Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2021 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2021 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

CXCL16 may be a predisposing factor to atherosclerosis: An animal study

  • Authors:
    • Junbi Zhao
    • Menglin Yang
    • Jie Wu
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, The First Affiliated Hospital of University of South China, Hengyang, Hunan 421001, P.R. China, Department of Burns, Plastic Surgery and Dermatology, No. 922 Hospital of Joint Support Unit of the People's Liberation Army, Hengyang, Hunan 421002, P.R. China
  • Article Number: 716
    |
    Published online on: August 10, 2021
       https://doi.org/10.3892/mmr.2021.12355
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Atherosclerosis (AS) is a chronic inflammatory process initiated when lipoprotein is retained in the arterial wall. Leukocyte recruitment accelerates this process. CXC chemokine ligand 16 (CXCL16) acts as a chemokine to attract immune cells and also facilitates the phagocytosis process of modified low‑density lipoprotein. Whether CXCL16 promotes or inhibits the pathological process of AS remains to be elucidated. To clarify this, CXCL16 gene was introduced into C57BL/6J wild‑type mice to establish a stable CXCL16 overexpression mouse model. The initial changes of AS in mice were induced by high‑fat diet (HFD). To study how the interaction of HFD and CXCL16 affected fatty acid metabolism and deposition, body weight and plasma lipid profile were assessed. Soluble CXCL16, matrix metalloproteinase‑9, monocyte chemoattractant protein‑1 and intercellular adhesion molecule‑1 were detected by immunohistochemistry and ELISA to identify how CXCL16 affects AS lesion formation. The present study suggested that overexpression of CXCL16 combined with HFD lead to atherogenesis by upregulating the aforementioned inflammatory related genes at a protein level. The present study was the first, to the best of the authors' knowledge, to build a CXCL16 homozygous transgenic mice model to study how overexpressed CXCL16 is associated with AS for intervening in the occurrence and development of AS.

Introduction

Atherosclerosis (AS) is a chronic inflammatory disease as well as a cholesterol storage disease, which is often asymptomatic at the early stages but can lead to serious ischemic vascular disease and thrombosis such as coronary heart disease and carotid artery disease at an advanced stage (1–3).

Risk factors of AS, such as obesity, smoking, stress and hypertension, are all intimately linked with a higher level of local or global inflammation (4–8). CXC chemokine ligand 16 (CXCL16), a member of the CXC chemokine family, serves an important role in the initiation and maintenance of inflammation (9,10). Evidence links it with the formation and progression of AS (11). CXCL16 expresses in aortic smooth muscle cells exclusively within atherosclerotic plaques (12). Its two distinct existing isoforms in vivo, transmembrane and soluble form, give it great influence over inflammation (13). The transmembrane isoform functions as a selective cell adhesion molecule for CXC receptor 6+ cells, such as monocytes and T lymphocytes, to facilitate cell-cell interaction (14), while the soluble isoform secreted into extracellular matrix or plasma exerts a relatively long distance recruitment of immune cells and regulates a global inflammation level (15,16). Another role CXCL16 performs is a scavenger receptor which facilitates internalization of fatty acids in several central cell types involved in AS, such as macrophages and T lymphocytes (17). Clinical researches investigating the role of CXCL16 in AS or carotid artery disease are controversial, for instance, as to whether CXCL16 promotes or inhibits lesions (18). Decreased and increased plasma levels of CXCL16 are identified to be related to cardiovascular or cerebrovascular events, such as coronary artery disease and atherosclerotic ischemic stroke (11,19). It is probably due to the methodological limitation of clinical research that cross-sectional studies or a relatively short period of prospective study cannot well determine causal relationship. The present study attempted to address this problem by introducing CXCL16 gene into C57BL/6J wild-type mice, a canonical strain for metabolism disorder, to create a predisposed high expression level of CXCL16 during a relatively long period of time. The present study also focused on how this high level of CXCL16 expression affected atherogenicity in an inflammatory aspect by testing several well-established atherosclerotic inflammation markers.

