Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
August-2019 Volume 20 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2019 Volume 20 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets

  • Authors:
    • Liying Liu
    • Siqi Wang
    • Chunyuan Cen
    • Shuyi Peng
    • Yan Chen
    • Xin Li
    • Nan Diao
    • Qian Li
    • Ling Ma
    • Ping Han
  • View Affiliations / Copyright

    Affiliations: Department of Radiology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430022, P.R. China, Advanced Application Team, GE Healthcare, Shanghai 201203, P.R. China
  • Pages: 1901-1914
    |
    Published online on: June 24, 2019
       https://doi.org/10.3892/mmr.2019.10414
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignant tumor with rapid progression and poor prognosis. In the present study, 11 high‑quality microarray datasets, comprising 334 tumor samples and 151 non‑tumor samples from the Gene Expression Omnibus, were screened, and integrative meta‑analysis of expression data was used to identify gene signatures that differentiate between PDAC and normal pancreatic tissues. Following the identification of differentially expressed genes (DEGs), two‑way hierarchical clustering analysis was performed for all DEGs using the gplots package in R software. Hub genes were then determined through protein‑protein interaction network analysis using NetworkAnalyst. In addition, functional annotation and pathway enrichment analyses of all DEGs were conducted in the Database for Annotation, Visualization, and Integrated Discovery. The expression levels and Kaplan‑Meier analysis of the top 10 upregulated and downregulated genes were verified in The Cancer Genome Atlas. A total of 1,587 DEGs, including 1,004 upregulated and 583 downregulated genes, were obtained by comparing PDAC with normal tissues. Of these, hematological and neurological expressed 1, integrin subunit α2 (ITGA2) and S100 calcium‑binding protein A6 (S100A6) were the top upregulated genes, and kinesin family member 1A, Dymeclin and β‑secretase 1 were the top downregulated genes. Reverse transcription‑quantitative PCR was performed to examine the expression levels of S100A6, KRT19 and GNG7, and the results suggested that S100A6 was significantly upregulated in PDAC compared with normal pancreatic tissues. ITGA2 overexpression was significantly associated with shorter overall survival times, whereas family with sequence similarity 46 member C overexpression was strongly associated with longer overall survival times. In addition, network‑based meta‑analysis confirmed growth factor receptor‑bound protein 2 and histone deacetylase 5 as pivotal hub genes in PDAC compared with normal tissue. In conclusion, the results of the present meta‑analysis identified PDAC‑related gene signatures, providing new perspectives and potential targets for PDAC diagnosis and treatment.

Introduction

Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive malignant tumors worldwide; it has a poor prognosis and a 5-year survival rate of ~8% in the USA (1). The median survival time for patients with advanced PDAC is <7 months, even with active treatment (2). Statistics from the National Cancer Institute Surveillance, Epidemiology and End Results database (https://seer.cancer.gov) indicate that PDAC is the fourth leading cause of cancer-related mortality, accounting for ~7% of all cancer deaths in the United States. The mortality rate of men with pancreatic cancer increased slightly from 2005 to 2014, at a rate of 0.3% per year (1). Based on this trend, Hezel et al predicted that pancreatic cancer would become the second most common cause of cancer-related death by 2030 (3). Resection of pancreatic tumor tissue during the early stage is currently the only curative treatment method. However, as symptoms and biomarkers for early diagnosis are lacking, >80% of patients with PDAC are not diagnosed until they are in the advanced stage, thereby missing the best timeframe for curative treatment (4). Additionally, the lack of effective and credible interventions is another key cause of the high mortality rate in patients with PDAC (3). Thus, new targets for PDAC diagnosis and better therapeutics for PDAC treatment are urgently needed.

Pancreatic cancer has many risk factors, including individual, lifestyle-related, disease and drug-related factors, with PDAC being primarily caused by somatically acquired mutations (5). Jones et al investigated gene mutations involved in pancreatic cancer and found an average of 63 mutated genes (6). A number of previous studies have examined gene mutations in pancreatic cancer. For example, Nagata et al reported and validated that mucins, such as mucin (MUC) 1, MUC5 and MUC6, were overexpressed in invasive ductal carcinoma (IDC) and in pancreatic intraepithelial neoplasia, which develops into IDC (7). Kirsten rat sarcoma viral oncogene homolog (KRAS) has been confirmed as the driver gene in PDAC (6–8). By establishing a genetically engineered mouse PDAC model, Rozenblum et al demonstrated that SMAD4 is inactivated in most pancreatic cancers, which leads to inactivation of the tumor suppressor gene cyclin-dependent kinase inhibitor 2A and activation of KRAS (9,10). p53, another tumor suppressor gene, has been found to be mutated in >50% of patients with PDAC (3,9). Fong and Winter systematically summarized the presence of various biomarkers in cancer cells and body fluids in patients with PDAC based on previous studies; these biomarkers included the genes KRAS, Fanconi anemia complementation group I (FANCI) and MUC1, and the proteins CA-19-9, CA-125 and CEA, as well as microRNA (miR)-21 and miR-210 (11). Unexpectedly, although >2,000 studies have been conducted on biomarkers for pancreatic cancer, the CA-19-9 serum level is the only widely used Food and Drug Administration-approved tumor marker, albeit not for diagnosis. To date, no biomarkers are sufficiently accurate for widespread diagnostic use (12).

Since the emergence of high-throughput genomic technologies, including microarrays several decades ago, these techniques have been applied to study many diseases. For example, these technologies are used to identify disease subtypes (13), explore gene expression profiles of disease (14) and to identify potential novel pathogenic genes and diseases (15). Additionally, molecular signatures discovered by microarrays have become predictive biomarkers for certain diseases (16). An increasing number of studies have applied this technique to identify differentially expressed genes (DEGs) between tumor tissues and normal tissues (17). Although microarray technology has enabled the discovery of biomarkers, study results vary owing to inaccuracies or quality problems in microarray analyses and verification, and small sample sizes exacerbate this issue (18). A meta-analysis, as a large-sample study, has an advantage in addressing this limitation due to its enhanced statistical power (19). Prior meta-analyses have been applied to study tumors to confirm DEGs between tumor tissue and normal tissue in glioma (20,21), lung cancer (22), bladder cancer (23), breast cancer (24), osteosarcoma (25), liver cancer (26) and pancreatic cancer (27). In the present study, integrative meta-analysis of expression data (INMEX) was used to conduct a meta-analysis based on 11 qualified microarray datasets, with the aim to identify crucial DEGs between PDAC samples and normal pancreatic samples that may serve as biomarkers for PDAC treatment and prognosis.

Materials and methods

Patients and tissue collection

The mean age of patients was 56.3 years (range, 39–73). Paired normal pancreatic tissues and PDAC tissues were collected from 15 patients (female to male ratio, 4:11) with PDAC who underwent surgical procedures at the Union Hospital of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China) between July 2018 and September 2018. Human study protocols were approved by the ethics committee of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China), and all patients in the study provided written informed consent. The pathological diagnoses of the specimens were confirmed by two clinicopathological experts at the Department of Pathology, Union Hospital of Tongji Medical College, Huazhong University of Science and Technology prior to RNA extraction. Specimens were snap frozen in liquid nitrogen and stored at −80°C. According to the American Joint Commission on Cancer Staging System for patients with pancreatic adenocarcinoma (28), patients were divided into three groups: i) Stage I (n=7); ii) stage II (n=7); and stage III (n=1).

Identification of PDAC microarray datasets and validation in The Cancer Genome Atlas (TCGA)

The keywords ‘pancreatic cancer’ were used to search for gene chips to study in the Gene Expression Omnibus (GEO) datasets of the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/geo). The inclusion criteria for the qualified chips were as follows: i) The chip was a gene expression chip; ii) the genes were from normal pancreatic and/or PDAC tissues; iii) the GEO series (GSE) dataset included >3 samples. Gene chips that met any of the following criteria were excluded: i) Chips containing pancreatic cancer cell lines; ii) methylated gene chips; iii) genes originating from animals other than humans; iv) non-microarray gene chips. Following the determination of the microarray datasets, the GSE number, information regarding the expression platform and sample number, source literature and the number of normal and pancreatic cancer samples were collected from the GEO database. To validate the results in TCGA (https://tcga-data.nci.Nih.gov/tcga/), DNA expression levels in pancreatic cancer and normal tissues and patients' survival time were obtained from the database.

