Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2018 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2018 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity

  • Authors:
    • Zhongdong Xie
    • Wenzheng Xia
    • Meng Hou
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China, Department of Neurosurgery, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China, Department of Radiation Oncology, The First Affiliated Hospital, Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China
  • Pages: 2695-2704
    |
    Published online on: November 28, 2017
       https://doi.org/10.3892/mmr.2017.8169
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Doxorubicin (Dox)-induced cardiotoxicity has been a well‑known phenomenon to clinicians and scientists for decades. It has been confirmed that Dox‑dependent cardiotoxicity is accompanied by cardiac cellular senescence. However, the molecular mechanisms underlying Dox cardiotoxicity remains to be fully elucidated. Long non‑coding (lnc) RNAs regulate gene transcription and the fate of post‑transcriptional mRNA, which affects a broad range of age‑associated physiological and pathological conditions, including cardiovascular disease and cellular senescence. However, the functional role of lncRNAs in Dox‑induced cardiac cellular senescence remains largely unknown. Using the reverse transcription‑quantitative polymerase chain reaction method, the present study indicated that long intergenic non‑coding (linc) RNA‑p21 was highly expressed in Dox‑treated HL‑1 murine cardiomyocytes. Dox‑induced cardiac senescence was accompanied by decreased cellular proliferation and viability, increased expression of p53 and p16, and decreased telomere length and telomerase activity, while these effects were relieved by silencing endogenous lincRNA‑p21. We found that lincRNA‑p21 interacted with β‑catenin and that silencing β‑catenin abolished the anti‑senescent effect of lincRNA‑p21 silencing. It was observed that modulating lincRNA‑p21 to exert an anti‑senescent effect was dependent on decreasing oxidant stress. To conclude, the present findings suggest that lincRNA‑p21 may be involved in Dox‑associated cardiac cellular senescence and that silencing lincRNA‑p21 effectively protects against Dox cardiotoxicity by regulating the Wnt/β‑catenin signaling pathway and decreasing oxidant stress. Furthermore, modulating lincRNA‑p21 may have cardioprotective potential in patients with cancer receiving Dox treatment.

Introduction

Doxorubicin (Dox) is one of the most widely used antineoplastic drugs. Its anticancer effects are believed to occur through the inhibition of topoisomerase enzyme and subsequent blockage of DNA resealing during cell replication (1). Despite its highly beneficial effects against cancer, the clinical use of Dox has been confined by its drawback of cardiotoxicity (2). Risk of Dox cardiotoxicity increases with both treatment concentration and duration, and delayed onset of cardiomyopathy can often occur years after initial treatment (3). The mechanism for Dox-induced cardiotoxicity is controversial, and several hypotheses have been proposed. One of the important mechanisms inducing cardiotoxicity is Dox induction of cardiomyocyte senescence (4,5). Dox treatment enhanced secretion of senescence-associated cytokines and augmented the DNA damage-response signaling cascade, thus inducing cardiomyocyte senescence (5,6). Therefore, there is an urgent need to find an efficient way to ameliorate Dox-induced cardiomyocyte senescence in order to prevent future cardiac complications.

Non-coding RNAs are non-protein-coding transcripts that function as regulators of RNA molecules. Long non-coding (lnc) RNAs are non-coding RNAs with at least 200 nucleotides (7) that have been reported to impact a broad spectrum of biological processes including development, differentiation, cell division, apoptosis, cellular senescence, diseases and disorders, thus regulating the complexity of the organism as a whole (8,9). LncRNA expression patterns are tissue- and stage-specific, suggesting their considerable importance in controlling different biological functions, cellular senescence in particular (10). Among lncRNAs, long intergenic non-coding (linc) RNA-p21 is closely related to cellular senescence. Recent research has shown that lincRNA-p21, which interacts with β-catenin, promoted cellular senescence (11). Also, lincRNA-p21 has been identified as a regulator of p53 expression, and reciprocally p53 can regulate the expression of lincRNA-p21, which plays a major role in pro-senescence networks (12). At the same time, lincRNA-p21 is a key regulator of age-related heart diseases such as coronary artery disease (13). However, there has been no research on the biological function of lncRNAs in Dox-related cardiotoxicity, so in this study we explored the involvement of lincRNA-p21 in cardiomyocyte senescence in the Dox-induced cardiotoxic process.

LncRNAs have been proposed to act in transvia several mechanisms ranging from repression of gene transcriptional networks to regulation of mRNA translation and protein stability (14). The Wnt/β-catenin signaling pathway is closely associated with ageing-associated impairments in cardiac regeneration and function (15). A previous study found that the canonical Wnt signaling pathway was involved in the senescence process of cardiac stem cells (CSCs) (16). As a post-transcriptional inhibitor of translation, β-catenin was initially identified as a direct transcriptional target of lincRNA-p21 (11). Moreover, lincRNA-p21 inhibited β-catenin signaling, thereby attenuating viability, self-renewal and glycolysis of colorectal cancer stem cells (17). In addition, in the Dox-induced dilated cardiomyopathy model, β-catenin signaling was apparently inhibited by Dox (18). Based on the role of lincRNA-p21-regulated β-catenin signaling and the inhibitory effect of Dox on β-catenin signaling, the present study aimed to determine if modulating lincRNA-p21 could activate β-catenin signaling and relieve Dox-related cardiotoxicity.

