolism.

In the present study, the effects of mechanical vibration on cell proliferation, mineralization, cytoskeletal microarchitecture and osteogenesis-associated gene and protein expression in primary newborn rabbit calvarial osteoblasts was systematically investigated. In addition, the impact of mechanical vibration on the gene and protein expression levels of the canonical Wnt signaling in primary osteoblasts was examined.

Materials and methods

In vitro mechanical loading devices

A custom-designed mechanical vibration system was employed in the present study to generate low-intensity and high-frequency loads to primary osteoblasts in vitro (Fig. 1A). For in vitro mechanical loading, cell culture plates containing primary osteoblasts were placed on the platform (30×30×30 cm). An electromagnetic actuator (Shanghai Huixia Instrument Co., Ltd., Shanghai, China) controlled by a function generator (Shanghai Huixia Instrument Co., Ltd.) was mounted beneath the platform to generate the vertical vibratory motion. An accelerometer (VIB-5; Shanghai Xinsheng Detecting Instrument Co., Ltd., Shanghai, China) was attached to the vibration platform to measure the mechanical signals transmitted to the cells. The machine generating systems imposed the vibration loading on osteoblasts in vitro at a sinusoidal waveform (0.5 gn, 45 Hz).

Figure 1.

Effects of mechanical vibration on the cytoskeleton and proliferation of primary rabbit osteoblasts. (A) Schematic representation of the mechanical vibration generator. For the in vitro experiment, a cell culture dish containing primary osteoblasts was placed on the platform (30×30×30 cm). The vertical vibratory motion was generated by an electromagnetic actuator mounted beneath the platform. The system generated a sinusoidal waveform with a vertical acceleration of 0.5 g at a frequency of 45 Hz. (B) Representative images of phalloidin-fluorescein isothiocyanate cytoskeleton staining of primary osteoblasts in vitro in the control and mechanical vibration groups (Scale bar, 20 µm). (C) Mechanical vibration for 3 days significantly promoted osteoblastic proliferation, as demonstrated using Cell Counting Kit-8 assay analysis (n=10). Values are expressed as the mean ± standard deviation, *P<0.05 vs. control. OD, optical density.

Cell culture of primary osteoblasts

All procedures in the experiment were approved by the Institutional Animal Care and Use Committee of the Fourth Military Medical University. A total of five one-day-old New Zealand rabbits were euthanized with CO2, and primary osteoblasts were obtained by digesting the calvarial bone of the rabbits (Animal Center of the Fourth Military Medical University, Xi'an, China) according to the procedures described previously (27). Cells were maintained in α-minimum essential medium (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) containing 10% fetal bovine serum (Hyclone; GE Healthcare Life Sciences) and 1% penicillin/streptomycin (Hyclone; GE Healthcare Life Sciences) at 37°C. Primary rabbit osteoblasts were identified via Alizarin Red staining for mineralization nodules, using methods described previously (28). Cells at passage 3–6 were used in the experiment. Cells were seeded onto the 6-well plate for 12 h at 37°C. Cells in the mechanical vibration group were subjected to 1 h/day mechanical vibratory stimulation for 3 consecutive days at room temperature. Cells in the control group were simultaneously placed onto the inactivated mechanical loading platform.

In vitro osteoblastic cytoskeletal morphology

Primary rabbit osteoblasts were seeded (1 ml) into a 35 mm confocal laser dish at a density of 1×105 cells/ml. One dish constituted one sample. Following mechanical vibration stimulation, primary osteoblastic cells were fixed in 4% formaldehyde solution for 5 min and then permeabilized with 0.1% Triton X-100 to evaluate osteoblastic cytoskeletal morphology. Cells were then stained with 50 mg/ml phalloidin-fluorescein isothiocyanate (FITC) (Sigma-Aldrich; Merck Millipore, Darmstadt, Germany) for 40 min and DAPI (Beyotime Institute of Biotechnology, Haimen, China) for 10 min to visualize the cytoskeletal microstructure and the cell nuclei. Following washing with PBS, cells were visualized using a confocal laser scanning microscope (FluoView FV1000; Olympus Corporation, Tokyo, Japan). A total of 10 fields of view of cells were visualized for each dish.