Materials and methods

Laboratory animals

Animal experiments were approved by the Laboratory Animal Welfare and Ethics Review Committee of University of South China (approval no. SYSK2013-0010). The present study was performed according to the requirements in the Guide for the Care and Use of Laboratory Animals (20). Specific pathogen-free (SPF) C57BL/6J wild-type mice were purchased from Shanghai Model Organisms Center, Inc. (SMOC) and raised under SPF conditions. A total of 45 mice (30 females and 15 males; age, 6–8 weeks; weight, 17–20 g) were housed in standard plastic cages at 20–26°C, 40–70% humidity with a 12 h light/dark cycle and had free access to water and food. The mice were given 2 weeks to acclimate for breeding before any treatment.

Vector construction

The goal of the present study was to subclone mouse CXCL16 cDNA into the pGL3-basic mammalian expression vector. PCR amplification was used to multiply Murine CXCL16 cDNA and simultaneously as part of the primer a sequence (5′ to 3′) of flag tag (GATTACAAGGATGACGACGATAAG) was attached to the N terminus. Later scavenger receptor (SR)-enhancer, SR-promoter and CXCL16-flag were all respectively inserted into pGL3-basic between restriction sites KpnI and NheI, XhoI and HindIII, HindIII and XbaI. A genomic DNA isolation kit (Bio Basic Inc.) was used to extract and purify DNA (the yield of 5–10 µg) from miniprep according to the manufacturer's protocols. Verification was performed through Sanger sequencing (21) using an ABI 3730XL automatic sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc.). A triple cut site ClaI was set to cut the vector in to three parts that were respectively 1.8, 2.7 and 0.1 kbp. The 1.8 kbp fragments including CXCL16 cDNA were collected and purified from agarose gel electrophoresed in TBE running buffer using the gel recovery kit (Bio Basic Inc.), according to the manufacturer's instructions, for further use.

Founder mouse generation

A total of 30 C57BL/6J × CBA F1 hybrid female mice (age, 2–4 weeks; weight, 7–10 g) supplied by SMOC were housed in standard plastic cages at 20–26°C and 40–70% humidity with a 12 h light/dark cycle. These mice were used as their oocytes exhibit high survival and maturation rates after microinjection (22). At the age of ~6–8 weeks old, 12 h before dark cycle, they were injected with 10 IU PMSG and ~48 h afterwards with 10 IU human chorionic gonadotropin i.p. In the same afternoon they were mated 1:1 with fertile male C57BL/6J mice. For all mouse experiments, the mice were anesthetized with 50–60 mg/kg pentobarbital sodium (Sigma-Aldrich; Merck KGaA) and sacrificed by cervical dislocation. The next day, if a vaginal plug was present, they were set as donors and fertilized eggs were excised from oviducts into M2 culture medium (Sigma-Aldrich; Merck KGaA). After washing, screening and removal of cumulus cells, the zygotes were transferred into M16 medium (Sigma-Aldrich; Merck KGaA) prior to microinjection. Linear DNA constructs (1.8 kbp) prepared as aforementioned were injected into the pronuclei of zygotes using micromanipulator (Narishige Group). After ~20–30 min rest in M16, zygotes (20–30 each) were transferred into the oviducts of pseudopregnant C57BL/6J mice prepared beforehand. Integration of the transgene was determined by a double check of transgene-specific PCRs with genomic DNA isolated from tail biopsies of the progenies. To distinguish genomic CXCL16 from transgenic CXCL16, special upstream and downstream primers were located in SR-promoter and CXCL16-flag respectively. The primer sequences (purchased from Sangon Biotech Co., Ltd.) were given in Table I.

Table I.

Primer sequences used.

Table I.

Primer sequences used.

NameSequence
CXCL16-FP 5′-TAAAGCGGCCTAAATGGGGTG-3′
CXCL16-RP 5′-CAAGAAAAGGAAGAACGCAAGAGA-3′
β-Actin-FP 5′-CATCCTGCGTCTGGACCTGG-3′
β-Actin-RP 5′-TAATGTCACGCACGATTTCC-3′

[i] CXCL16, CXC chemokine ligand 16; FP, forward primer; RP, reverse primer.