Senescence can be triggered by multiple mechanisms, including those resulting in the production of reactive oxygen species (ROS) and oxidative stress (19). Oxidative stress and generation of ROS are also important mediators of the cellular alterations caused by Dox exposure (20). Cardiac senescence induced by Dox correlates with increased generation of ROS and oxidative stress (21). LncRNAs have close relationships with oxidative stress, DNA damage and other types of cellular stress responses (22). With respect to lincRNA-p21, a recent report observed that UVB-induced apoptosis of keratinocytes involved increased lincRNA-p21 expression and ROS-associated DNA damage (23). Furthermore, endoplasmic reticulum stress induced by lincRNA-p21 has been suggested to account for its effects on apoptosis induction and inhibition of hepatocellular carcinoma cell proliferation (24). The current study explored whether suppressing lincRNA-p21 expression could attenuate oxidative stress to alleviate cellular senescence induced by Dox and thus exert a cardioprotective effect.

Materials and methods

Reagents

Dulbecco's modified Eagle's medium and fetal bovine serum (FBS) were purchased from HyClone (GE Healthcare Life Sciences, Logan, UT, USA), TRIzol® reagent was from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the Transcriptor First Strand cDNA Synthesis kit, FastStart Universal SYBR® Green Master (Rox) and X-tremeGENE HP DNA transfection reagent were purchased from Roche Diagnostics (Basel, Switzerland). Rabbit monoclonal antibodies against β-catenin and β-actin were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA) and horseradish peroxidase-conjugated anti-rabbit secondary antibodies were from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Small interfering RNAs (siRNAs) targeting lincRNA-p21 and β-catenin transcripts were purchased from Thermo Fisher Scientific, Inc. WST-1 Cell Proliferation and Cytotoxicity Assay kit, Mitochondrial Membrane Potential Assay kit with JC-1 and Reactive Oxygen Species Assay Kit were purchased from Beyotime Technology (Jiangsu, China). Superoxide Dismutase (SOD) Activity Colorimetric Assay and Lipid Peroxidation (Malondialdehyde; MDA) Assay kits were purchased from Abcam (Cambridge, UK). N-acetyl cysteine (NAC) was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany).

Cell culture and cell treatment

HL-1 murine cardiomyocytes were a kind gift from Dr William C. Claycomb. Cells were maintained in fibronectin-coated flasks supplemented with 10% FBS, 100 U/ml penicillin, 100 mg/ml streptomycin and 2 mM L-glutamine and maintained semi-confluent at all times. The treatment was carried out by exposing the cell culture to 5 µM Dox for short periods of time.

WST-1 proliferation assay

HL-1 cells were plated at a density of 1×105 cells/well in a 96-well plate. The cells were analyzed at 0, 24, 48 and 72 h, using the WST-1 assay. In brief, the cells were incubated with WST-1 at a concentration of 10 nM for 2 h. The reaction product was quantified by measuring absorbance using an ELISA reader at 440 and 690 nm. Data were analyzed using absorbance analysis software.

MTT assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to determine cell viability. Briefly, 300 µl of MTT reagent was added to each well 2 h prior to harvesting. The supernatant was then removed and cells were incubated with 400 µl of dimethylsulfoxide for 10 min. Absorbance at 540 nm was recorded using the ELISA plate reader. Three repeats were performed.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The expression levels of several genes were analyzed with RT-qPCR. Briefly, total cellular RNA was isolated using TRIzol® reagent and reversed transcribed using the transcriptor First Stand cDNA Synthesis Kit according to the manufacturer's instructions. RT-qPCR was carried out using the Fast Start Universal SYBR Master and fluorescence quantitative PCR system. The quantification number of cycles (Cq) was set within the exponential phase of the PCR. The ΔCq value for each target gene was calculated by subtracting the Cq value of GAPDH (internal control) from the target gene. Relative gene expression levels were calculated by comparing the ΔCq values between control and experimental conditions for each target PCR using the following equation: Relative gene expression=2−(ΔCq sample-ΔCq control). The primer pairs used to detect the mRNA levels of target genes are listed in Table I.

Table I.

Primer sequences.

Table I.

Primer sequences.

GenesSequences
LincRNA-p21F: 5′-CCTGTCCACTCGCTTTC-3′
R: 5′-GGAACTGGAGACGGAATGTC-3′
p53F: 5′-GGATGCCCATGCTACAGAGGAGTCT-3′
R: 5′-GTCTGAGTCAGGCCCCACTTTCTTG-3′
p16F: 5′-TTGGCCCAAGAGCGGGGACA-3′
R: 5′-GCGGGCTGAGGCCGGATTTA-3′
telomere lengthF: 5′-TGAAAGTAGAGGATTGCCACTG-3′
R: 5′-AGCCAGAACAGGAACGTAGC-3′
β-cateninF: 5′-TAGTGTGACAAGCTGAGTATGCGA-3′
R: 5′-CTGGAGCGTCTGATGAG-3′
GAPDHF: 5′-GGAGCCAAAAGGGTCATCAT-3′
R: 5′-GTGATGGCATGGACTGTGGT-3′
siRNA-LincRNA-p21 UGAAAAGAGCCGUGAGCUA
siRNA-β-catenin CTCACTTGCAATAATTACAAA
siRNA-NT CTCUCCGAACGUGUCACGUTT

[i] LincRNA-p21, long intergenic noncoding RNA-p21; siRNA, small interfering RNA; siRNA-NT, non-target-specific small interfering RNA.