Elimination of batch differences and individual data analysis

INMEX (http://www.inmex.ca) is an online tool that supports multiple microarray platforms and commonly used gene IDs; it has comprehensive processing capabilities for meta-analysis of multiple gene expression sets (29). The ComBat option using the empirical Bayes method in INMEX was applied to eliminate the differences between dataset batches on different platforms and on the same platform and to ensure that different microarray experiments were directly comparable to each other to avoid inaccuracies resulting from differences unrelated to the disease. Extremely high or low expression ratios for additional genes were robustly stabilized by contracting differences by the empirical Bayes method (30).

Meta-analysis of microarray datasets

All selected microarray datasets were log2 transformed and each constructed relative expression value table was set to match INMEX's upload format: The rows contained gene information and the columns contained sample information; each table was then uploaded. The data were annotated, function IDs were matched, and outlier samples were determined from boxplots and principal component analysis plots to ensure normalized quantile data. The correctness and integrity of all datasets were checked prior to running the ComBat adjust batch effect function, and the meta-analysis was performed. Considering the characteristics of each statistical method, the Cochran Q test was performed on the uploaded INMEX data, which revealed notable heterogeneity among different studies. Therefore, a random-effects model combined with the moderated effect size (ES) and metaMA packages were selected for the DEG screening (31,32). The gplots package in R software (version 3.5.0; http://www.r-project.org) was used to perform hierarchical cluster analysis of the DEGs.

Functional enrichment analysis of the DEGs

To determine the potential functions of the screened DEGs, Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed in the Database for Annotation, Visualization, and Integrated Discovery (DAVID; http://david.ncifcrf.gov) and the top 10 most enriched terms with P<0.05 were identified.

Network-based meta-analysis

To better understand DEG expression, protein-protein interaction (PPI) networks were constructed using NetworkAnalyst with an extensive and high-quality PPI database based in InnateDB (33). The Hub Explorer tool was used to retrieve information on node levels, betweenness centrality and expression levels. The types of data obtained were the degree of the node (number of connections to other nodes) and betweenness centrality (number of shortest paths through the node). The expression was defined as the log fold change value of the corresponding node. Nodes with the highest degree or betweenness values were considered crucial hub nodes.

Verification of gene expression and Kaplan-Meier analysis

To verify the expression of the top ten upregulated and downregulated genes in PDAC tissues compared with normal tissues, scatter plots of TCGA data were produced using GraphPad Prism 6 (GraphPad Software, Inc.). To explore the effects of DEGs on survival time, Kaplan-Meier curves were constructed using GraphPad Prism 6 based on DNA expression profiles in the PDAC tissue samples and the corresponding survival times extracted from TCGA. The median expression level of each DEG was set as the cutoff value to split TCGA cohorts into high- and low-expression groups. The log-rank tests were used to assess the differences between groups of patients exhibiting low or high expression of the selected DEGs. P<0.05 was considered to indicate a statistically significant difference.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

To confirm S100A6, KRT19 and GNG7 expression, PDAC tissues and paired normal pancreatic tissues from 15 patients with pathologically confirmed PDAC were collected. Total RNA was extracted from tissues using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. First-strand cDNA was synthesized using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. RT-qPCR was performed using the FastStart Universal SYBR Green master mix (Roche Diagnostics). The thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/elongation at 60°C for 60 sec. The 2−∆∆Cq quantification method was used for analyzing the qPCR data (34). The primers used are listed in Table I. The gene expression levels in each sample were normalized to GAPDH.

Table I.

Primer sequences.

Table I.

Primer sequences.

Gene namePrimer sequence (5′-3′)
GAPDHF: ACTTTGGTATCGTGGAAGGACTCAT
R: GTTTTTCTAGACGGCAGGTCAGG
S100A6F: CCATCTTCCACAAGTACTCCGG
R: GCAGCTTCGAGCCAATGGT
GNG7F: CGCATAGAAGCCGGGATTGA
R: TTGTCCTTAAAGGGGTTCTCCG
KRT19F: AGAATTGAACCGGGAGGTCG
R: CCTGATTCTGCCGCTCACTA

[i] S100A6, S100 calcium-binding protein; GNG7, G protein subunit 7; KRT19, keratin-19.

Statistical analysis

The ES combined random-effects model was used to perform the meta-analysis, and the threshold to screen for DEGs was set at P<0.05. The Benjamini-Hochberg false discovery rate was used to correct the P-value to obtain more precise outcomes. The Mann-Whitney U test was used to conduct validation of gene expression in TCGA. S100A6, KRT19 and GNG7 expression results for the paired PDAC and normal samples were compared using paired Student's t-test or Wilcoxon test. P<0.05 was considered to indicate a statistically significant difference.

Results

Meta-analysis

Raw data from the following 11 microarray gene expression profile datasets were downloaded from the GEO database: GSE15471 (35), GSE16515 (36), GSE22780, GSE28735 (37,38), GSE32676 (39), GSE43288-GPL96 (40), GSE43288-GPL97 (40), GSE43795 (41), GSE46234, GSE55643 (42) and GSE62165 (43). In total, 485 samples were analyzed (334 tumor samples and 151 non-tumor samples); the two sample types were subjected to meta-analysis to identify DEGs. Specific information for each dataset included the first author, country, publication date, platform and numbers of PDAC and normal pancreatic tissue samples. The complete information and reference numbers of each dataset are presented in Table II. The detailed screening and processing workflow is depicted in Fig. 1.

Figure 1.

Study workflow. (A) Identification of eligible gene expression datasets for meta-analysis of PDAC. (B) Processing meta-analysis. DEGs, differentially expressed genes; GEO, Gene Expression Omnibus; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; PDAC, pancreatic ductal adenocarcinoma; PPI, protein-protein interaction; TCGA, The Cancer Genome Atlas.

Table II.

Characteristics of datasets used in the meta-analysis of pancreatic ductal adenocarcinoma vs. Normal tissue.

Table II.

Characteristics of datasets used in the meta-analysis of pancreatic ductal adenocarcinoma vs. Normal tissue.

Numbers

Author, yearSource accessionCountryPlatformPDACNormal(Refs.)
Badea et al, 2009GSE15471RomaniaGPL5703939(35)
Pei et al, 2009GSE16515USAGPL5703616(36)
Killary, 2011GSE22780USAGPL57088N/A
Hussain et al, 2012GSE28735USAGPL62444545(37,38)
Donahue et al, 2011GSE32676USAGPL570257(39)
Crnogorac-Jurcevic et al, 2013GSE43288UKGPL9686(40)
Crnogorac-Jurcevic et al, 2013GSE43288UKGPL9786(40)
Kim et al, 2013GSE43795South KoreaGPL1055865(41)
Raeder, 2017GSE46234NorwayGPL57044N/A
Jamieson et al, 2014GSE55643UKGPL6480458(42)
Janky et al, 2016GSE62165BelgiumGPL1366711813(43)
Eliminating differences between batches

As differences between platforms lead to inaccuracies, biases in these datasets must be eliminated to increase the precision and reliability of the results. Therefore, prior to the meta-analysis, ComBat in INMEX was used to correct for differences between batches online. A principal component analysis plot demonstrated modest separation among the 11 datasets (data not shown).

Meta-analysis of gene expression in PDAC

DEGs with low but continuous expression levels in all profile datasets were defined as gained genes, and DEGs that disappeared in the meta-analysis but were expressed in individual analyses or in the meta-analysis resulting from experimental errors in the platforms were defined as lost genes (20,44,45). In total, one gained gene, unkempt family zinc finger-like (UNKL), which was weakly expressed in all datasets (ES, −0.25395), and 1,278 lost genes were identified. Through the meta-analysis, 1,587 DEGs were identified, of which 1,004 were upregulated and 583 were downregulated (data not shown). Unsupervised hierarchical clustering of the DEGs was performed, and the results demonstrated that PDAC and normal samples were partitioned into two major groups (Fig. 2). Among all DEGs, the top 10 upregulated genes were hematological and neurological expressed 1 (HN1), integrin subunit α2 (ITGA2), S100 calcium-binding protein A6 (S100A6), inhibin βA subunit (INHBA), keratin-19 (KRT19), membrane-bound O-acyltransferase domain-containing 2 (MBOAT2), collagen type I α2 chain (COL1A2), collagen type III α1 chain (COL3A1), monoglyceride lipase (MGLL) and β-actin (ACTB) (Table III). The top 10 downregulated genes were kinesin family member 1A (KIF1A), Dymeclin (DYM), β-secretase 1 (BACE1), nucleobindin-2 (NUCB2), phosphoserine aminotransferase 1 (PSAT1), LIF receptor α (LIFR), BR serine/threonine kinase 2 (BRSK2), potassium two pore domain channel subfamily K member 3 (KCNK3), family with sequence similarity 46 member C (FAM46C) and G protein subunit γ7 (GNG7) (Table III).