In vitro osteoblastic proliferation

For the proliferation assay, osteoblast suspensions were seeded into 96-well culture plates at a density of 1×104 cells/ml (200 µl/well) and cultured for 12 h to ensure sufficient adhesion to the cell culture plate. One well of a culture plate taken as one sample. Following mechanical vibration stimulation for 3 days, a Cell Counting Kit-8 (CCK-8) assay (Nanjing EnoGene Biotech. Co., Ltd., Nanjing, China) was used to quantify osteoblastic proliferation according to the provided manufacturer's instructions. Briefly, each well of the plate was supplemented with 20 µl CCK-8 solution, and incubated at 37°C for 2 h. The cell culture plate was then shaken for 1 min and the optical density values were examined with a microplate reader at 450 nm wavelength (TecanInfinite M200 Pro; Tecan Trading AG, Zurich, Switzerland).

In vitro osteoblastic osteogenesis-associated gene expression

Primary rabbit osteoblasts were seeded (2 ml) onto a 6-well culture plate at a density of 1×105 cells/ml. A single well of a 6-well culture plate constituted one sample. Total RNA was isolated from the primary osteoblasts using TRIzol (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) and quantified with a spectrophotometer (SmartSpec Plus; Bio-Rad Laboratories, Inc., Hercules, CA, USA). RNA (2 µg) was reverse-transcribed into cDNA in a 40 µl system with oligo (dT)18 primers using the FastQuant RT kit (Tiangen Biotech Co., Ltd., Beijing, China). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using 2 µl cDNA in a 20 µl reaction system with Maxima SYBR-Green qPCR Master Mix (Thermo Fisher Scientific, Inc.) using the Bio-Rad CFX96 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.). The primer sequences utilized for RT-qPCR analyses are shown in Table I. The thermal cycling parameters for RT-qPCR reactions consisted of an initial denaturation step at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec and extension at 55°C for 15 sec. β-actin was used as an internal control for normalization. The relative quantity of mRNA was calculated using 2−∆∆Cq analysis (29). All RT-qPCR reactions were performed in triplicate.

Table I.

The sequence of primers used in the present study for in vitro reverse transcription-quantitative polymerase chain reaction.

Table I.

The sequence of primers used in the present study for in vitro reverse transcription-quantitative polymerase chain reaction.

GenePrimer directionPrimer sequence (5′-3′)Product length (bp)
ALPForward ACGGGGCGTGTATCCTCCAA182
Reverse CCCAAGGAGGCAGGATTGAC
OCNForward TTGGTGCACACCTAGCAGAC187
Reverse ACCTTATTGCCCTCCTGCTT
Runx-2Forward CAGTCTTACCCCTCTTACC130
Reverse CATCTTTACCTGAAATGCG
BMP2Forward GGACGACATCCTGAGCGAGT117
Reverse CGGCGGTACAAGTCCAGCAT
SOSTForward TCTCCCTAGCCCTGTGTCTCCT100
Reverse ACTTCCGTGGCGTCATTCTTGA
Wnt3aForward ATGAACCGCCACAACAAC190
Reverse GCTTCTCCACCACCATCT
Lrp6Forward GCTTGGCACTTGTATGTAAA179
Reverse TGGGCTAAGATCATCAGACT
β-cateninForward GACACGGACCACACGCACAA173
Reverse CCGAGCAGCAGCAAGTCTTCT
OPGForward AACGGCGGCATAGTTCACAAGA170
Reverse GCTGCGAAGCTGATCCAAGGT
β-actinForward TACGCCAACACGGTGCTGTC187
Reverse ACATCTGCTGGAAGGTGGAGAG

[i] ALP, alkaline phosphatase; OCN, osteocalcin; Runx2, Runt-related transcription factor 2; BMP2, bone morphogenetic protein 2; SOST, sclerostin; Lrp6, low-density lipoprotein receptor-related protein 6; OPG, osteoprotegerin.