Relative telomere length measurement

Relative telomere length quantification in HL-1 cells was performed using a qPCR approach based on a previously established method (25), with GAPDH as the normalizing gene. The primer pairs used to detect telomere length are listed in Table I.

Relative telomerase activity measurement

Telomerase activity of HL-1 cells was examined using the Telo TAGGG Telomerase PCR ELISA PLUS kit according to the manufacturer's instructions. Cell lysates were centrifuged for 20 min at 4°C and 3 µl of cell extract were used for each telomeric repeat PCR amplification reaction and 3 µl of inactivated cell lysate were used for Telomeric Repeat Amplification Protocol (TRAP) reactions according to the manufacturer's recommendations. Each TRAP reaction was performed with amplification of an internal control from the kit to validate the absence of a PCR inhibitor. Using the ELISA method, the amplified products were immobilized on streptavidin-coated microtiter plates via biotin-streptavidin interaction. Thereafter, the amplifications were detected by anti-digoxigenin antibodies conjugated to peroxidase. After addition of the peroxidase substrate (3,3′,5,5′-tetramethylbenzidine), the amount of TRAP products was determined by measurement of absorbance at 450 nm using the ELISA plate reader.

Western blot analysis

To obtain total protein, HL-1 cells were lysed with ice-cold lysis buffer (Beyotime Biotechnology). Expression of β-catenin and β-actin were evaluated by western blot. Cellular extracts were prepared according to the manufacturer's instruction. Protein samples were quantified and separated with SDS-PAGE. Western blot assay was performed as described previously (26).

Plasmid transfection

LincRNA-p21 siRNA, β-catenin siRNA and adenoviral vectors expressing lincRNA-p21 (Ad-lnc-p21) were designed and synthesized. Scrambled non-targeting siRNA (siRNA-NT) and adenoviral vectors expressing a control scrambled sequence (Ad-Ctrl) were used as negative controls. HL-1 cells were transfected using Lipofectamine® 2000 (Invitrogen) at a final concentration of 100 nM.

Evolution of ΔΨm

Cells in a 96-well microtiter plate were grown at 37°C for 1 day in complete culture medium to reach 1×105 cells per well. The cells were then washed with PBS and loaded at 37°C for 15 min with 5 µg/ml JC-1. After two wash cycles with PBS, the time-dependent JC-1 fluorescence was recorded using the ELISA plate reader. The fluorescent probe was excited at 490 nm and the emission was alternately read at 530 and 590 nm.

ROS measurement

Levels of intracellular ROS were determined using 2,7-dichlorodihydrofluorescein diacetate (Beyotine Institute of Biotechnology, Nantong, China), following the manufacturer's instructions. The fluorescence intensity of the cells was measured using a fluorescence spectrophotometer, with excitation and emission wavelengths of 488 and 525 nm, respectively.

SOD activity

SOD activity in HL-1 cells was determined using a colorimetric assay kit (Abcam) according to the manufacturer's protocol. Briefly, protein was isolated from HL-1 cells using lysis buffer, and SOD activity was measured in 10 µg of total protein extract. Absorbance was measured at 450 nm.

Lipid peroxidation assays

Lipid peroxidation was monitored using an assay kit (Abcam) to measure the formation of MDA according to the manufacturer's protocol. Briefly, HL-1 cells (1×106 cells) were homogenized on ice in 300 µl of MDA lysis buffer (with 3 µl of 100× butylated hydroxytoluene), then centrifuged (13,000 × g, 10 min) to remove insoluble material. The supernatant (200 µl) was added to 600 µl of thiobarbituric acid and incubated at 95°C for 60 min. The samples were cooled to room temperature in an ice bath for 10 min, and the absorbance at 532 nm was measured spectrophotometrically.

Statistical analysis

Data were expressed as means ± standard deviation. Differences among groups were tested with one-way analysis of variance followed by Tukey's post hoc test, and comparisons between two groups were evaluated with Student's t-tests using SPSS package v19.0 (IBM, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Dox induced cellular senescence and generation of lincRNA-p21

To determine whether lincRNA-p21 is involved in Dox-induced cardiac senescence, its expression was evaluated in HL-1 murine cardiomyocytes exposed to 5 µM Dox for 24 h. RT-qPCR analysis revealed a significant increase of linRNA-p21 in HL-1 cells following Dox treatment (Fig. 1A).

Figure 1.

Dox induced cellular senescence and generation of lincRNA-p21. (A) RT-qPCR analysis of lincRNA-p21 mRNA levels in HL-1 cells after treatment with Dox. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control. (B) Proliferation growth curves of HL-1 cells incubated with Dox at concentrations of 5 µM, determined by the WST-1 proliferation assay. (C) Dox was added to culture media and cell viability was analyzed by MTT assay. (D-F) RT-qPCR analysis of p53 and p16 mRNA levels and telomere length in HL-1 cells treated with Dox. (G) Relative telomerase activity. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control.

To further explore the role of Dox in inducing senescence in HL-1 cells, we tested HL-1 cell viability and proliferation and demonstrated that both proliferation and the percentage of viable cells were decreased following Dox treatment (Fig. 1B and C). Furthermore, expression of senescence-related genes p53 and p16 was markedly increased in the Dox treatment group (Fig. 1D, E). Finally, we demonstrated that treating cells with Dox resulted in decreasing telomere length and telomerase activity (Fig. 1F and G).