Figure 2.

Two-way hierarchical clustering. Two-way hierarchical clustering based on 1,587 DEGs in PDAC vs. normal tissues across 11 datasets. PDAC samples, indicated in red label, and normal tissue, indicated in blue, were categorized into the two major clusters. PDAC, pancreatic ductal adenocarcinoma

Table III.

Top 20 differentially expressed genes identified in the meta-analysis of PDAC vs. normal tissues.

Table III.

Top 20 differentially expressed genes identified in the meta-analysis of PDAC vs. normal tissues.

A, Top 10 upregulated genes in PDAC vs. Normal tissue

Entrez IDGeneGene nameCombined ESAdjusted P-value
51155HN1Hematological and neurological expressed 12.4036 7.5536×10−10
3673ITGA2Integrin subunit alpha 22.3434 5.0162×10−7
6277S100A6S100 calcium binding protein A62.1598 1.1665×10−6
3624INHBAInhibin beta A subunit2.1409 2.4647×10−5
3880KRT19Keratin 192.0556 5.215×10−5
129642MBOAT2Membrane bound O-acyltransferase domain containing 22.046<0.001
1278COL1A2Collagen type I alpha 2 chain2.0415 4.4806×10−5
1281COL3A1Collagen type III alpha 1 chain1.993 1.0244×10−4
11343MGLLMonoglyceride lipase1.8727 1.1349×10−12
60ACTBβ actin1.8532 1.0806×10−4

B, Top 10 downregulated genes in PDAC vs. Normal tissue

Entrez IDGeneGene nameCombined ESAdjusted P-value

547KIF1AKinesin family member 1A−1.9848 7.0263×10−7
54808DYMDymeclin−1.8453 3.6218×10−7
23621BACE1β-secretase 1−1.8387 1.302×10−4
4925NUCB2Nucleobindin 2−1.8176 5.8813×10−7
29968PSAT1Phosphoserine aminotransferase 1−1.809 6.8582×10−7
3977LIFRLIF receptor alpha−1.7681 1.2712×10−10
9024BRSK2BR serine/threonine kinase 2−1.7642 6.1567×10−4
3777KCNK3Potassium two pore domain channel subfamily K member 3−1.7365 1.1409×10−6
54855FAM46CFamily with sequence similarity 46 member C−1.7315 4.01×10−11
2788GNG7G protein subunit gamma 7−1.6543 1.6178×10−6

[i] Differentially expressed genes were ranked according to the combined ES. ES, effect size; PDAC, pancreatic ductal adenocarcinoma.

Identification of hub genes using network-based meta-analysis

Hub genes serve key roles in interrelationships among DEGs. To identify hub genes among the PDAC DEGs, a PPI network analysis was conducted using NetworkAnalyst, which included comprehensive data curated from the literature by InnateDB. One large subnetwork comprising 8,527 nodes and 37,579 edges, and a smaller subnetwork containing 3 nodes and 2 edges were obtained, and the top 10 hub genes in PDAC vs. normal tissue were identified (Table IV). To display the results more clearly, a zero-edge network analysis was performed, which comprised 965 nodes and 2,806 edges (Fig. 3). Finally, hub genes in the network were ranked by degree. Growth factor receptor-bound protein 2 (GRB2), with a combined ES of 0.76104 and an adjusted P-value of 0.0053254, had the highest degree (90) and betweenness (53,725) among upregulated DEGs. Histone deacetylase 5 (HDAC5), with a combined ES of −0.37624 and an adjusted P-value of 0.0018425, had the highest degree (45) and betweenness (17,157) among downregulated DEGs.

Figure 3.

Identification of hub genes using network-based meta-analysis. ‘Zero order’ interaction network for DEGs by meta-analysis of PDAC in comparison with normal tissue in a forced atlas layout. CAND1, cullin-associated and neddylation-dissociated 1; CBL, Cbl proto-oncogene; CREBBP, CREB binding protein; CTNNB1, catenin β1; CUL1, cullin 1; GRB2, growth factor receptor-bound protein 2; HDAC5, histone deacetylase 5; SMURF1, SMAD-specific E3 ubiquitin protein ligase 1; SP1, Sp1 transcription factor; UBE2I, ubiquitin-conjugating enzyme E2 I.

Table IV.

The top 10 hub genes in PDAC vs. Normal tissue.

Table IV.

The top 10 hub genes in PDAC vs. Normal tissue.

A, Upregulated genes

IDGeneDegreeBetweenness
2885GRB29053,725
Q86VP6CAND18340,684
Q13616CUL18243,269
P08047SP17447,977
P35222CTNNB15627,401
P63279UBE2I4524,406
Q9UQL6HDAC54517,157
Q9HCE7SMURF14116,525
P22681CBL4011,550
Q92793CREBBP3914,026

B, Downregulated genes

IDGeneDegree Betweenness

Q9UQL6HDAC54517,157
Q92793CREBBP3914,026

[i] CAND1, cullin-associated and neddylation-dissociated 1; CBL, Cbl proto-oncogene; CREBBP, CREB binding protein; CTNNB1, catenin β1; CUL1, cullin 1; GRB2, growth factor receptor-bound protein 2; HDAC5, histone deacetylase 5; PDAC, pancreatic ductal adenocarcinoma; SMURF1, SMAD-specific E3 ubiquitin protein ligase 1; SP1, Sp1 transcription factor; UBE2I, ubiquitin-conjugating enzyme E2 I.

Functional annotation and pathway enrichment analyses

To examine the functions of the identified DEGs, the DEGs were mapped in DAVID to perform GO term and KEGG pathway analyses. The following three aspects were included in the GO analyses: Biological process (BP), cellular component (CC) and molecular function (MF). In the GO analyses, DEGs identified between normal and PDAC tissues were notably enriched in ‘cell-cell adhesion’ (BP), ‘cytosol’ (CC) and ‘protein binding’ (MF) (Fig. 4A-C). In total, 27 KEGG pathways were significantly enriched (P<0.05) between normal and PDAC tissues. The top two enriched pathways with the lowest P value were ‘ubiquitin-mediated proteolysis’ (P=7.40×10−9) and ‘pathways in cancer’ (P=6.23×10−5) (Fig. 4D), which demonstrated that these DEGs may be strongly associated with pancreatic cancer occurrence.

Figure 4.

GO term and KEGG pathway analyses of differentially expressed genes. GO term analyses of (A) biological process, (B) cellular component and (C) molecular function. (D) KEGG pathway analysis. GO, Gene Ontology; HIF-1, hypoxia-inducible factor 1; KEGG, Kyoto Encyclopedia of Genes and Genomes; PDAC, pancreatic ductal adenocarcinoma; SMAD, Smad family of genes.

TCGA validation

The top 10 upregulated and downregulated DEGs obtained by meta-analysis were validated in TCGA using 147 PDAC samples and four normal samples. The results revealed that compared with the expression levels in normal samples, S100A6 and KRT19 were strongly upregulated in the PDAC samples (Fig. 5A and B). Compared with the expression levels in normal samples, LIFR and GNG7 were significantly downregulated in the PDAC samples (Fig. 5C and D).

Figure 5.

TCGA dataset validation of S100A6, KRT19, LIFR and GNG7. (A) S100A6 and (B) KRT19 were upregulated genes. (C) LIFR and (D) GNG7 were downregulated genes. *P<0.05; **P<0.01; ****P<0.0001. GNG7, G protein subunit γ 7; KRT19, keratin-19; LIFR, LIF receptor α; PDAC, pancreatic ductal adenocarcinoma; S100A6, S100 calcium-binding protein; TCGA, The Cancer Genome Atlas.