In vitro osteoblastic osteogenesis-associated protein expression

Primary rabbit osteoblasts were seeded (2 ml) into a 6-well culture plates at a density of 1×105 cells/ml. A single well of a 6-well culture plate constituted a sample. The adherent primary osteoblasts were washed with ice-cold PBS and lysed to obtain total protein using radioimmunoprecipitation assay buffer containing 1 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich; Merck Millipore). The cell lysates were agitated at 4°C for 30 min and then centrifuged at 4°C for 20 min at 30,000 × g. The protein concentration was determined using a bicinchoninic assay kit (Pierce; Thermo Fisher Scientific, Inc.). The protein extracts (30 µg per sample) were separated by 8 or 10% Tris-glycine SDS-PAGE and then transferred onto PVDF membranes (EMD Millipore, Billerica, MA, USA) after mixing with 2X loading buffer. The polyvinylidene difluoride membranes were blocked in TBS 0.5% Tween-20 (TBST) containing 5% bovine serum albumin (BSA) for 1 h at room temperature and incubated overnight at 4°C with primary antibodies. The primary antibodies are listed as follows: Mouse anti-rabbit monoclonal osteocalcin (OCN; dilution, 1:1,000; cat. no. ab13420; Abcam, Cambridge, MA, USA), mouse anti-rabbit monoclonal Runx2 (dilution, 1:1,000; cat. no. BA3613-2; Wuhan Boster Biological Technology, Ltd., Wuhan, China), rabbit polyclonal anti-rabbit Wnt3a (dilution, 1:300; cat. no. bs-23278R; Bioss, Beijing, China), mouse monoclonal anti-rabbit Lrp6 (dilution, 1:300; cat. no. bs-2905R; Bioss), rabbit polyclonal anti-rabbit β-catenin (1:1,000; cat. no. 06-734; EMD Millipore) and mouse monoclonal anti-rabbit GAPDH (1:3,000, cat. no. MB001; Bioworld Technology, Inc., St. Louis Park, MN, USA) antibodies. All primary antibodies were diluted in TBST containing 5% BSA. The membranes were then incubated with a 1:3,000 dilution of horseradish peroxidase-conjugated secondary antibody (cat. no. BA1051; Wuhan Boster Biological Technology, Ltd.) for 1 h at room temperature, and visualized using an enhanced chemiluminescence system (ImageQuant 350; GE Healthcare Life Sciences, Chalfont, UK). Semi-quantitative analysis was performed using the QuantityOne software (version 4.5; Bio-Rad Laboratories, Inc.). GAPDH was used as an internal control for normalization.

In vitro osteoblastic mineralization

Primary rabbit osteoblasts were seeded (2 ml) onto a 6-well culture plate at a density of 1×105 cells/ml. Osteoblastic mineralization was determined using a quantitative Alizarin Red-S staining procedure, as previously described (30,31). One well of a 6-well culture plate was used as one sample. Following mechanical vibration stimulation for 14 consecutive days (1 h/day), the plates containing primary osteoblasts were fixed with 4% paraformaldehyde and then stained with 40 mM Alizarin Red-S (Sigma-Aldrich; Merck Millipore) for 1 h. Following rinsing with PBS, the bound stain was eluted using 0.5 ml of 5% cetylpyridinium chloride. The solubilized stain (0.15 ml) was transferred to a 96-well plate, and the absorbance values were determined at 405 nm with a multimode microplate reader (Tecan Infinite M200 Pro; Tecan Trading AG).

Statistical analysis

All data presented in this study areexpressed as the mean ± standard deviation. Statistical analyses were performed using SPSS (version 13.0; SPSS, Inc., Chicago, IL, USA). The differences of each parameter between the control group and mechanical vibration group were examined using a Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

In vitro osteoblastic proliferation and morphology

Primary rabbit osteoblasts exhibited a fusiform, triangle or polygonal shape, with a round or oval nucleus, and demonstrated positive staining of mineralization nodules (data not shown). Phalliodin-FITC cytoskeleton staining images (Fig. 1B) demonstrated that osteoblasts in the mechanical vibration group displayed a well-developed cytoskeleton with higher fluorescence intensity, and increased number of microfilaments with directional arrangement, and thicker stress fibers compared with the cells in the control group. As presentedin Fig. 1C, a significant increase in osteoblastic proliferation was observed following mechanical vibration stimulation for 3 days via CCK-8 assay analysis (P=0.0003), whereas no obvious increase was observed following 1 day of mechanical vibration compared with the control group.

In vitro osteogenesis-associated gene expression

As indicated in Fig. 2, mechanical vibration significantly increased alkaline phosphatase (ALP), osteocalcin (OCN), Runx2, BMP2 and osteoprotegerin (OPG) mRNA expression compared with the control group (P=0.0017, 0.0362, 0.0001, 0.0091 and 0.0017, respectively). In addition, mechanical vibration significantly decreased sclerostin (SOST) gene expression levels compared with the control group (P=0.0001). The gene expression levels of canonical Wnt signaling pathway members, including Wnt3a, Lrp6 and β-catenin were significantly higher in the mechanical vibration group compared with the control group (P=0.0103, 0.0454 and 0.0372, respectively).

Figure 2.