Modulating lincRNA-p21 attenuated cellular senescence induced by Dox

The role of lincRNA-p21 in cellular senescence induced by Dox was further investigated by knockdown of endogenous lincRNA-p21 by siRNA. LincRNA-p21 expression levels were significantly reduced by transfection with lincRNA-p21 siRNA compared with siRNA-NT (Fig. 2A). Knockdown of lincRNA-p21 was associated with significantly increased proliferation and cellular viability of HL-1 cells (Fig. 2B and C) compared with the HL-1 cells treated with Dox only. In addition, inhibition of lincRNA-p21 in the presence of Dox decreased the expression of senescence-related genes p53 and p16 (Fig. 2D and E), while telomere length and telomerase activity increased (Fig. 2F and G), compared to cells treated with Dox without inhibition of lincRNA-p21. In contrast, siRNA-NT treatment did not attenuate cellular senescence induced by Dox.

Figure 2.

Modulating lincRNA-p21 attenuated cellular senescence induced by Dox. (A) RT-qPCR analysis of lincRNA-p21 mRNA levels in untransfected HL-1 cells and HL-1 cells transfected with lincRNA-p21-specific siRNA or control siRNA-NT; *P<0.05 vs. siRNA-lincRNA-p21. (B-G) HL-1 cells were transfected with siRNA-lincRNA-p21 or siRNA-NT in the presence of Dox. (B) Proliferation of HL-1 cells determined by the WST-1 proliferation assay. (C) Cell viability analyzed by MTT assay. (D-F) RT-qPCR analysis of p53and p16 mRNA level and telomere length in HL-1 cells. (G) Relative telomerase activity. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox+siRNA-lincRNA-p21.

LincRNA-p21-β-catenin signaling was involved in Dox-related cellular senescence

LincRNA-p21 has previously been demonstrated to reduce β-catenin protein levels in CSCs (17). In the present study, β-catenin protein expression levels were decreased in the Dox-treated group when compared with the control group; however, after silencing lincRNA-p21, β-catenin protein expression levels increased (Fig. 3A and B). To further investigate the mechanism underlying the effect of lincRNA-p21on Dox-related cellular senescence, we used siRNA to silence β-catenin. β-catenin mRNA expression levels were significantly reduced in cells transfected with siRNA-β-catenin compared to transfection with siRNA-NT control (Fig. 3C). Knockdown of lincRNA-p21 reversed the decrease in proliferation and viability and the increase in expression of senescence-related genes p53 and p16 in HL-1 cells induced by Dox (Fig. 3D-G); it also increased telomere length and telomerase activity (Fig. 3H and I). However, these effects were abolished by silencing β-catenin.

Figure 3.

The lincRNA-p21-β-catenin signaling pathway was involved in Dox-related cellular senescence. (A) Image and (B) quantification of western blotting of β-catenin protein expression levels in untransfected HL-1 cells and HL-1 cells transfected with lincRNA-p21-specific siRNA or siRNA-NT in the presence of Dox. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox+siRNA-lincRNA-p21. (C) β-catenin mRNA levels in HL-1 cells transfected with siRNA-β-cateninor siRNA-NT; *P<0.05 vs. siRNA-β-catenin. (D-I) HL-1 cells were treated with Dox, or transfected with siRNA-lincRNA-p21, siRNA-lincRNA-p21+siRNA-β-catenin, siRNA-β-catenin or siRNA-NT in the presence of Dox. (D) Proliferation determined by the WST-1 proliferation assay. (E) Cell viability analyzed with the MTT assay. (F-H) RT-qPCR analysis of p53 and p16 mRNA levels and telomere length in HL-1 cells. (I) Relative telomerase activity. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox+siRNA-lincRNA-p21.

LincRNA-p21 participated in cellular senescence by inducing oxidative stress

To determine whether lincRNA-p21 induced cellular senescence by increasing oxidative stress in the presence of Dox, we examined mitochondrial transmembrane potential, generation of ROS, activation of SOD and lipid peroxidation by MDA assay. Dox significantly decreased mitochondrial transmembrane potential (Fig. 4A) and activation of SOD (Fig. 4C) while increasing generation of ROS (Fig. 4B) and MDA activation (Fig. 4D). However, after silencing lincRNA-p21, mitochondrial transmembrane potential and the activation of SOD were increased, but generation of ROS and MDA activation were decreased. siRNA against β-catenin was a potent blocker of the inhibitory effect of siRNA-lincRNA-p21 on oxidative stress, resulting in increased generation of ROS and MDA activation while decreasing mitochondrial transmembrane potential and activation of SOD (Fig. 4).

Figure 4.

LincRNA-p21 participated in cellular senescence by inducing oxidative stress. HL-1 cells were treated with Dox or transfected with siRNA-lincRNA-p21, siRNA-lincRNA-p21+siRNA-β-catenin, siRNA-β-catenin or siRNA-NT in the presence of Dox. (A) Mitochondrial membrane potential measured using JC-1 stain. (B) Intracellular ROS production analyzed by fluorescence spectrophotometry. (C) SOD activity evaluated by colorimetric assay. (D) Lipid peroxidation evaluated by MDA formation. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox+siRNA-lincRNA-p21.