Kaplan-Meier analysis

The TCGA dataset comprised 157 pancreatic cancer cases with detailed clinical and prognostic information and gene expression data. To determine the effects of the identified DEGs on the survival time of patients with PDAC, Kaplan-Meier analysis was used for the top 10 upregulated DEGs and the top 10 downregulated DEGs among the PDAC samples in the TCGA dataset. The results revealed that patients with high ITGA2 expression levels had shorter survival times compared with patients with lower ITGA2 expression levels (Fig. 6A). KRT19, MBOAT2 and MGLL exhibited similar results to ITGA2 (Fig. 6C-E). By contrast, patients with high FAM46C expression had longer survival times compared with patients with low FAM46C expression (Fig. 6G). These findings further demonstrated that high expression levels of upregulated DEGs, such as ITGA2, KRT19, MBOAT2 and MGLL, may represent a risk factor for poor survival in PDAC. By contrast, high expression levels of downregulated DEGs, such as FAM46C, may positively influence survival times of patients with PDAC.

Figure 6.

Kaplan-Meier survival curve analysis. Kaplan-Meier analysis of overall survival for patients with PDAC with high expression levels of upregulated and downregulated genes. (A) ITGA2, (B) S100A6, (C) KRT19, (D) MBOAT2 and (E) MGLL were upregulated genes. (F) LIFR, (G) FAM46C and (H) GNG7 were downregulated genes. Red lines represent high expression of DEGs and green lines represent low expression of DEGs. The censored subjects are marked with ticks on the Kaplan-Meier survival curves. DEG, differentially expressed gene; FAM46C, family with sequence similarity 46 member C; GNG7, G protein subunit 7; ITGA2, integrin subunit α2; KRT19, keratin-19; LIFR, LIF receptor; MBOAT2, membrane-bound O-acyltransferase domain-containing 2; MGLL, monoglyceride lipase; PDAC, pancreatic ductal adenocarcinoma; S100A6, S100 calcium-binding protein.

Validation of genes with significantly different expression in TCGA by RT-qPCR

To validate S100A6, KRT19 and GNG7 expression, RT-qPCR was performed using paired normal pancreatic tissues and PDAC tissues, which were collected from 15 patients. Among the three genes, S100A6 was significantly upregulated in PDAC tissues compared with normal pancreatic tissues (Fig. 7A). By contrast, the expression of KRT19 and GNG7 (Fig. 7B and C) PDAC did not significantly differ from normal tissues, although enhanced/low expression levels of these genes were detected in some PDAC tissues.

Figure 7.

Enhanced expression of S100A6, KRT19 and GNG7 mRNA in PDAC. Scatter plots illustrate the relative expression of (A) S100A6, (B) KRT19 and (C) GNG7 mRNA normalized to GAPDH mRNA in each sample. *P<0.05. GNG7, G protein subunit 7; KRT19, keratin-19; PDAC, pancreatic ductal adenocarcinoma; S100A6, S100 calcium-binding protein.

Discussion

With the rapid development of high-throughput genomic technology, researchers have explored gene mutations in pancreatic cancer over the past two decades, including oncogenes such as KRAS, SMAD4, proto-oncogene c-Myc and RAD51 recombinase (46), as well as tumor suppressor genes such as cyclin-dependent kinase inhibitor (CDKN2A) and p53 (6). Although these studies initially identified several pancreatic cancer-related gene mutations, DEGs derived from individual studies may be unreliable due to the limited quality and quantity of microarray chips. Identifying specific genes that can be used as biomarkers to diagnose pancreatic cancer or for targeted therapies is the key to reducing pancreatic cancer-related death and improving pancreatic cancer prognosis. Tang et al identified 205 pancreatic cancer-related genes (142 upregulated and 63 downregulated) by screening and merging DEGs from four transcriptome microarray datasets (226 PDAC samples and 65 normal pancreatic tissue samples) in the GEO database (27). Through functional analysis, including GO, KEGG pathway, Kaplan-Meier survival and PPI network analyses, the authors identified DKK1 and HMGA2 as candidate genes in PDAC. Notably, these two genes were not identified as DEGs in the present study. In the present study, a meta-analysis was performed using 11 high-quality microarray datasets (334 tumor samples and 151 normal samples) from the GEO database to identify reliable PDAC-related DEGs; 1,587 DEGs were identified, including 1,004 upregulated and 583 downregulated genes. One gained gene, UNKL, was identified with a combined ES value of −0.25395. This gained gene was previously unreported. Additionally, based on the PPI network, GRB2 and HDAC5 were identified as pivotal hub genes in PDAC. In addition to the aforementioned functional analysis by Tang et al (27), the expression of several top genes was verified by TCGA analysis and RT-qPCR.

Among the upregulated genes, HN1 had the highest combined ES value of 2.4036. The present study was consistent with a previous study by Tang et al (27). In addition, many studies have confirmed that HN1 mutations are related to cancer occurrence. For example, Lu et al reported that HN1 is mutated in ovarian carcinoma epithelial tissue and can be used as a biomarker for ovarian cancer (47). Laughlin et al established a mouse glioma model and confirmed that murine HN1 depletion led to a significant reduction in glioma volume (48). They also demonstrated that HN1 was associated with the melanoma phenotype and regulated cell proliferation and melanogenesis (48). HN1 is overexpressed in breast cancer and can promote invasion and metastasis in breast cancer (49) and prostate cancer cells (50). These studies illustrate that HN1 gene expression is related to the proliferation, invasion and metastasis of tumor cells. The results of the bioinformatics analysis in the present study demonstrated that HN1 was upregulated in PDAC samples, which indicated that PDAC occurrence may be related to HN1 overexpression. This result is consistent with the previously studied mechanism of action of HN1 (49). Conversely, RT-qPCR analysis of HN1 did not demonstrate a significant difference between PDAC samples and normal pancreatic tissue. Despite the lack of a statistical difference between PDAC patients with high levels and low HN1 expression levels in the TCGA dataset, since the present study suggested that HN1 expression is associated with PDAC, further exploration of the association between HN1 gene expression, PDAC progression and patient survival is important.

ITGA2 is a collagen receptor expressed on cell membranes that mediates cell-cell and cell-matrix adhesions. A number of previous studies have indicated that ITGA2 expression is upregulated in normal epithelial cells, and its expression changes when tumorigenesis occurs (51–53). Ramirez et al revealed a loss of ITG α2β1 in breast and prostate cancer (51). Previous studies have also reported that loss of ITGA2 serves a critical role in colon cancer metastasis (52) and that ITGA2 is strongly expressed in PDAC (53). The results of the present study are consistent with previous studies on pancreatic cancer in that ITGA2 expression was significantly higher in PDAC tissue compared with normal pancreatic tissue.

S100A6, or its product calcyclin, has been identified to be associated with various malignancies, such as osteosarcoma (54), gastric cancer (55) and malignant melanoma (56). Upregulation of S100A6 expression in tumor tissue is associated with cell proliferation (57). In addition, Ohuchida et al quantitatively analyzed S100A6 and demonstrated that the S100A6 expression level was markedly higher in pancreatic cancer tissues compared with normal pancreatic tissue (58). S100A6 is one of the 158 PDAC-related DEGs identified by Logsdon et al using microarray datasets (59). In the present study, S100A6 expression was upregulated in PDAC samples compared with normal tissue, which was verified by TCGA and RT-qPCR; the findings were consistent with previous studies. Unfortunately, no association was observed between S100A6 gene expression and patient survival time in the TCGA dataset.

In the present study, KIF1A was identified as the most strongly downregulated gene, with a combined ES of −1.9848. The protein encoded by KIF1A is microtubule-dependent molecular motor involved in important intracellular functions such as organelle transport and cell division (60). De et al (61) found that KIF1A is highly expressed in breast cancer and its upregulation is associated with breast cancer resistance to docetaxel. By contrast, Hattori et al demonstrated that KIF1A expression was upregulated in human and murine adrenal tumors compared with normal adrenal tissue (62). However, few studies have shown that the PDAC occurrence is related to the downregulation of KIF1A, although mutation of KIF1A is strongly associated with cancer (63). In the present study, KIF1A was the most strongly downregulated DEG in PDAC, further indicating that KIF1A may be related to the disease.