Transgenic mice strain generation

PCR positive offspring were mated with wild-type C57BL/6J mice according to female/male ratio (1:1 or 1:2). To generate homozygous transgenic strain, sib-mating was applied most of the time and backcrossing when necessary. Genomic DNA was extracted from the descendants to sequence for the verification of transgene presence. PCR was used as a screen method. When all progenies (n>5) of two consecutive generations were all homozygous, the mouse was considered homozygous. After 10 generations of selective breeding, a CXCL16+/+ transgenic line was successfully established. In total, 16 CXCL16+/+ C57BL/6J mice from F11 combined with 16 wild-type C57BL/6J mice were chosen as subjects.

Treatment

CXCL16+/+ and wild-type mice were randomly selected and divided into two treatment groups. One group was fed with high-fat diet (HFD, 67.5% standard chow, 15% lard, 10% yolk powder, 3% cholesterol, 4% whole milk powder and 0.5% Sodium cholate; Amresco, LLC) and the other standard chow, termed low-fat diet (LFD) for 18 weeks (23–25). Body weight, plasma total cholesterol (TC), triglycerides (TG), low-density lipoprotein (LDL), high-density lipoprotein (HDL) were measured at week 18. Mice in each group were intraperitoneally injected with sodium pentobarbital (50 mg/kg) and were sacrificed by cervical dislocation followed by decapitation.

ELISA

ELISA kits for Mouse CXCL16 (cat. no. 10030301; Cusabio Technology LLC), Mouse matrix metalloproteinase-9 (MMP-9; cat. no. EK1462), monocyte chemoattractant protein-1 (MCP-1; cat. no. EK1351) and intercellular adhesion molecule-1 (ICAM-1; cat. no. EK1726; Wuhan Boster Biological Technology, Ltd.) were used according to the manufacturer's protocols. Absorbance was measured at 450 nm using an 800 TS Absorbance Reader (BioTek Instruments, Inc.). ELISA calc software (BioTNT; V0.1) was used to draw standard curve and calculate concentration.

Hematoxylin-eosin (HE) staining and immunohistochemistry

Biopsies were obtained from the aortic root and artery sinus and were fixed overnight in 4% formaldehyde solution at room temperature. Aortic root HE staining was performed to examine the degree of fatty acid infiltration among the groups. The sections were stained in hematoxylin solution for 10 min and eosin solution for 1 min at room temperature. Immunohistochemical staining of the lesions was performed at room temperature for 1 h using rabbit polyclonal MMP-9 antibody (1:1,000; cat. no. ab38898), rabbit polyclonal MCP-1 antibody (1:1,000; cat. no. ab73680) (both Abcam) and rabbit polyclonal ICAM-1 antibody (1:200; cat. no. PB9081; Wuhan Boster Biological Technology, Ltd.).

Statistical analysis

Each experiment was repeated in triplicate. Data analysis was performed with SPSS v17.0 (SPSS, Inc.) and presented as the mean ± standard deviation. Results were determined by unpaired Student's t test and one-way ANOVA (post hoc test: Tukey's multiple comparison test) or two-way ANOVA (post hoc test: Bonferroni). P<0.05 was considered to indicate a statistically significant difference. All diagrams were generated by GraphPad Prism7 (GraphPad Software, Inc.).

Results

Transgene construct

Following several rounds of insertion, a plasmid with the backbone of pGL3-basic, SR-enhancer, SR-promoter, CXCL16 CDS and flag was successfully constructed (Fig. 1) and confirmed by sequencing.

Figure 1.

Diagram of transgenic mice strain generation. SR, scavenger receptor; CXCL16, CXC chemokine ligand 16; ori, origin; Ampr, ampicillin resistance gene; SV40, simian virus 40.