Antioxidant treatment suppressed cellular senescence induced by Dox

To confirm that the effects of exogenous Dox on cellular senescence were specifically due to lincRNA-p21-induced oxidative stress, we investigated the effects of the antioxidant agent NAC on cellular senescence in Dox-treated HL-1 cells. NAC treatment apparently decreased the generation of ROS in Dox-treated HL-1 cells (Fig. 5A). We then overexpressed lincRNA-p21 using Ad-lnc-p21 transfection (Fig. 5B). We found that NAC reversed the decrease in proliferation and viability and the increased expression of senescence-related genes p53 and p16 in HL-1 cells induced by Dox (Fig. 5C-F), and also increased telomere length and telomerase activity (Fig. 5G and H); however, these effects were abolished by lincRNA-p21 overexpression.

Figure 5.

Antioxidant treatment suppressed cellular senescence induced by Dox. (A) Intracellular ROS production analyzed with fluorescence spectrophotometry. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox. (B) RT-qPCR analysis of lincRNA-p21 mRNA levels in untransfected HL-1 cells and HL-1 cells transfected with adenoviral vectors expressing lincRNA-p21 or a control scrambled sequence; *P<0.05 vs. Ad-lnc-p21. (C-H) HL-1 cells were treated with Dox, Dox+NAC, or were transfected with Ad-lnc-p21 or Ad-Ctrl and treated with NAC in the presence of Dox. (C) Proliferation determined by the WST-1 proliferation assay. (D) Cell viability analyzed by MTT assay. (E-G) RT-qPCR analysis of p53 and p16 mRNA levels and telomere length in HL-1 cells. (H) Relative telomerase activity was measured. Data represent means ± standard deviation from three independent experiments; *P<0.05 vs. Control, ▲P<0.05 vs. Dox, °P<0.05 vs. Dox+NAC+Ad-lnc-p21.

Discussion

Dox is among the most widely used chemotherapeutic agents and has been shown to be effective in a wide range of tumors (27). However, the clinical effectiveness of Dox is hampered by the development of cardiotoxicity that negatively affects patients' outcomes and severely limits the oncologic therapeutic opportunities (28). Numerous studies have probed the molecular mechanisms of Dox-related cardiomyopathy. As a result, a number of molecular elements have been implicated in the pathogenesis of Dox cardiotoxicity, including DNA and mitochondrial damage and accumulation of ROS (29,30). These molecular effects indicated that cardiac cellular senescence played a substantial role in Dox-induced cardiomyopathy (31). As previous studies showed that treatment with Dox extensively generated reactive oxidative stress leading to cardiac senescence, these findings confirmed that a number of senescence- and stress-associated proteins and genes were involved in Dox-induced cardiomyopathy (5,32). In our study, we found that treatment with Dox induced apparent cellular senescence, showing that increased expression of senescence related genes p53 and p16 was accompanied by impaired cellular proliferation and viability. Cellular senescence induced by Dox is defined as the arrest of cell cycle progression which can be caused by telomere shortening (5), in agreement with our results finding that treatment of HL-1cells with Dox induced shortening of telomere length and decreased telomerase activity.

Epigenetic modifications can also be mediated by lncRNAs, which play major roles in regulation of gene transcription, chromatin structure and mRNA stability during cell development and diseases (33). They are also involved in the regulation of different cellular functions such as genome maintenance, post-transcriptional modifications, structural maintenance of cellular processes and translational control (34,35). Several lncRNAs have recently been suggested to be involved in the regulation of senescence, and recent research has revealed that lncRNA HOTAIR overexpression reduced adipogenic differentiation of MSCs, inducing senescence-associated changes (36). In addition, lncRNAs also take part in the process of cardiac senescence, as related research has confirmed that the mitochondrial lncRNA ASncmtRNA-2 is induced in aging and replicative senescence in vascular cells (37). As an important regulator of the cellular senescence process, lincRNA-p21 exerts its effect in multiple ways. A previous study suggested that overexpression of lincRNA-p21 increased p21 expression at both mRNA and protein levels and impeded cell-cycle progression, and thus was involved in cellular senescence (14). LincRNA-p21 has been identified as a regulator of p53 expression, and reciprocally p53 can regulate the expression of lincRNA-p21, which plays a major role in pro-senescence networks (12). LincRNA-p21 is necessary for the recruitment of hnRNPK to the p53 response element and for increasing the binding efficiency of p53 in the p21 promoter region, promoting cellular senescence (38). In the present study, we have characterized the expression profile of lincRNA-p21 in HL-1 cells treated with Dox and found that its expression was closely related to HL-1 cellular senescence induced by Dox. Treatment with Dox induced increased expression of lincRNA-p21 accompanied by decreased cellular proliferation, viability, telomere length and telomerase activity, while increasing expression of senescence-related genes p53 and p16. Furthermore, this senescent condition was reversed by silencing lincRNA-p21, further confirming the pro-senescent effect of lincRNA-p21.