Effects of in vitro mechanical vibration stimulation on osteogenesis-associated gene expression in primary rabbit osteoblasts. Reverse transcription-quantitative polymerase chain reaction analysis of ALP, OCN, Runx2, BMP2, OPG, SOST, Wnt3a, Lrp6 and β-catenin gene expression levels. Values are expressed as the mean ± standard deviation. (n=3). The relative expression level of each gene was normalized to β-actin, *P<0.05 vs. control. ALP, alkaline phosphatase; OCN, osteocalcin; Runx2, Runt-related transcription factor 2; BMP2, bone morphogenetic protein 2; OPG, osteoprotegerin; SOST, sclerostin; Lrp6, low-density lipoprotein receptor-related protein 6.

In vitro osteogenesis-associated protein expression

As demonstrated in Fig. 3, western blotting results revealed that mechanical vibration stimulation significantly stimulated the protein expression of osteogenesis-associate factors, including OCN and Runx2 (P=0.0034 and 0.0004, respectively). In addition, the protein expression levels of members of the canonical Wnt signaling pathway, including Wnt3a, Lrp6 and β-catenin, were significantly higher in the mechanical vibration group compared with the control group (P=0.0051, 0.0008 and 0.0011, respectively).

Figure 3.

Effects of in vitro mechanical vibration stimulation on osteogenesis-associated protein expression in primary rabbit osteoblasts. The expression levels of OCN, Runx2, Wnt3a, Lrp6 and β-catenin were examined via western blotting analysis. Values are expressed as the mean ± standard deviation (n=3–4). The relative expression level of each gene was normalized to GAPDH. *P<0.05 vs. control. OCN, osteocalcin; Runx2, Runt-related transcription factor 2; Lrp6, low-density lipoprotein receptor-related protein 6.

Extracellular matrix (ECM) mineralization

As presented in Fig. 4, ECM mineralization was determined via Alizarin Red staining, which revealed an increased area of mineralization in the mechanical vibration group with a higher number of stained nodules, compared with the controls. Quantification of the solubilized stain demonstrated that ECM mineralization was significantly increased following mechanical vibration stimulation compared with the control group (P=0.0001).

Figure 4.

Effects of mechanical vibration stimulation on extracellular matrix mineralization in primary rabbit osteoblasts via Alizarin Red staining. (A) Representative microscope images (magnification, ×4) of Alizarin Red-stained osteoblasts in the control and mechanical vibration groups (Scale bar, 20 µm). (B) Quantitative comparisons of absorbance values of the solubilized stain in the control and mechanical vibration groups. Values are expressed as the mean ± standard deviation, (n=10). *P<0.05 vs. control.

Discussion

WBV, as a promising, safe and non-pharmacological therapy, has been demonstrated to promote osteogenesis experimentally and clinically (14,32). However, the exact regulatory mechanisms underlying the effect of WBV exposure on osteogenesis and bone remodeling remains poorly understood. Therefore, to evaluate the mechanism of mechanical vibration as a potential treatment modality for osteoporosis, it is vital to assess its impact on osteoblasts in vitro as a scientific reference for subsequent clinically therapeutic applications. In the present study, mechanical vibration (45 Hz, 0.5 g) was applied for 1 h/day as the stimulation parameter, which is consistent with the parameter used by Judex et al (3). The results of the current study demonstrated that mechanical vibration significantly increased osteoblastic proliferation and mineralization, and induced the formation of a well-arranged cytoskeletal structure. Furthermore, these results that the expression of osteogenesis-associated molecules, including ALP, OCN, Runx2 and BMP2, was significantly increased by mechanical vibration. Notably, mechanical vibration significantly enhanced the gene and protein expression levels of canonical Wnt/β-catenin signaling pathway members, indicating that canonical Wnt signaling may be involved in the regulation of mechanical vibration-induced osteoblastogenesis. These results provide a novel insight into the application of mechanical vibration for promoting osteogenesis. In addition, these results extend the basic knowledge of the molecular mechanisms involved in osteoblastic functions in response to external mechanical signals.