CXCL16+/+ transgenic mice

A total of 426 microinjected eggs were obtained and 20 eggs as one unit were transferred to oviducts of 20 pseudo mothers. Among which 12 became pregnant and 171 young were born. Following PCR screening, 26 were proved to be carriers of the target gene. After 4 weeks, another double-blind PCR was performed on 26 transgenic and four wild-type mice, and confirmed the stability of transgene expression. Founder mice were mated with wild-type C57BL/6J mice. The PCR-positive offspring were then mated with positive siblings in order to obtained homozygous transgenic mice. When all progenies (n>5) of two consecutive generations were all homozygous, the parent mice were considered homozygous. F8-1–2 (female) and F9-2–3 (male) were thus proved homozygous and, when mated with wild type mice, their offspring were all positive. Backcross F8-1–2 with F9-2-3, 5 descendants were obtained and termed C10-1–1 to C10-1-5. Sib-mate C10-1 and 19 descendants were obtained and eight were randomly chosen as CXCL16+/+ transgenic subject mice. In addition, eight from the 11th generation of wild-type mice were randomly selected as subjects.

Transgene expression in CXCL16+/+ transgenic mice

CXCL16 mRNA expression on artery AS lesion and plasma protein expression was measured at week 18. In the two HFD groups or the two LFD groups, CXCL16+/+ transgenic mice had a higher CXCL16 mRNA expression (Fig. 2A). CXCL16 mRNA expression of CXCL16+/+ transgenic mice or wild-type mice fed with HFD was significantly higher than those fed with LFD (Fig. 2A). CXCL16 plasma protein expression was result similar to CXCL16 mRNA expression on artery AS lesion (Fig. 2B).

Figure 2.

CXCL16 expression in CXCL16+/+ transgenic mice. (A) Relative mRNA expression of CXCL16 on artery atherosclerosis lesion in the HFD and LFD groups. (B) Plasma CXCL16 level at week 18 in the HFD and LFD groups. All data are expressed as the mean ± standard deviation and analyzed by one-way or two-way analysis of variance (n=8). *P<0.05, ***P<0.001. CXCL16, CXC chemokine ligand 16; HFD, high-fat diet; LFD, low-fat diet.

Plasma lipid profile and visceral fat accumulation

Body weight and plasma lipid profile were measured at the end of the week 18. No significant difference was observed between the two LFD groups, but the average body weight of CXCL16+/+ transgenic mice fed with HFD was significantly highly (Fig. 3A) compared with that of wild-type mice fed with the same regimen. Similar results were observed in plasma TC level, LDL-cholesterol (LDL-C) level, non HDL-C level and TC/HDL-cholesterol (HDL-C) ratio (Fig. 3B-E). Another significant change was identified between CXCL16+/+ transgenic mice fed with HFD and LFD. When fed with HFD, CXCL16+/+ transgenic mice tend to maintain much higher plasma lipoprotein levels such as LDL-C and HDL-C compared with the LFD groups (Fig. 3C and F), even when no significant differences were observed between the expression levels of the wild-type mice groups. This suggested that CXCL16 exerted an effect on fatty acid metabolism, but it was only significant when a higher intake of fatty acid was present.

Figure 3.

Body weights and plasma lipid profiles in different groups. (A) Body weights and plasma level of (B) TC, (C) LDL-C, (D) non HDL-C, (E) TC/HDL-C ratio and (F) HDL-C. All data are expressed as the mean ± standard deviation and analyzed by one-way or two-way analysis of variance (n=8). *P<0.05, **P<0.01, ***P<0.001. TC, total cholesterol; LDL-C, low density lipoprotein-cholesterol; HDL-C, high density lipoprotein-cholesterol; HFD, high-fat diet; LFD, low-fat diet.

Visceral fat accumulation was recorded in the form of images (data not shown). Fibrosis status was determined according to the Ishak staging system (26). Table II shows the percentage of mice with different degree of liver disease; after 18 weeks of HFD, 100% of mice with CXCL16+/+ developed liver diseases, while only 50% of wild-type mice in HFD did. The degree of fibrosis status was also relatively less. None of mice in the LFD groups developed fatty liver disease.