Given the impact of cellular senescence in Dox-associated cardiomyopathy processes, there is much interest in understanding how to modulate senescence for therapeutic purposes. The Wnt/β-catenin pathway is closely related to cardiac senescence, as previous research has revealed a marked decrease in β-catenin in mouse hearts 8 weeks before the mice developed cardiomyopathy at 21 weeks of age after infection with the coxsakie virus (39). Also, sustained inhibition of the Wnt/β-catenin pathway was reported to be involved in Dox-induced cardiomyopathy processes (18). In our study, as indicated by the results of western blots, expression of β-catenin was apparently decreased during Dox treatment. As a target of lincRNA-p21, β-catenin protein has been shown to be directly downregulated by lincRNA-p21 in various cell types, and vector-delivered lincRNA-p21 preferentially blocked the activation of Wnt/β-catenin signaling in CSCs (17). The viability, self-renewal and tumorigenicity of CSCs in this study were compromised by lincRNA-p21 overexpression. It has also been reported that lincRNA-p21 inhibited the Wnt/β-catenin pathway so that inhibition of lincRNA-p21 caused decreased proliferation of hepatic stellate cells (40). In agreement with these previous findings, our research confirmed that treatment with Dox inhibited Wnt/β-catenin signaling, which was reversed by silencing lincRNA-p21. In contrast, inactivating the Wnt/β-catenin pathway using siRNA blocked the anti-senescent effect of silencing lincRNA-p21, as indicated by decreased cellular proliferation and viability, reduced telomere length and telomerase activity and increased expression of p53 and p16.

Oxidative stress has been shown to be a central mediator of cellular senescence (41). Cellular senescence is accompanied by ROS generation, increased oxidant enzyme activity and diminished antioxidant enzyme activity (42). Dox-induced oxidative stress triggered cardiotoxicity leading to cardiomyopathy and heart failure (20). Several theories, including mitochondrial dysfunction, increased ROS production and contractile failure have been proposed as plausible underlying mechanisms for Dox-induced cardiomyopathy (43,44). Regulatory lncRNAs have been identified as key modulators of senescence, oxidative stress-induced apoptosis and cell cycle arrest and have great effects during the cellular senescence process (12,45). LincRNA-p21 was associated with cellular DNA damage and endoplasmic reticulum stress under oxidative stress, thus inducing growth regression of HepG2 cells and apoptosis of hepatocellular carcinoma cells (23). Herein, we found that treatment with Dox induced oxidative stress, decreased mitochondrial transmembrane potential and activation of SOD, while increasing generation of ROS and stimulating MDA activation. These oxidative effects were relieved by silencing lincRNA-p21. To further confirm the alleviation of oxidative stress by lincRNA-p21 in Dox-induced cardiac senescence, we used the antioxidant NAC to alleviate ROS generation and found that it could ameliorate cellular senescence induced by Dox. In addition, the ameliorative effects were abolished by overexpression of lincRNA-p21, confirming that oxidative stress relieved by lincRNA-p21 played a substantial role in Dox-induced cardiac senescence.

In conclusion, our study indicated that lincRNA-p21 is involved in cardiac cellular senescence. Enhancing lincRNA-p21 expression may relieve cardiac senescence induced by Dox by regulating oxidative stress via the Wnt/β-catenin signaling pathway. We demonstrated that attenuation of cardiac senescence may have important therapeutic implications for Dox-induced cardiomyopathy. Targeting lincRNA-p21 expression in cardiomyocytes may be a useful strategy in treatment of Dox-induced cardiomyopathy.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81500261 to M.H.; and grant no. 81600278 to W.Z.X) and the Medical Science and Technology Project of Zhejiang Province (grant no. 2018236627 to M.H.).

References

1 

Binaschi M, Bigioni M, Cipollone A, Rossi C, Goso C, Maggi CA, Capranico G and Animati F: Anthracyclines: Selected new developments. Curr Med Chem Anticancer Agents. 1:113–130. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Ferrans VJ, Clark JR, Zhang J, Yu ZX and Herman EH: Pathogenesis and prevention of doxorubicin cardiomyopathy. Tsitologiia. 39:928–937. 1997.PubMed/NCBI

3 

Kumar S, Marfatia R, Tannenbaum S, Yang C and Avelar E: Doxorubicin-induced cardiomyopathy 17 years after chemotherapy. Tex Heart Inst J. 39:424–427. 2012.PubMed/NCBI

4 

Bartlett JJ, Trivedi PC and Pulinilkunnil T: Autophagic dysregulation in doxorubicin cardiomyopathy. J Mol Cell Cardiol. 104:1–8. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Du WW, Yang W, Chen Y, Wu ZK, Foster FS, Yang Z, Li X and Yang BB: Foxo3 circular RNA promotes cardiac senescence by modulating multiple factors associated with stress and senescence responses. Eur Heart J. 38:1402–1412. 2017.PubMed/NCBI

6 

Ghosh AK, Rai R, Park KE, Eren M, Miyata T, Wilsbacher LD and Vaughan DE: A small molecule inhibitor of PAI-1 protects against doxorubicin-induced cellular senescence. Oncotarget. 7:72443–72457. 2016.PubMed/NCBI