As demonstrated in the current study, the activities of osteoblasts were significantly stimulated when they were subjected to mechanical vibration (45 Hz, 0.5 g) for 1 h/day for 3 days. The results of CCK-8 analysis and quantitative Alizarin Red-S staining revealed that the proliferation and mineralization of primary osteoblasts were promoted under mechanical vibration. The results are consistent with the findings of Chow et al (33). In addition, these results revealed obvious cytomorphological alterations to osteoblasts in vitro following 3 days of micromechanical vibration stimulation. Similarly, these results are consistent with several previous findings (34,35) that observed a higher number of and thicker microfilaments in the osteoblastic cytoskeleton with directional arrangement following stimulation by mechanical vibration (36). Furthermore, the cytoskeleton adjusts its structure in response to external physical or chemical stimuli and intracellular biochemical events (37). It has been demonstrated that cytoskeletal deformation is one of the earliest events that occurs following exposure of bone cells to external biophysical stimuli, and thus modulates the intracellular biochemical response and the subsequent osteogenic activities (38,39). Together, the findings of the present study confirm that mechanical vibration may regulate osteoblastic cytoskeletal microstructure and enhance osteoblastic proliferation and mineralization.

To explore the mechanism by which mechanical vibration regulates osteoblastic activities in vitro, the gene and protein expression levels of osteogenesis-associated molecules and signaling pathways were investigated. In the current study, the results indicated that the gene expression of ALP, a marker of the osteoblast phenotype, was upregulated following mechanical vibration, which is consistent with previous findings (40). It was identified that vibratory loading increased the gene and protein expression levels of OCN, a major osteoblastic differentiation and bone formation marker, which was similar to results of a previous study by Tanaka et al (40). In addition, mechanical vibration was observed to lead to upregulation of the gene and protein levels of Runx2, a key transcription factor involved in osteoblast differentiation (41). The gene expression levels of BMP2 and OPG, two molecules responsible for regulating osteoblast differentiation and inhibiting osteoclast activities (42,43), were observed to be upregulated following mechanical vibration stimulation in the present study. Additionally, a significant downregulation in SOST gene expression was identified. The SOST gene encodes the sclerostin protein, which was previously hypothesized to be a negative regulator of bone formation and exclusively expressed by osteocytes (44–46). It has been demonstrated that sclerostin functions as a BMP antagonist and is an inhibitor of the canonical Wnt signaling pathway (47).

Accumulating evidence has identified that canonical Wnt signaling serves a key role in regulating osteogenesis, and ultimately regulates bone mass and bone strength (48,49). Extracellular Wnt proteins initially bind to the Frizzled and Lrp5/6 co-receptors on the cell membrane, which results in the stabilization of β-catenin in the cytoplasm and facilitates further Wnt-targeted gene transcription in the cell nucleus. It has been demonstrated that activation of canonical Wnt signaling can promote osteoblastogenesis and enhance osteoblast activity (50–52). Knockout of genes involved in the canonical Wnt signaling pathway in mice, including Wnt, Lrp6 and β-catenin exhibited abnormal bone remodeling and decreased bone mass (52,53). In addition, it was demonstrated that canonical Wnt signaling activates ALP, Runx2 and BMP2 expression (19,20,54). The findings of the present study indicated that the gene and protein expression levels of genes involved in the Wnt signaling pathway were significantly enhanced in osteoblasts in vitro following mechanical stimulation. Thus, these results demonstrated that the activation of the canonical Wnt signaling pathway may have an essential role in mediating mechanical vibration-induced osteoblastogenesis.

In conclusion, the results of the current study indicated that mechanical vibration stimulation (0.5 gn, 45 Hz) positively regulated the biological functions of osteoblasts, as characterized by changes in cytoskeletal microstructure, enhancement of cellular proliferation and augmentation of bone matrix mineralization. In addition, these results demonstrated that mechanical vibration promoted osteogenesis-associated gene and protein expression and activated canonical Wnt signaling pathway. It was revealed that low-level mechanical vibration enhanced osteoblastogenesis through a potential canonical Wnt signaling-associated mechanism. This study increases the basic knowledge of the osteogenic activity of WBV, and may contribute to a more efficient and scientific clinical application of WBV in promoting osteogenesis and inhibiting osteoporosis.

Acknowledgements

The authors acknowledge the support from the National Natural Science Foundation of China (grant nos. 81471806 and 31270889), the Natural Science Foundation of Shaanxi Province (grant no. 2014JQ4139), and the Doctoral Thesis Foundation of the Fourth Military Medical University (grant no. 2015D13).