DYM encodes a Golgi-related protein transported within cells, and previous studies have shown that DYM loss of function is closely related to microcephaly in Dyggve-Melchior-Clausen syndrome (64,65). In the present study, DYM was the second most downregulated gene, with a combined ES value of −1.8453, which suggested that it may have potential protective functions against PDAC. KIF1A and DYM expression levels were validated by TCGA, although no significant differences between PDAC and normal tissues were observed. In addition, RT-qPCR analysis of KIF1A and DYM was performed multiple times. The expression of these two genes could not be detected in some normal or PDAC tissues, potentially owing to sub-threshold expression levels of these two genes, or high sensitivity of the genes to pancreatin, leading to a certain extent of degradation. Additional specimens need to be collected for further study.

Overexpression of BACE1, which hydrolyzes transmembrane amyloid precursor protein into amyloid-b protein, has been demonstrated to serve an important role in Alzheimer's disease (66). Excessive amyloid-b protein aggregation damages neurons (67). Chen et al reported that the long non-coding RNA BACE1 antisense RNA (BACE1-AS) may be used as a novel target of anisomycin to inhibit the proliferation and invasion of ovarian cancer stem cells; the authors also demonstrated that the increased BACE1 levels caused by silencing of BACE1-AS resulted in poor cancer suppression by anisomycin (68). Therefore, BACE1 may be a tumor suppressor. In the present study, BACE1 was downregulated in PDAC compared with normal pancreatic tissues. Nonetheless, the relationship between BACE1 and cancer, especially in PDAC, requires further study.

The top 10 upregulated and downregulated genes were validated by performing a meta-analysis on a dataset from TCGA. The results demonstrated that high expression levels of ITGA2, KRT19, MBOAT2, and MGLL were associated with shorter survival times, whereas high FAM46C expression was associated with longer survival times. Dong et al (69) reported that ITGA2 is associated with the tumor, node and metastasis classification system and staging of gastric cancer, and that the expression level of ITGA2 was increased in metastatic lymph nodes and distant metastases. They demonstrated that increased ITGA2 levels were associated with reduced overall survival rates in patients with gastric cancer. Previous studies have shown that KRT19 is a marker associated with metastasis and poor prognosis of pancreatic ductal adenocarcinoma (70,71). Badea et al (35) combined gene expression analysis of whole-tissue and microdissected PDAC, and found that upregulation of MBOAT2 is inversely correlated with patient survival. Transcriptomic analyses identified that MGLL overexpression is an unfavorable prognostic marker in primary gastrointestinal stromal tumors (72). The results of Caba et al (73) suggested that FAM46C was downregulated in patients with PDAC and could be used as prognostic indicator in these patients. The present results are consistent with previous studies and suggested that these genes may be novel targets for diagnosing and treating PDAC.

Using NetworkAnalyst for PPI network analysis, GRB2, with a degree of 90, and HDAC5, with a degree of 45, were identified as two hub genes among the upregulated and downregulated DEGs, respectively. The GRB2 protein contains one Src homology 2 domain and is a linker protein in the tyrosine kinase receptor signaling pathway (74). GRB2 expression directly affects cell proliferation and differentiation (75). Liang et al found that GRB2 expression was higher in hepatocellular carcinoma compared with normal liver tissue and that high GRB2 expression levels were associated with shorter survival times (76). This is consistent with the GRB2 expression profile in PDAC described in the present study, although the expression level of GRB2 did not appear to be significantly associated with overall survival rates in the present study. In addition, a previous study has confirmed that Grb2 may be used as a therapeutic target for pancreatic cancer (77). Wang et al demonstrated that GRB2 is a target of miR-329 through the GRB2/pERK pathway, which may lead to novel therapies for pancreatic cancer (78). The results of these studies verify the accuracy and credibility of the results of the present study and further demonstrate that GRB2 is a potential target for treating pancreatic cancer.

Histone deacetylases are epigenetic regulators that suppress transcription by acting on gene promoters. HDAC1, HDAC2, HDAC3 and HDAC8 are targets of multiple epigenetic inhibitors, such as the REST corepressor 1, the nucleosome remodeling deacetylase and the SIN3 histone deacetylase complexes (79). A number of studies have reported high HDAC5 expression in various tumors, including medulloblastomas (GSE15471, GSE16515, GSE22780, GSE28735, GSE32676, GSE43288-GPL96, GSE43288-GPL97, GSE43795, GSE46234, GSE55643 and GSE62165.) (80), breast cancer (81) and pancreatic neuroendocrine tumors (82). In addition, HDAC5 overexpression is associated with tumor cell proliferation and invasion, as well as poor prognosis (80–82). He et al demonstrated that HDAC5 is overexpressed in and promotes the proliferation of colorectal cancer cells by upregulating delta-like canonical Notch ligand 4 expression (83). However, Özdağ et al reported the opposite finding that, with the exception of high HDAC5 expression levels in two samples of rectal cancer, HDAC5 expression in all other rectal cancers was markedly downregulated and that HDAC5 expression could be used to distinguish between rectal tumors and normal tissues (84). These results are similar to the results of the present study, which demonstrated that HDAC5 was downregulated in PDAC tissues compared with normal tissues. Overall, findings to date demonstrate that HDAC5 may serve a key role in tumorigenesis, but its role in PDAC requires further study.

In conclusion, 1,587 DEGs were identified in the present meta-analysis. HN1, ITGA2 and S100A6 were the top upregulated genes and may be promising potential targets for diagnosing and treating PDAC. HN1, which had the highest combined ES, has rarely been reported as being important in PDAC; thus, this gene should be further investigated. KIF1A, DYM and BACE1 were the most markedly downregulated genes in this study, providing new perspectives regarding PDAC mechanisms and targeted treatment. GRB2 and HDAC5 were identified as hub genes, serving the most pivotal roles in PDAC. However, a lack of adequate validation in vitro or in vivo is a limitation of this study. As the number of PDAC cases in the TCGA database is limited, the present results need to be confirmed by further experiments. Therefore, future research will include experimental verification of the meta-analysis results using immunohistochemistry and cell proliferation assays, and identification of genes associated with PDAC progression by screening differentially expressed genes at different stages.

Acknowledgements

Not applicable.

Funding

The present study was supported by The National Natural Science Foundation of China (grant nos. 81371661 and 81873895).

Availability of data and materials

The datasets used and analyzed during the present study are available from GEO GSE15471, GSE16515, GSE22780, GSE28735, GSE32676, GSE43288-GPL96, GSE43288-GPL97, GSE43795, GSE46234, GSE55643 and GSE62165 (http://www.ncbi.nlm.nih.gov/geo) and TCGA (https://tcga-data.nci.Nih.gov/tcga/).

Authors' contributions

LL analyzed the results. LL and SW wrote the manuscript. PH and SW designed the study. CC performed the experiments. SP, YC and XL conceived the study and perform statistical analyses. ND, QL and LM collected and analyzed the data. All authors approved the manuscript for publication and agree to be accountable for all aspects of the research.