7 

Atianand MK, Cafferey DR and Fitzgerald KA: Immunobiology of long noncoding RNAs. Annu Rev Immunol. 35:177–198. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Kour S and Rath PC: Age-related expression of a repeat-rich intergenic long noncoding RNA in the rat brain. Mol Neurobiol. 54:639–660. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, Tramontano A and Bozzoni I: A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147:358–369. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Liu S, Wang Z, Chen D, Zhang B, Tian RR, Wu J, Zhang Y, Xu K, Yang LM, Cheng C, et al: Annotation and cluster analysis of spatiotemporal- and sex-related lncRNA expression in rhesus macaque brain. Genome Res. 27:1608–1620. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Yoon JH, Abdelmohsen K, Srikantan S, Yang X, Martindale JL, De S, Huarte M, Zhan M, Becker KG and Gorospe M: LincRNA-p21 suppresses target mRNA translation. Mol Cell. 47:648–655. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Abdelmohsen K and Gorospe M: Noncoding RNA control of cellular senescence. Wiley Interdiscip Rev RNA. 6:615–629. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Wu G, Cai J, Han Y, Chen J, Huang ZP, Chen C, Cai Y, Huang H, Yang Y, Liu Y, et al: LincRNA-p21 regulates neointima formation, vascular smooth muscle cell proliferation, apoptosis, and atherosclerosis by enhancing p53 activity. Circulation. 130:1452–1465. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Dimitrova N, Zamudio JR, Jong RM, Soukup D, Resnick R, Sarma K, Ward AJ, Raj A, Lee JT, Sharp PA and Jacks T: LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint. Mol Cell. 54:777–790. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Schwörer S, Becker F, Feller C, Baig AH, Köber U, Henze H, Kraus JM, Xin B, Lechel A, Lipka DB, et al: Epigenetic stress responses induce muscle stem-cell ageing by Hoxa9 developmental signals. Nature. 540:428–432. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Nakamura T, Hosoyama T, Murakami J, Samura M, Ueno K, Kurazumi H, Suzuki R, Mikamo A and Hamano K: Age-related increase in Wnt inhibitor causes a senescence-like phenotype in human cardiac stem cells. Biochem Biophys Res Commun. 487:653–659. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Wang J, Lei ZJ, Guo Y, Wang T, Qin ZY, Xiao HL, Fan LL, Chen DF, Bian XW, Liu J and Wang B: miRNA-regulated delivery of lincRNA-p21 suppresses β-catenin signaling and tumorigenicity of colorectal cancer stem cells. Oncotarget. 6:37852–37870. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Chen KH, Chen CH, Wallace CG, Chen YT, Yang CC, Sung PH, Chiang HJ, Chen YL, Chua S, Yip HK and Cheng JT: Combined therapy with melatonin and exendin-4 effectively attenuated the deterioration of renal function in rat cardiorenal syndrome. Am J Transl Res. 9:214–229. 2017.PubMed/NCBI

19 

Rodier F and Campisi J: Four faces of cellular senescence. J Cell Biol. 192:547–556. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Du Q, Zhu B, Zhai Q and Yu B: Sirt3 attenuates doxorubicin-induced cardiac hypertrophy and mitochondrial dysfunction via suppression of Bnip3. Am J Transl Res. 9:3360–3373. 2017.PubMed/NCBI

21 

Przybylska D, Janiszewska D, Goździk A, Bielak-Zmijewska A, Sunderland P, Sikora E and Mosieniak G: NOX4 downregulation leads to senescence of human vascular smooth muscle cells. Oncotarget. 7:66429–66443. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Zeng Q, Wang Q, Chen X, Xia K, Tang J, Zhou X, Cheng Y, Chen Y, Huang L, Xiang H, et al: Analysis of lncRNAs expression in UVB-induced stress responses of melanocytes. J Dermatol Sci. 81:53–60. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Hall JR, Messenger ZJ, Tam HW, Phillips SL, Recio L and Smart RC: Long noncoding RNA lincRNA-p21 is the major mediator of UVB-induced and p53-dependent apoptosis in keratinocytes. Cell Death Dis. 6:e17002015. View Article : Google Scholar : PubMed/NCBI

24 

Yang N, Fu Y, Zhang H, Hui S, Zhu N and Yang G: LincRNA-p21 activates endoplasmic reticulum stress and inhibits hepatocellular carcinoma. Oncotarget. 6:281512015. View Article : Google Scholar : PubMed/NCBI

25 

Crepin T, Carron C, Roubiou C, Gaugler B, Gaiffe E, Simula-Faivre D, Ferrand C, Tiberghien P, Chalopin JM, Moulin B, et al: ATG-induced accelerated immune senescence: Clinical implications in renal transplant recipients. Am J Transplant. 15:1028–1038. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Xia W, Zhang F, Xie C, Jiang M and Hou M: Macrophage migration inhibitory factor confers resistance to senescence through CD74-dependent AMPK-FOXO3a signaling in mesenchymal stem cells. Stem Cell Res Ther. 6:822015. View Article : Google Scholar : PubMed/NCBI

27 

Yang F, Teves SS, Kemp CJ and Henikoff S: Doxorubicin, DNA torsion, and chromatin dynamics. Biochim Biophys Acta. 1845:84–89. 2014.PubMed/NCBI

28 

Cardinale D, Colombo A, Bacchiani G, Tedeschi I, Meroni CA, Veglia F, Civelli M, Lamantia G, Colombo N, Curigliano G, et al: Early detection of anthracycline cardiotoxicity and improvement with heart failure therapy. Circulation. 131:1981–1988. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Singal PK and Iliskovic N: Doxorubicin-induced cardiomyopathy. N Engl J Med. 339:900–905. 1998. View Article : Google Scholar : PubMed/NCBI

30 

Zhang S, Liu X, Bawa-Khalfe T, Lu LS, Lyu YL, Liu LF and Yeh ET: Identification of the molecular basis of doxorubicin-induced cardiotoxicity. Nat Med. 18:1639–1642. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Suliman HB, Carraway MS, Ali AS, Reynolds CM, Welty-Wolf KE and Piantadosi CA: The CO/HO system reverses inhibition of mitochondrial biogenesis and prevents murine doxorubicin cardiomyopathy. J Clin Invest. 117:3730–3741. 2007.PubMed/NCBI