References

1 

Xie L, Jacobson JM, Choi ES, Busa B, Donahue LR, Miller LM, Rubin CT and Judex S: Low-level mechanical vibrations can influence bone resorption and bone formation in the growing skeleton. Bone. 39:1059–1066. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Xie P, Tang Z, Qing F, Chen X, Zhu X, Fan Y, Yang X and Zhang X: Bone mineral density, microarchitectural and mechanical alterations of osteoporotic rat bone under long-term whole-body vibration therapy. J Mech Behav Biomed Mater. 53:341–349. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Judex S, Lei X, Han D and Rubin C: Low-magnitude mechanical signals that stimulate bone formation in the ovariectomized rat are dependent on the applied frequency but not on the strain magnitude. J Biomech. 40:1333–1339. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Jing D, Cai J, Wu Y, Shen G, Li F, Xu Q, Xie K, Tang C, Liu J, Guo W, et al: Pulsed electromagnetic fields partially preserve bone mass, microarchitecture, and strength by promoting bone formation in hindlimb-suspended rats. J Bone Miner Res. 29:2250–2261. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Garnero P: New developments in biological markers of bone metabolism in osteoporosis. Bone. 66:46–55. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Rubin C, Turner AS, Bain S, Mallinckrodt C and McLeod K: Anabolism. Low mechanical signals strengthen long bones. Nature. 412:603–604. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Rubin C, Xu G and Judex S: The anabolic activity of bone tissue, suppressed by disuse, is normalized by brief exposure to extremely low-magnitude mechanical stimuli. FASEB J. 15:2225–2229. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Judex S, Donahue LR and Rubin C: Genetic predisposition to low bone mass is paralleled by an enhanced sensitivity to signals anabolic to the skeleton. FASEB J. 16:1280–1282. 2002.PubMed/NCBI

9 

Chan ME, Adler BJ, Green DE and Rubin CT: Bone structure and B-cell populations, crippled by obesity, are partially rescued by brief daily exposure to low-magnitude mechanical signals. FASEB J. 26:4855–4863. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Sehmisch S, Galal R, Kolios L, Tezval M, Dullin C, Zimmer S, Stuermer KM and Stuermer EK: Effects of low-magnitude, high-frequency mechanical stimulation in the rat osteopenia model. Osteoporos Int. 20:1999–2008. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Gilsanz V, Wren TA, Sanchez M, Dorey F, Judex S and Rubin C: Low-level, high-frequency mechanical signals enhance musculoskeletal development of young women with low BMD. J Bone Miner Res. 21:1464–1474. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Shi HF, Cheung WH, Qin L, Leung AH and Leung KS: Low-magnitude high-frequency vibration treatment augments fracture healing in ovariectomy-induced osteoporotic bone. Bone. 46:1299–1305. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Christiansen BA and Silva MJ: The effect of varying magnitudes of whole-body vibration on several skeletal sites in mice. Ann Biomed Eng. 34:1149–1156. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Rubin C, Recker R, Cullen D, Ryaby J, McCabe J and McLeod K: Prevention of postmenopausal bone loss by a low-magnitude, high-frequency mechanical stimuli: A clinical trial assessing compliance, efficacy, and safety. J Bone Miner Res. 19:343–351. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Fritton SP, McLeod KJ and Rubin CT: Quantifying the strain history of bone: Spatial uniformity and self-similarity of low-magnitude strains. J Biomech. 33:317–325. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Coughlin TR and Niebur GL: Fluid shear stress in trabecular bone marrow due to low-magnitude high-frequency vibration. J Biomech. 45:2222–2229. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Caetano-Lopes J, Canhão H and Fonseca JE: Osteoblasts and bone formation. Acta Reumatol Port. 32:103–110. 2007.PubMed/NCBI

18 

Jiang T, Zhou B, Huang L, Wu H, Huang J, Liang T, Liu H, Zheng L and Zhao J: Andrographolide exerts pro-osteogenic effect by activation of Wnt/β-catenin signaling pathway in vitro. Cell Physiol Biochem. 36:2327–2339. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, Javed A, van Wijnen AJ, Stein JL, Stein GS and Lian JB: Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem. 280:33132–33140. 2005. View Article : Google Scholar : PubMed/NCBI

20 

Zhang R, Oyajobi BO, Harris SE, Chen D, Tsao C, Deng HW and Zhao M: Wnt/β-catenin signaling activates bone morphogenetic protein 2 expression in osteoblasts. Bone. 52:145–156. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Bennett CN, Longo KA, Wright WS, Suva LJ, Lane TF, Hankenson KD and MacDougald OA: Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc Natl Acad Sci USA. 102:3324–3339. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Wang B, Jin H, Zhu M, Li J, Zhao L, Zhang Y, Tang D, Xiao G, Xing L, Boyce BF and Chen D: Chondrocyte beta-catenin signaling regulates postnatal bone remodeling through modulation of osteoclast formation in a murine model. Arthritis Rheumatol. 66:107–120. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Li C, Wang W, Xie L, Luo X, Cao X and Wan M: Lipoprotein receptor-related protein 6 is required for parathyroid hormone-induced Sost suppression. Ann NYAcad Sci. 1364:62–73. 2016. View Article : Google Scholar