Ethics approval and consent to participate

Human study protocols were approved by the ethics committee of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China), in accordance with the Declaration of Helsinki (reference no. S298). All patients in the study provided written informed consent.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer Statistics, 2017. CA Cancer J Clin. 67:7–30. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Crane CH, Varadhachary GR, Yordy JS, Staerkel GA, Javle MM, Safran H, Haque W, Hobbs BD, Krishnan S, Fleming JB, et al: Phase II trial of cetuximab, gemcitabine, and oxaliplatin followed by chemoradiation with cetuximab for locally advanced (T4) pancreatic adenocarcinoma: Correlation of Smad4(Dpc4) immunostaining with pattern of disease progression. J Clin Oncol. 29:3037–3043. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Hezel AF, Kimmelman AC, Stanger BZ, Bardeesy N and Depinho RA: Genetics and biology of pancreatic ductal adenocarcinoma. Genes Dev. 20:1218–1249. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Gillen S, Schuster T, Meyer Zum Büschenfelde C, Friess H and Kleeff J: Preoperative/neoadjuvant therapy in pancreatic cancer: A systematic review and meta-analysis of response and resection percentages. PLoS Med. 7:e10002672010. View Article : Google Scholar : PubMed/NCBI

5 

Stratton MR, Campbell PJ and Futreal PA: The cancer genome. Nature. 458:719–724. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, Mankoo P, Carter H, Kamiyama H, Jimeno A, et al: Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science. 321:1801–1806. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Nagata K, Horinouchi M, Saitou M, Higashi M, Nomoto M, Goto M and Yonezawa S: Mucin expression profile in pancreatic cancer and the precursor lesions. J Hepatobiliary Pancreat Surg. 14:243–254. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Sausen M, Phallen J, Adleff V, Jones S, Leary RJ, Barrett MT, Anagnostou V, Parpart-Li S, Murphy D, Kay Li Q, et al: Clinical implications of genomic alterations in the tumour and circulation of pancreatic cancer patients. Nat Commun. 6:76862015. View Article : Google Scholar : PubMed/NCBI

9 

Rozenblum E, Schutte M, Goggins M, Hahn SA, Panzer S, Zahurak M, Goodman SN, Sohn TA, Hruban RH, Yeo CJ and Kern SE: Tumor-suppressive pathways in pancreatic carcinoma. Cancer Res. 57:1731–1734. 1997.PubMed/NCBI

10 

Bardeesy N, Cheng KH, Berger JH, Chu GC, Pahler J, Olson P, Hezel AF, Horner J, Lauwers GY, Hanahan D and DePinho RA: Smad4 is dispensable for normal pancreas development yet critical in progression and tumor biology of pancreas cancer. Genes Dev. 20:3130–3146. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Fong ZV and Winter JM: Biomarkers in pancreatic cancer: Diagnostic, prognostic, and predictive. Cancer J. 18:530–538. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Poruk KE, Gay DZ, Brown K, Mulvihill JD, Boucher KM, Scaife CL, Firpo MA and Mulvihill SJ: The clinical utility of CA 19-9 in pancreatic adenocarcinoma: Diagnostic and prognostic updates. Curr Mol Med. 13:340–351. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Kim SM, Kwon IJ, Myoung H, Lee JH and Lee SK: Identification of human papillomavirus (HPV) subtype in oral cancer patients through microarray technology. Eur Arch Otorhinolaryngol. 275:535–543. 2018. View Article : Google Scholar : PubMed/NCBI

14 

Gunel T, Hosseini MK, Gumusoglu E, Kisakesen HI, Benian A and Aydinli K: Expression profiling of maternal plasma and placenta microRNAs in preeclamptic pregnancies by microarray technology. Placenta. 52:77–85. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Qiao X, Wang H, Wang X, Zhao B and Liu J: Microarray technology reveals potentially novel genes and pathways involved in non-functioning pituitary adenomas. Balkan J Med Genet. 19:5–16. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Li G, Li X, Yang M, Xu L, Deng S and Ran L: Prediction of biomarkers of oral squamous cell carcinoma using microarray technology. Sci Rep. 7:421052017. View Article : Google Scholar : PubMed/NCBI

17 

Li J, Chen Z, Tian L, Zhou C, He MY, Gao Y, Wang S, Zhou F, Shi S, Feng X, et al: LncRNA profile study reveals a three-lncRNA signature associated with the survival of patients with oesophageal squamous cell carcinoma. Gut. 63:1700–1710. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Ramasamy A, Mondry A, Holmes CC and Altman DG: Key issues in conducting a meta-analysis of gene expression microarray datasets. PLoS Med. 5:e1842008. View Article : Google Scholar : PubMed/NCBI

19 

Rung J and Brazma A: Reuse of public genome-wide gene expression data. Nat Rev Genet. 14:89–99. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Wang S, Jin F, Fan W, Liu F, Zou Y, Hu X, Xu H and Han P: Gene expression meta-analysis in diffuse low-grade glioma and the corresponding histological subtypes. Sci Rep. 7:117412017. View Article : Google Scholar : PubMed/NCBI

21 

Zhang Y, Xia Q and Lin J: Identification of the potential oncogenes in glioblastoma based on bioinformatic analysis and elucidation of the underlying mechanisms. Oncol Rep. 40:715–725. 2018.PubMed/NCBI

22 

Xiao W, Pacyna-Gengelbach M, Schluns K, An Q, Gao Y, Cheng S and Petersen I: Differentially expressed genes associated with human lung cancer. Oncol Rep. 14:229–234. 2005.PubMed/NCBI

23 

Tang F, He Z, Lei H, Chen Y, Lu Z, Zeng G and Wang H: Identification of differentially expressed genes and biological pathways in bladder cancer. Mol Med Rep. 17:6425–6434. 2018.PubMed/NCBI

24 

Peng C, Ma W, Xia W and Zheng W: Integrated analysis of differentially expressed genes and pathways in triplenegative breast cancer. Mol Med Rep. 15:1087–1094. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Sun W, Ma X, Shen J, Yin F, Wang C and Cai Z: Bioinformatics analysis of differentially expressed pathways related to the metastatic characteristics of osteosarcoma. Int J Mol Med. 38:466–474. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Hoshida Y, Nijman SM, Kobayashi M, Chan JA, Brunet JP, Chiang DY, Villanueva A, Newell P, Ikeda K, Hashimoto M, et al: Integrative transcriptome analysis reveals common molecular subclasses of human hepatocellular carcinoma. Cancer Res. 69:7385–7392. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Tang Y, Zhang Z, Tang Y, Chen X and Zhou J: Identification of potential target genes in pancreatic ductal adenocarcinoma by bioinformatics analysis. Oncol Lett. 16:2453–2461. 2018.PubMed/NCBI

28 

Amin MB, Edge S, Greene F, Byrd DR, Brookland RK, Washington MK, Gershenwald JE, Compton CC, Hess KR, Sullivan DC, et al: AJCC Cancer Staging Manual. 8th. Springer International Publishing; New York, NY: 2017, View Article : Google Scholar

29 

Xia J, Fjell CD, Mayer ML, Pena OM, Wishart DS and Hancock RE: INMEX-a web-based tool for integrative meta-analysis of expression data. Nucleic Acids Res. 41:W63–W70. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Johnson WE, Li C and Rabinovic A: Adjusting batch effects in microarray expression data using empirical bayes methods. Biostatistics. 8:118–127. 2007. View Article : Google Scholar : PubMed/NCBI

31 

Cochran WG: The combination of estimates from different experiments. Biometrics. 10:101–129. 1954. View Article : Google Scholar

32 

Marot G, Foulley JL, Mayer CD and Jaffrézic F: Moderated effect size and P-value combinations for microarray meta-analyses. Bioinformatics. 25:2692–2699. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Breuer K, Foroushani AK, Laird MR, Chen C, Sribnaia A, Lo R, Winsor GL, Hancock RE, Brinkman FS and Lynn DJ: InnateDB: Systems biology of innate immunity and beyond-recent updates and continuing curation. Nucleic Acids Res. 41:D1228–D1233. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Badea L, Herlea V, Dima SO, Dumitrascu T and Popescu I: Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia. Hepatogastroenterology. 55:2016–2027. 2008.PubMed/NCBI

36 

Pei H, Li L, Fridley BL, Jenkins GD, Kalari KR, Lingle W, Petersen G, Lou Z and Wang L: FKBP51 affects cancer cell response to chemotherapy by negatively regulating Akt. Cancer Cell. 16:259–266. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Zhang G, Schetter A, He P, Funamizu N, Gaedcke J, Ghadimi BM, Ried T, Hassan R, Yfantis HG, Lee DH, et al: DPEP1 inhibits tumor cell invasiveness, enhances chemosensitivity and predicts clinical outcome in pancreatic ductal adenocarcinoma. PLos One. 7:e315072012. View Article : Google Scholar : PubMed/NCBI

38 

Zhang G, He P, Tan H, Budhu A, Gaedcke J, Ghadimi BM, Ried T, Yfantis HG, Lee DH, Maitra A, et al: Integration of metabolomics and transcriptomics revealed a fatty acid network exerting growth inhibitory effects in human pancreatic cancer. Clin Cancer Res. 19:4983–4993. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Donahue TR, Tran LM, Hill R, Li Y, Kovochich A, Calvopina JH, Patel SG, Wu N, Hindoyan A, Farrell JJ, et al: Integrative survival-based molecular profiling of human pancreatic cancer. Clin Cancer Res. 18:1352–1363. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Crnogorac-Jurcevic T, Chelala C, Barry S, Harada T, Bhakta V, Lattimore S, Jurcevic S, Bronner M, Lemoine NR and Brentnall TA: Molecular analysis of precursor lesions in familial pancreatic cancer. PLos One. 8:e548302013. View Article : Google Scholar : PubMed/NCBI