32 

Minotti G, Ronchi R, Salvatorelli E, Menna P and Cairo G: Doxorubicin irreversibly inactivates iron regulatory proteins 1 and 2 in cardiomyocytes: Evidence for distinct metabolic pathways and implications for iron-mediated cardiotoxicity of antitumor therapy. Cancer Res. 61:8422–8428. 2001.PubMed/NCBI

33 

Gutschner T and Diederichs S: The hallmarks of cancer: A long non-coding RNA point of view. RNA Biol. 9:703–719. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Quinodoz S and Guttman M: Long noncoding RNAs: An emerging link between gene regulation and nuclear organization. Trends Cell Biol. 24:651–663. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Andersson R, Refsing Andersen P, Valen E, Core LJ, Bornholdt J, Boyd M, Heick Jensen T and Sandelin A: Nuclear stability and transcriptional directionality separate functionally distinct RNA species. Nat Commun. 5:53362014. View Article : Google Scholar : PubMed/NCBI

36 

Kalwa M, Hänzelmann S, Otto S, Kuo CC, Franzen J, Joussen S, Fernandez-Rebollo E, Rath B, Koch C, Hofmann A, et al: The lncRNA HOTAIR impacts on mesenchymal stem cells via triple helix formation. Nucleic Acids Res. 44:10631–10643. 2016. View Article : Google Scholar : PubMed/NCBI

37 

Bianchessi V, Badi I, Bertolotti M, Nigro P, D'Alessandra Y, Capogrossi MC, Zanobini M, Pompilio G, Raucci A and Lauri A: The mitochondrial lncRNA ASncmtRNA-2 is induced in aging and replicative senescence in endothelial cells. J Mol Cell Cardiol. 81:62–70. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Kim C, Kang D, Lee EK and Lee JS: Long Noncoding RNAs and RNA-binding proteins in oxidative stress, cellular senescence and age-related diseases. Oxid Med Cell Longev. 2017:20623842017. View Article : Google Scholar : PubMed/NCBI

39 

Lim BK, Xiong D, Dorner A, Youn TJ, Yung A, Liu TI, Gu Y, Dalton ND, Wright AT, Evans SM, et al: Coxsackievirus and adenovirus receptor (CAR) mediates atrioventricular-node function and connexin 45 localization in the murine heart. J Clin Invest. 118:2758–2770. 2008. View Article : Google Scholar : PubMed/NCBI

40 

Yu F, Guo Y, Chen B, Shi L, Dong P, Zhou M and Zheng J: LincRNA-p21 Inhibits the Wnt/β-catenin pathway in activated hepatic stellate cells via sponging MicroRNA-17-5p. Cell Physiol Biochem. 41:1970–1980. 2017. View Article : Google Scholar : PubMed/NCBI

41 

Kim YY, Jee HJ, Um JH, Kim YM, Bae SS and Yun J: Cooperation between p21 and Akt is required for p53-dependent cellular senescence. Aging Cell. 16:1094–1103. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Finkel T and Holbrook NJ: Oxidants, oxidative stress and the biology of ageing. Nature. 408:239–247. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Rigaud VO, Ferreira LR, Ayub-Ferreira SM, Ávila MS, Brandão SM, Cruz FD, Santos MH, Cruz CB, Alves MS, Issa VS, et al: Circulating miR-1 as a potential biomarker of doxorubicin-induced cardiotoxicity in breast cancer patients. Oncotarget. 8:6994–7002. 2017.PubMed/NCBI

44 

Ichikawa Y, Ghanefar M, Bayeva M, Wu R, Khechaduri A, Naga Prasad SV, Mutharasan RK, Naik TJ and Ardehali H: Cardiotoxicity of doxorubicin is mediated through mitochondrial iron accumulation. J Clin Invest. 124:617–630. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Zhang D, Lee H, Haspel JA and Jin Y: Long noncoding RNA FOXD3-AS1 regulates oxidative stress-induced apoptosis via sponging microRNA-150. FASEB J. 31:4472–4481. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xie Z, Xia W and Hou M: Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity. Mol Med Rep 17: 2695-2704, 2018.
APA
Xie, Z., Xia, W., & Hou, M. (2018). Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity. Molecular Medicine Reports, 17, 2695-2704. https://doi.org/10.3892/mmr.2017.8169
MLA
Xie, Z., Xia, W., Hou, M."Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity". Molecular Medicine Reports 17.2 (2018): 2695-2704.
Chicago
Xie, Z., Xia, W., Hou, M."Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity". Molecular Medicine Reports 17, no. 2 (2018): 2695-2704. https://doi.org/10.3892/mmr.2017.8169
Copy and paste a formatted citation
x
Spandidos Publications style
Xie Z, Xia W and Hou M: Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity. Mol Med Rep 17: 2695-2704, 2018.
APA
Xie, Z., Xia, W., & Hou, M. (2018). Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity. Molecular Medicine Reports, 17, 2695-2704. https://doi.org/10.3892/mmr.2017.8169
MLA
Xie, Z., Xia, W., Hou, M."Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity". Molecular Medicine Reports 17.2 (2018): 2695-2704.
Chicago
Xie, Z., Xia, W., Hou, M."Long intergenic non‑coding RNA‑p21 mediates cardiac senescence via the Wnt/β‑catenin signaling pathway in doxorubicin-induced cardiotoxicity". Molecular Medicine Reports 17, no. 2 (2018): 2695-2704. https://doi.org/10.3892/mmr.2017.8169
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team