24 

Wang Y, Li YP, Paulson C, Shao JZ, Zhang X, Wu M and Chen W: Wnt and the Wnt signaling pathway in bone development and disease. Front Biosci (Landmark Ed). 19:379–407. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Xu C, Wang J, Zhu T, Shen Y, Tang X, Fang L and Xu Y: Cross-talking between PPAR and WNT signaling and its regulation in mesenchymal stem cell differentiation. Curr Stem Cell Res Ther. 11:247–254. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Weivoda MM, Ruan M, Hachfeld CM, Pederson L, Howe A, Davey RA, Zajac JD, Kobayashi Y, Williams BO, Westendorf JJ, et al: Wnt signaling inhibits osteoclast differentiation by activating canonical and noncanonical cAMP/PKA pathways. J Bone Miner Res. 31:65–75. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Wong GL and Cohn DV: Target cells in bone for parathormone and calcitonin are different: Enrichment for each cell type by sequential digestion of mouse calvaria and selective adhesion to polymeric surfaces. Proc Natl Acad Sci USA. 72:3167–3171. 1975. View Article : Google Scholar : PubMed/NCBI

28 

Williams DC, Boder GB, Toomey RE, Paul DC, Hillman CC Jr, King KL, Van Frank RM and Johnston CC Jr: Mineralization and metabolic response in serially passaged adult rat bone cells. Calcif Tissue Int. 30:233–246. 1980. View Article : Google Scholar : PubMed/NCBI

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Shui C and Scutt A: Mild heat shock induces proliferation, alkaline phosphatase activity, and mineralization in human bone marrow stromal cells and Mg-63 cells in vitro. J Bone Miner Res. 16:731–741. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Ciapetti G, Ambrosio L, Savarino L, Granchi D, Cenni E, Baldini N, Pagani S, Guizzardi S, Causa F and Giunti A: Osteoblast growth and function in porous poly epsilon-caprolactone matrices for bone repair: A preliminary study. Biomaterials. 24:3815–3824. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Gori F, Hofbauer LC, Dunstan CR, Spelsberg TC, Khosla S and Riggs BL: The expression of osteoprotegerin and RANK ligand and the support of osteoclast formation by stromal-osteoblast lineage cells is developmentally regulated. Endocrinology. 141:4768–4776. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Chow SK, Leung KS, Qin J, Guo A, Sun M, Qin L and Cheung WH: Mechanical stimulation enhanced estrogen receptor expression and callus formation in diaphyseal long bone fracture healing in ovariectomy-induced osteoporotic rats. Osteoporos Int. 27:2989–3000. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Zhang C, Lu Y, Zhang L, Liu Y, Zhou Y, Chen Y and Yu H: Influence of different intensities of vibration on proliferation and differentiation of human periodontal ligament stem cells. Arch Med Sci. 11:638–646. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Uzer G, Pongkitwitoon S, Ete Chan M and Judex S: Vibration induced osteogenic commitment of mesenchymal stem cells is enhanced by cytoskeletal remodeling but not fluid shear. J Biomech. 46:2296–2302. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Sato N, Kubo K, Yamada M, Hori N, Suzuki T, Maeda H and Ogawa T: Osteoblast mechanoresponses on Ti with different surface topographies. J Dent Res. 88:812–816. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Thompson WR, Rubin CT and Rubin J: Mechanical regulation of signaling pathways in bone. Gene. 503:179–193. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Huang H, Kamm RD and Lee RT: Cell mechanics and mechanotransduction: Pathways, probes, and physiology. Am J Physiol Cell Physiol. 287:C1–C11. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Klein-Nulend J, Bacabac RG and Bakker AD: Mechanical loading and how it affects bone cells: The role of the osteocyte cytoskeleton in maintaining our skeleton. Eur Cell Mater. 24:278–291. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Tanaka SM, Li J, Duncan RL, Yokota H, Burr DB and Turner CH: Effects of broad frequency vibration on cultured osteoblasts. J Biomech. 36:73–80. 2003. View Article : Google Scholar : PubMed/NCBI

41 

Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, et al: Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell. 89:765–771. 1997. View Article : Google Scholar : PubMed/NCBI