Table II.

Counts of mice with liver disease in each experimental group (n=8).

Table II.

Counts of mice with liver disease in each experimental group (n=8).

GroupnCirrhosisFatty liverHealthy liverNos. of livers with pathological changesPercentage
HDF CXCL16+/+84408100
HDF wild-type8044450
LDF CXCL16+/+800880
LDF wild-type800800

[i] CXCL16, CXC chemokine ligand 16; HDF, high-fat diet; LDF, low-fat diet.

Aortic root HE staining

For aortic root HE staining, CXCL16 double positive mice in the HFD groups demonstrated the most marked contrast compared with healthy aorta (Fig. 4).

Figure 4.

HE staining of aortic root sections in different groups. Representative images of aortic root sections stained with HE to exam total fatty acid infiltration. Black arrows indicate fatty acid infiltration. (A) HFD CXCL16+/+, (B) HFD wild type, (C) LFD CXCL16+/+, (D) LFD wild type. Magnification, ×400. HE, hematoxylin-eosin; CXCL16, CXC chemokine ligand 16; HFD, high-fat diet; LFD, low-fat diet.

Plasma level of MCP-1 and ICAM-1

Plasma MCP-1 and ICAM-1 expression levels were determined by ELISA at the end of the week 18. Fig. 5A demonstrates the overall expression level of MCP-1 in the four groups. MCP-1 expression pattern among the LFD groups showed no observable discrepancy (Fig. 5A) while among the HFD groups, a significant difference was observed; with a higher expression of CXCL16, MCP-1 expression levels were also higher (Fig. 5A).

Figure 5.

Plasma MCP-1 and ICAM-1 levels in different groups. Quantitative analysis of plasma MCP-1 and ICAM-1 levels in different groups was conducted using ELISA. (A) MCP-1, (B) ICAM-1. All data are expressed as the mean ± standard deviation (n=8) and analyzed by one-way or two-way analysis of variance. *P<0.05, ***P<0.001. MCP-1, monocyte chemoattractant protein-1; ICAM-1, intercellular adhesion molecule 1; HFD, high-fat diet; LFD, low-fat diet.

ICAM-1 expression levels showed an incremental gradient from LDF wild-type, LDF CXCL16+/+, HDF wild-type to HDF CXCL16+/+. This had no statistical significance except for the difference between CXCL16+/+ transgenic mice fed with HFD and LFD (Fig. 5B).

Artery sinus expression of MCP-1 and ICAM-1

Immunohistochemistry staining also indicated a higher local expression of MCP-1 and ICAM-1 in transgenic mice at the aortic root and artery sinus (Fig. 6). Positive MCP-1 signals were seen within the AS lesions, while accumulation of ICAM-1 was mainly located on the aortic intima surface (Fig. 6E-H). An overall higher expression of MCP-1 and ICAM-1 was observed at the artery sinus compared with the aortic root (Fig. 6).

Figure 6.

Reprehensive images of HFD group aortic root and artery sinus sections showing MCP-1 and ICAM-1 local expression. Black arrows indicate positively stained areas. (A and B) MCP-1 aortic root Immunohistochemistry. (C and D) MCP-1 artery sinus immunohistochemistry. (E and F) ICAM-1 immunohistochemistry of aortic root. (G and H) ICAM-1 immunohistochemistry of artery sinus. Magnification, ×400. HFD, high-fat diet; MCP-1, monocyte chemoattractant protein-1; ICAM-1, intercellular adhesion molecule-1.

Plasma level of MMP-9

Plasma MMP-9 level was tested at the end of the week 18. It showed high specificity among the four groups. HDF CXCL16+/+ mice had the highest plasma level of all, and it was statistically significant when compared with HDF wild-type or LDF CXCL16+/+ mice (Fig. 7). Additionally, LDF CXCL16+/+ mice also expressed a higher level of plasma MMP-9 than LDF wild-type mice (Fig. 7).