41 

Park M, Kim M, Hwang D, Park M, Kim WK, Kim SK, Shin J, Park ES, Kang CM, Paik YK and Kim H: Characterization of gene expression and activated signaling pathways in solid-pseudopapillary neoplasm of pancreas. Mod Pathol. 27:580–593. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Lunardi S, Jamieson NB, Lim SY, Griffiths KL, Carvalho-Gaspar M, Al-Assar O, Yameen S, Carter RC, McKay CJ, Spoletini G, et al: IP-10/CXCL10 induction in human pancreatic cancer stroma influences lymphocytes recruitment and correlates with poor survival. Oncotarget. 5:11064–11080. 2014. View Article : Google Scholar : PubMed/NCBI

43 

Janky R, Binda MM, Allemeersch J, Van den Broeck A, Govaere O, Swinnen JV, Roskams T, Aerts S and Topal B: Prognostic relevance of molecular subtypes and master regulators in pancreatic ductal adenocarcinoma. BMC Cancer. 16:6322016. View Article : Google Scholar : PubMed/NCBI

44 

Jha PK, Vijay A, Sahu A and Ashraf MZ: Comprehensive gene expression meta-analysis and integrated bioinformatic approaches reveal shared signatures between thrombosis and myeloproliferative disorders. Sci Rep. 6:370992016. View Article : Google Scholar : PubMed/NCBI

45 

Wang X, Ning Y and Guo X: Integrative meta-analysis of differentially expressed genes in osteoarthritis using microarray technology. Mol Med Rep. 12:3439–3445. 2015. View Article : Google Scholar : PubMed/NCBI

46 

Han H, Bearss DJ, Browne LW, Calaluce R, Nagle RB and Von Hoff DD: Identification of differentially expressed genes in pancreatic cancer cells using cDNA microarray. Cancer Res. 62:2890–2896. 2002.PubMed/NCBI

47 

Lu KH, Patterson AP, Wang L, Marquez RT, Atkinson EN, Baggerly KA, Ramoth LR, Rosen DG, Liu J, Hellstrom I, et al: Selection of potential markers for epithelial ovarian cancer with gene expression arrays and recursive descent partition analysis. Clin Cancer Res. 10:3291–3300. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Laughlin KM, Luo D, Liu C, Shaw G, Warrington KH Jr, Qiu J, Yachnis AT and Harrison JK: Hematopoietic- and neurologic-expressed sequence 1 expression in the murine GL261 and high-grade human gliomas. Pathol Oncol Res. 15:437–444. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Zhang C, Xu B, Lu S, Zhao Y and Liu P: HN1 contributes to migration, invasion, and tumorigenesis of breast cancer by enhancing MYC activity. Mol Cancer. 16:902017. View Article : Google Scholar : PubMed/NCBI

50 

Varisli L, Ozturk BE, Akyuz GK and Korkmaz KS: HN1 negatively influences the β-catenin/E-cadherin interaction, and contributes to migration in prostate cells. J Cell Biochem. 116:170–178. 2015. View Article : Google Scholar : PubMed/NCBI

51 

Ramirez NE, Zhang Z, Madamanchi A, Boyd KL, O'Rear LD, Nashabi A, Li Z, Dupont WD, Zijlstra A and Zutter MM: The α2β1 integrin is a metastasis suppressor in mouse models and human cancer. J Clin Invest. 121:226–237. 2011. View Article : Google Scholar : PubMed/NCBI

52 

Robertson JH, Yang SY, Winslet MC and Seifalian AM: Functional blocking of specific integrins inhibit colonic cancer migration. Clin Exp Metastasis. 26:769–780. 2009. View Article : Google Scholar : PubMed/NCBI

53 

Shimoyama S, Gansauge F, Gansauge S, Oohara T and Beger HG: Altered expression of extracellular matrix molecules and their receptors in chronic pancreatitis and pancreatic adenocarcinoma in comparison with normal pancreas. Int J Pancreatol. 18:227–234. 1995.PubMed/NCBI

54 

Li Y, Wagner ER, Yan Z, Wang Z, Luther G, Jiang W, Ye J, Wei Q, Wang J, Zhao L, et al: The calcium-binding protein S100A6 accelerates human osteosarcoma growth by promoting cell proliferation and inhibiting osteogenic differentiation. Cell Physiol Biochem. 37:2375–2392. 2015. View Article : Google Scholar : PubMed/NCBI

55 

Wang XH, Zhang LH, Zhong XY, Xing XF, Liu YQ, Niu ZJ, Peng Y, Du H, Zhang GG, Hu Y, et al: S100A6 overexpression is associated with poor prognosis and is epigenetically up-regulated in gastric cancer. Am J Pathol. 177:586–597. 2010. View Article : Google Scholar : PubMed/NCBI

56 

Maelandsmo GM, Florenes VA, Mellingsaeter T, Hovig E, Kerbel RS and Fodstad O: Differential expression patterns of S100A2, S100A4 and S100A6 during progression of human malignant melanoma. Int J Cancer. 74:464–469. 1997. View Article : Google Scholar : PubMed/NCBI

57 

He X, Xu X, Khan AQ and Ling W: High expression of S100A6 predicts unfavorable prognosis of lung squamous cell cancer. Med Sci Monit. 23:5011–5017. 2017. View Article : Google Scholar : PubMed/NCBI

58 

Ohuchida K, Mizumoto K, Ishikawa N, Fujii K, Konomi H, Nagai E, Yamaguchi K, Tsuneyoshi M and Tanaka M: The role of S100A6 in pancreatic cancer development and its clinical implication as a diagnostic marker and therapeutic target. Clin Cancer Res. 11:7785–7793. 2005. View Article : Google Scholar : PubMed/NCBI

59 

Logsdon CD, Simeone DM, Binkley C, Arumugam T, Greenson JK, Giordano TJ, Misek DE, Kuick R and Hanash S: Molecular profiling of pancreatic adenocarcinoma and chronic pancreatitis identifies multiple genes differentially regulated in pancreatic cancer. Cancer Res. 63:2649–2657. 2003.PubMed/NCBI

60 

Okada Y, Yamazaki H, Sekine-Aizawa Y and Hirokawa N: The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell. 81:769–780. 1995. View Article : Google Scholar : PubMed/NCBI

61 

De S, Cipriano R, Jackson MW and Stark GR: Overexpression of kinesins mediates docetaxel resistance in breast cancer cells. Cancer Res. 69:8035–8042. 2009. View Article : Google Scholar : PubMed/NCBI

62 

Hattori Y, Kanamoto N, Kawano K, Iwakura H, Sone M, Miura M, Yasoda A, Tamura N, Arai H, Akamizu T, et al: Molecular characterization of tumors from a transgenic mouse adrenal tumor model: Comparison with human pheochromocytoma. Int J Oncol. 37:695–705. 2010. View Article : Google Scholar : PubMed/NCBI

63 

Brait M, Loyo M, Rosenbaum E, Ostrow KL, Markova A, Papagerakis S, Zahurak M, Goodman SM, Zeiger M, Sidransky D, et al: Correlation between BRAF mutation and promoter methylation of TIMP3, RARbeta2 and RASSF1A in thyroid cancer. Epigenetics. 7:710–719. 2012. View Article : Google Scholar : PubMed/NCBI

64 

Osipovich AB, Jennings JL, Lin Q, Link AJ and Ruley HE: Dyggve-Melchior-Clausen syndrome: Chondrodysplasia resulting from defects in intracellular vesicle traffic. Proc Natl Acad Sci U S A. 105:16171–16176. 2008. View Article : Google Scholar : PubMed/NCBI

65 

Dimitrov A, Paupe V, Gueudry C, Sibarita JB, Raposo G, Vielemeyer O, Gilbert T, Csaba Z, Attie-Bitach T, Cormier-Daire V, et al: The gene responsible for Dyggve-Melchior-Clausen syndrome encodes a novel peripheral membrane protein dynamically associated with the Golgi apparatus. Hum Mol Genet. 18:440–453. 2009. View Article : Google Scholar : PubMed/NCBI