42 

Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM and Wang EA: Novel regulators of bone formation: Molecular clones and activities. Science. 242:1528–1534. 1988. View Article : Google Scholar : PubMed/NCBI

43 

Hofbauer LC and Schoppet M: Clinical implications of the osteoprotegerin/RANKL/RANK system for bone and vascular diseases. JAMA. 292:490–495. 2004. View Article : Google Scholar : PubMed/NCBI

44 

Bonewald LF: The amazing osteocyte. J Bone Miner Res. 26:229–238. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Burgers TA and Williams BO: Regulation of Wnt/β-catenin signaling within and from osteocytes. Bone. 54:244–249. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Bellido T, Saini V and Pajevic PD: Effects of PTH on osteocyte function. Bone. 54:250–257. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Ellies DL, Viviano B, McCarthy J, Rey JP, Itasaki N, Saunders S and Krumlauf R: Bone density ligand, Sclerostin, directly interacts with LRP5 but not LRP5G171V to modulate Wnt activity. J Bone Miner Res. 21:1738–1749. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Santos A, Bakker AD, Zandieh-Doulabi B, Semeins CM and Klein-Nulend J: Pulsating fluid flow modulates gene expression of proteins involved in Wnt signaling pathways in osteocytes. J Orthop Res. 27:1280–1287. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Macsai CE, Foster BK and Xian CJ: Roles of Wnt signalling in bone growth, remodelling, skeletal disorders and fracture repair. J Cell Physiol. 215:578–587. 2008. View Article : Google Scholar : PubMed/NCBI

50 

Zhang R, Oyajobi BO, Harris SE, Chen D, Tsao C, Deng HW and Zhao M: Wnt/β-catenin signaling activates bone morphogenetic protein 2 expression in osteoblasts. Bone. 52:145–156. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, Javed A, van Wijnen AJ, Stein JL, Stein GS and Lian JB: Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem. 280:33132–3340. 2005. View Article : Google Scholar : PubMed/NCBI

52 

Bennett CN, Longo KA, Wright WS, Suva LJ, Lane TF, Hankenson KD and MacDougald OA: Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc Natl Acad Sci USA. 102:3324–3329. 2005. View Article : Google Scholar : PubMed/NCBI

53 

Wang B, Jin H, Zhu M, Li J, Zhao L, Zhang Y, Tang D, Xiao G, Xing L, Boyce BF and Chen D: Chondrocyte β-catenin signaling regulates postnatal bone remodeling through modulation of osteoclast formation in a murine model. Arthritis Rheumatol. 66:107–120. 2014. View Article : Google Scholar : PubMed/NCBI

54 

Rawadi G, Vayssière B, Dunn F, Baron R and Roman-Roman S: BMP-2 controls alkaline phosphatase expression and osteoblast mineralization by a Wnt autocrine loop. J Bone Miner Res. 18:1842–1853. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao H, Zhai M, Wang P, Zhang X, Cai J, Chen X, Shen G, Luo E and Jing D: Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism. Mol Med Rep 16: 317-324, 2017.
APA
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X. ... Jing, D. (2017). Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism. Molecular Medicine Reports, 16, 317-324. https://doi.org/10.3892/mmr.2017.6608
MLA
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X., Shen, G., Luo, E., Jing, D."Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism". Molecular Medicine Reports 16.1 (2017): 317-324.
Chicago
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X., Shen, G., Luo, E., Jing, D."Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism". Molecular Medicine Reports 16, no. 1 (2017): 317-324. https://doi.org/10.3892/mmr.2017.6608
Copy and paste a formatted citation
x
Spandidos Publications style
Gao H, Zhai M, Wang P, Zhang X, Cai J, Chen X, Shen G, Luo E and Jing D: Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism. Mol Med Rep 16: 317-324, 2017.
APA
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X. ... Jing, D. (2017). Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism. Molecular Medicine Reports, 16, 317-324. https://doi.org/10.3892/mmr.2017.6608
MLA
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X., Shen, G., Luo, E., Jing, D."Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism". Molecular Medicine Reports 16.1 (2017): 317-324.
Chicago
Gao, H., Zhai, M., Wang, P., Zhang, X., Cai, J., Chen, X., Shen, G., Luo, E., Jing, D."Low‑level mechanical vibration enhances osteoblastogenesis via a canonical Wnt signaling‑associated mechanism". Molecular Medicine Reports 16, no. 1 (2017): 317-324. https://doi.org/10.3892/mmr.2017.6608
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team