Figure 7.

Plasma MMP-9 level in different groups. Quantitative analysis of plasma MMP-9 level in different groups assayed by ELISA. All data are expressed as the mean ± standard deviation and analyzed by one-way or two-way analysis of variance (n=8). ***P<0.001. ELISA, enzyme linked immunosorbent assay; MMP-9, matrix metalloproteinase-9; HFD, high-fat diet; LFD, low-fat diet.

Artery sinus MMP-9 expression

Local expression of MMP-9 in artery sinus was also tested among the HFD groups (Fig. 8A and B). Atherosclerotic plaques of CXCL16+/+ mice possessed a higher percentage of cells that were MMP-9 positive (Fig. 8C).

Figure 8.

MMP-9 local expression. Reprehensive images of the HFD groups artery sinus sections showing MMP-9 local expression. (A) CXCL16+/+ transgenic mice, (B) wild type mice. (C) Percentage of MMP-1 positive cells at artery sinus. All data are expressed as the mean ± standard deviation and analyzed by Student's t test (n=8). **P<0.01. Magnification, ×200 and ×400. MMP-9, matrix metalloproteinase-9; HFD, high-fat diet; CXCL16, CXC chemokine ligand 16.

Discussion

Growing attention has been paid to chemokines involved in the pathogenesis of AS (27). CXCL16 is one of those chemokines, although a large-scale review of overexpression of CXCL16 in transgenic mice is still required. CXCL16 is specifically expressed in arteries with AS and is mainly undetectable in normal arteries (14). The present study was the first, to the best of the authors' knowledge, to examine how overexpression of CXCL16 directs the progress of AS under LFD and HFD. Although apolipoprotein E (ApoE) knockout mice are used by numerous research groups for AS changes, they possess some limitations (28,29). ApoE is a multifunctional protein that has an effect on inflammation, oxidation, lipid transport and AS pathogenesis (30). These functions might affect atherosclerotic plaque development in ApoE−/− mice, independent of plasma lipid levels (29). It has been reported that HFD for 10–20 weeks can cause typical AS lesions in the aortic sinus valve of mice, which are mainly filled with foam cells and lipid streaks (23,31). The present study identified that a high expression level of CXCL16 combined with an HFD presented a strong pro-atherogenesis ability. Blood lipid levels have a regulatory effect on the expression of CXCL16. A higher level of lipid profile was identified in CXCL16+/+ transgenic mice fed with HFD and greater fatty acid accumulation was observed in the liver and the artery wall. Higher plasma levels of AS markers and denser foci expression of risk indicators were detected, while the levels in transgenic mice fed with LFD showed no significant difference with its corresponding control. It was a limitation to the present study that oil Red O staining was not performed to check the formation of lipid plaques and to observe the changes in foam cells. The observation of changes in plaques and fibrous caps will be added in future studies, which may further illustrate this part of the results.

HDF CXCL16+/+ mice expressed a significant high level of pro-inflammatory or pro-AS markers while the other three groups retained a relatively similar low level of such markers, suggesting that both HFD and high CXCL16 level were prerequisite for a severer degree of AS to occur. Overexpression of the CXCL16 gene in transgenic mice did have a pro-inflammatory effect, but not as great as the HFD. When an HFD was combined with high CXCL16 expression, it showed a predisposing effect greater than either of these factors (HFD or CXCL 16 overexpression) alone. As adipose tissue is a potential origin for inflammation, this may suggest that CXCL16 alone is not enough to initiate inflammation. However, CXCL16 when initiated is a potent booster of inflammation and, furthermore, AS.

MCP-1 and ICAM-1 are involved mainly in the initiation of atherosclerotic plaques (32). MCP-1 has a definite pro-atherogenesis effect via its potent chemotactic ability for monocytes and also helps them through endothelial cells by diapedesis (33). MCP-1 is predominantly expressed in macrophages, smooth muscle cells and endothelial cells (34). It induces transendothelial migration of monocytes so as to facilitate atherosclerotic lesion formation (35). Absence of MCP-1 results in a milder extent of AS. Modified LDL, local fluid stress or short-term of high glucose exposure may all be stimulants to upregulate MCP-1 expression (36–38). The present study proposed MCP-1 as an early stage in indicator of AS.