66 

Shi Z, Hong Y, Zhang K, Wang J, Zheng L, Zhang Z, Hu Z, Han X, Han Y, Chen T, et al: BAG-1M co-activates BACE1 transcription through NF-κB and accelerates Aβ production and memory deficit in Alzheimer's disease mouse model. Biochim Biophys Acta Mol Basis Dis. 1863:2398–2407. 2017. View Article : Google Scholar : PubMed/NCBI

67 

Yi X, Hao Y, Xia N, Wang J, Quintero M, Li D and Zhou F: Sensitive and continuous screening of inhibitors of β-site amyloid precursor protein cleaving enzyme 1 (BACE1) at single SPR chips. Anal Chem. 85:3660–3666. 2013. View Article : Google Scholar : PubMed/NCBI

68 

Chen Q, Liu X, Xu L, Wang Y, Wang S, Li Q, Huang Y and Liu T: Long non-coding RNA BACE1-AS is a novel target for anisomycin-mediated suppression of ovarian cancer stem cell proliferation and invasion. Oncol Rep. 35:1916–1924. 2016. View Article : Google Scholar : PubMed/NCBI

69 

Dong J, Wang R, Ren G, Li X, Wang J, Sun Y, Liang J, Nie Y, Wu K, Feng B, et al: HMGA2-FOXL2 axis regulates metastases and epithelial-to-mesenchymal transition of chemoresistant gastric cancer. Clin Cancer Res. 23:3461–3473. 2017. View Article : Google Scholar : PubMed/NCBI

70 

Yao H, Yang Z, Liu Z, Miao X, Yang L, Li D, Zou Q and Yuan Y: Glypican-3 and KRT19 are markers associating with metastasis and poor prognosis of pancreatic ductal adenocarcinoma. Cancer Biomark. 17:397–404. 2016. View Article : Google Scholar : PubMed/NCBI

71 

Dugnani E, Sordi V, Pellegrini S, Chimienti R, Marzinotto I, Pasquale V, Liberati D, Balzano G, Doglioni C, Reni M, et al: Gene expression analysis of embryonic pancreas development master regulators and terminal cell fate markers in resected pancreatic cancer: A correlation with clinical outcome. Pancreatology. 18:945–953. 2018. View Article : Google Scholar : PubMed/NCBI

72 

Li CF, Chuang IC, Liu TT, Chen KC, Chen YY, Fang FM, Li SH, Chen TJ, Yu SC, Lan J and Huang HY: Transcriptomic reappraisal identifies MGLL overexpression as an unfavorable prognosticator in primary gastrointestinal stromal tumors. Oncotarget. 7:49986–49997. 2016.PubMed/NCBI

73 

Caba O, Irigoyen A, Jimenez-Luna C, Benavides M, Ortuño FM, Gallego J, Rojas I, Guillen-Ponce C, Torres C, Aranda E and Prados J: Identification of gene expression profiling associated with erlotinib-related skin toxicity in pancreatic adenocarcinoma patients. Toxicol Appl Pharmacol. 311:113–116. 2016. View Article : Google Scholar : PubMed/NCBI

74 

Wintgens JP, Wichert SP, Popovic L, Rossner MJ and Wehr MC: Monitoring activities of receptor tyrosine kinases using a universal adapter in genetically encoded split TEV assays. Cell Mol Life Sci. 76:1185–1199. 2019. View Article : Google Scholar : PubMed/NCBI

75 

Dharmawardana PG, Peruzzi B, Giubellino A, Burke TR Jr and Bottaro DP: Molecular targeting of growth factor receptor-bound 2 (Grb2) as an anti-cancer strategy. Anticancer Drugs. 17:13–20. 2006. View Article : Google Scholar : PubMed/NCBI

76 

Liang C, Xu Y, Ge H, Xing B, Li G, Li G and Wu J: miR-564 inhibits hepatocellular carcinoma cell proliferation and invasion by targeting the GRB2-ERK1/2-AKT axis. Oncotarget. 8:107543–107557. 2017. View Article : Google Scholar : PubMed/NCBI

77 

Birchmeier C, Birchmeier W, Gherardi E and Vande Woude GF: Met, metastasis, motility and more. Nat Rev Mol Cell Biol. 4:915–925. 2003. View Article : Google Scholar : PubMed/NCBI

78 

Wang X, Lu X, Zhang T, Wen C, Shi M, Tang X, Chen H, Peng C, Li H, Fang Y, et al: mir-329 restricts tumor growth by targeting grb2 in pancreatic cancer. Oncotarget. 7:21441–21453. 2016.PubMed/NCBI

79 

Witt O, Deubzer HE, Milde T and Oehme I: HDAC family: What are the cancer relevant targets? Cancer Lett. 277:8–21. 2009. View Article : Google Scholar : PubMed/NCBI

80 

Milde T, Oehme I, Korshunov A, Kopp-Schneider A, Remke M, Northcott P, Deubzer HE, Lodrini M, Taylor MD, von Deimling A, et al: HDAC5 and HDAC9 in medulloblastoma: Novel markers for risk stratification and role in tumor cell growth. Clin Cancer Res. 16:3240–3252. 2010. View Article : Google Scholar : PubMed/NCBI

81 

Li A, Liu Z, Li M, Zhou S, Xu Y, Xiao Y and Yang W: HDAC5, a potential therapeutic target and prognostic biomarker, promotes proliferation, invasion and migration in human breast cancer. Oncotarget. 7:37966–37978. 2016.PubMed/NCBI

82 

Klieser E, Urbas R, Stättner S, Primavesi F, Jäger T, Dinnewitzer A, Mayr C, Kiesslich T, Holzmann K, Di Fazio P, et al: Comprehensive immunohistochemical analysis of histone deacetylases in pancreatic neuroendocrine tumors: HDAC5 as a predictor of poor clinical outcome. Hum Pathol. 65:41–52. 2017. View Article : Google Scholar : PubMed/NCBI

83 

He P, Liang J, Shao T, Guo Y, Hou Y and Li Y: HDAC5 promotes colorectal cancer cell proliferation by up-regulating DLL4 expression. Int J Clin Exp Med. 8:6510–6516. 2015.PubMed/NCBI

84 

Ozdağ H, Teschendorff AE, Ahmed AA, Hyland SJ, Blenkiron C, Bobrow L, Veerakumarasivam A, Burtt G, Subkhankulova T, Arends MJ, et al: Differential expression of selected histone modifier genes in human solid cancers. BMC Genomics. 7:902006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu L, Wang S, Cen C, Peng S, Chen Y, Li X, Diao N, Li Q, Ma L, Han P, Han P, et al: Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets. Mol Med Rep 20: 1901-1914, 2019.
APA
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X. ... Han, P. (2019). Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets. Molecular Medicine Reports, 20, 1901-1914. https://doi.org/10.3892/mmr.2019.10414
MLA
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X., Diao, N., Li, Q., Ma, L., Han, P."Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets". Molecular Medicine Reports 20.2 (2019): 1901-1914.
Chicago
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X., Diao, N., Li, Q., Ma, L., Han, P."Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets". Molecular Medicine Reports 20, no. 2 (2019): 1901-1914. https://doi.org/10.3892/mmr.2019.10414
Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, Wang S, Cen C, Peng S, Chen Y, Li X, Diao N, Li Q, Ma L, Han P, Han P, et al: Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets. Mol Med Rep 20: 1901-1914, 2019.
APA
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X. ... Han, P. (2019). Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets. Molecular Medicine Reports, 20, 1901-1914. https://doi.org/10.3892/mmr.2019.10414
MLA
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X., Diao, N., Li, Q., Ma, L., Han, P."Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets". Molecular Medicine Reports 20.2 (2019): 1901-1914.
Chicago
Liu, L., Wang, S., Cen, C., Peng, S., Chen, Y., Li, X., Diao, N., Li, Q., Ma, L., Han, P."Identification of differentially expressed genes in pancreatic ductal adenocarcinoma and normal pancreatic tissues based on microarray datasets". Molecular Medicine Reports 20, no. 2 (2019): 1901-1914. https://doi.org/10.3892/mmr.2019.10414
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team