ICAM-1 by contrast, is an adhesion molecule. Adhesion molecules represent another group of factors closely linked with inflammation and AS (39). They are upregulated in the regions predisposed to atherosclerotic lesion. Deficiency of certain adhesion molecules exert a protective effect from atheroma formation (40,41). Among adhesion molecules, ICAM-1 and vascular cell adhesion protein 1 (VCAM-1) are upregulated in atherosclerotic plaques (32,43), while ICAM-1 is a more responsive marker to diet cholesterol compared with VCAM-1, which remains relatively stable during or after a high cholesterol diet (44). Thus, the present study proposed ICAM-1 as a marker representing adhesion molecules in AS.

Under the combined action of elevated blood lipids and CXCL16 overexpression, the expression levels of MCP-1 and ICAM-1 in the aortic root and artery sinus of transgenic mice with HFD were significantly higher compared with those of wild-type mice with HFD, suggesting that they may have a common regulatory pathway under the influence of CXCL16 overexpression. The distribution of inflammatory factors on the tissue surface is consistent with the location of the initial stage of AS. Overexpression of CXCL16 in ApoE knockout mice can also promote the expression of MCP-1 mRNA in arterial plaques, but its mechanism or signal pathway remain to be elucidated (45). These results of the present study can also indirectly support the hypothesis that CXCL16 has the effect of promoting AS lesions, which supports the views of Wuttge et al (46). In a future study, additional markers in CXCL16 inflammation-related pathways need to be investigated to further explain the process of promoting AS lesions.

MMP-9 is one of the zinc-dependent endopeptidases and has a broad spectrum of substrates including a full length interstitial collagens, certain cytokine and adhesion molecules (47–49). MMP-9 is closely involved in AS in that it can regulate inflammatory processes by proteolyzing chemokines (50,51) or releasing chemokines from their functional location (50). MMP-9 may also serve a role in macrophage migration (50). Another function, which is also the main role it serves in AS, is that MMP-9 affects plaque stability (52). Clinical and cell experimental studies have shown that a high level of MMP-9 expression, active form foci or total plasma MMP-9 are correlated with plaque vulnerability to rupture (53–56). The present study proposed MMP-9 level as a marker for advanced AS and its corresponding myocardial infarction. Following an HFD, all mice had elevated peripheral blood MMP-9. Immunohistochemistry showed that the expression of MMP-9 in the aortic sinus AS lesions of transgenic mice was significantly increased. Unfortunately, there was the lack of protein expression analysis of MCP-1, ICAM-1 and MMP-9 using western blot analysis in the present study.

According to a pooled analysis conducted by NCD Risk Factor Collaboration, the global body mass index has been constantly increasing since 1975 (57). This adds an extra burden to the task of artery disease control, although the pathological conditions in the arterial wall are reversible before certain point of the disease (58). More studies similar to the present study could lead the way to a significant elucidation of the mechanism of AS and may show the way to prevention or cure.

In conclusion, the present study was the first, to the best of the authors' knowledge, to establish a CXCL16 homozygous transgenic mice model to study how overexpressed CXCL16 is associated with AS. It is hypothesized that overexpression of CXCL16 combined with HFD may promote the AS lesions by upregulating the aforementioned inflammatory-related genes at a protein level. Overexpression of CXCL16 may lead to high blood lipids and strong inflammatory response. Whether blocking the expression of CXCL16 could reduce the local inflammatory response in AS, thereby intervening in the occurrence and development of AS, remains to be elucidated.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JZ and JW conceived and designed the experiments. JZ, MY and JW performed the experiments. JZ and JW confirm the authenticity of all the raw data. JZ and JW analyzed the data. JW wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal experiments were performed according to the guidelines of the Chinese Experimental Animals Administration Legislation and were approved by the Ethics Committee for Animal Care and Use of Shandong Academy of Medical Sciences.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wang HH, Garruti G, Liu M, Portincasa P and Wang DQ: Cholesterol and lipoprotein metabolism and atherosclerosis: Recent advances in reverse cholesterol transport. Ann Hepatol. 16 (Suppl 1):S27–S42. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Galkina E and Ley K: Immune and inflammatory mechanisms of atherosclerosis (*). Annu Rev Immunol. 27:165–197. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Toth PP: Subclinical atherosclerosis: What it is, what it means and what we can do about it. Int J Clin Pract. 62:1246–1254. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Ambrose JA and Barua RS: The pathophysiology of cigarette smoking and cardiovascular disease: An update. J Am Coll Cardiol. 43:1731–1737. 2004. View Article : Google Scholar : PubMed/NCBI

5 

Balistreri CR, Caruso C and Candore G: The role of adipose tissue and adipokines in obesity-related inflammatory diseases. Mediators Inflamm. 2010:8020782010. View Article : Google Scholar : PubMed/NCBI

6 

Gustafson B: Adipose tissue, inflammation and atherosclerosis. J Atheroscler Thromb. 17:332–341. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Wannamethee SG, Lowe GDO, Shaper AG, Rumley A, Lennon L and Whincup PH: Associations between cigarette smoking, pipe/cigar smoking, and smoking cessation, and haemostatic and inflammatory markers for cardiovascular disease. Eur Heart J. 26:1765–1773. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Mazurek T, Zhang L, Zalewski A, Mannion JD, Diehl JT, Arafat H, Sarov-Blat L, O'Brien S, Keiper EA, Johnson AG, et al: Human epicardial adipose tissue is a source of inflammatory mediators. Circulation. 108:2460–2466. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Andersen T, Ueland T, Ghukasyan Lakic T, Åkerblom A, Bertilsson M, Aukrust P, Michelsen AE, James SK, Becker RC, Storey RF, et al: C-X-C ligand 16 is an independent predictor of cardiovascular death and morbidity in acute coronary syndromes. Arterioscler Thromb Vasc Biol. 39:2402–2410. 2019. View Article : Google Scholar : PubMed/NCBI

10 

Bakogiannis C, Sachse M, Stamatelopoulos K and Stellos K: Platelet-derived chemokines in inflammation and atherosclerosis. Cytokine. 122:1541572019. View Article : Google Scholar : PubMed/NCBI

11 

Ma A, Pan X, Xing Y, Wu M, Wang Y and Ma C: Elevation of serum CXCL16 level correlates well with atherosclerotic ischemic stroke. Arch Med Sci. 10:47–52. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Cybulsky MI, Iiyama K, Li H, Zhu S, Chen M, Iiyama M, Davis V, Gutierrez-Ramos JC, Connelly PW and Milstone DS: A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest. 107:1255–1262. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Ludwig A, Schulte A, Schnack C, Hundhausen C, Reiss K, Brodway N, Held-Feindt J and Mentlein R: Enhanced expression and shedding of the transmembrane chemokine CXCL16 by reactive astrocytes and glioma cells. J Neurochem. 93:1293–1303. 2005. View Article : Google Scholar : PubMed/NCBI

14 

Hofnagel O, Engel T, Severs NJ, Robenek H and Buers I: SR-PSOX at sites predisposed to atherosclerotic lesion formation mediates monocyte-endothelial cell adhesion. Atherosclerosis. 217:371–378. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Lehrke M, Millington SC, Lefterova M, Cumaranatunge RG, Szapary P, Wilensky R, Rader DJ, Lazar MA and Reilly MP: CXCL16 is a marker of inflammation, atherosclerosis, and acute coronary syndromes in humans. J Am Coll Cardiol. 49:442–449. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Holmøy T, Løken-Amsrud KI, Bakke SJ, Beiske AG, Bjerve KS, Hovdal H, Lilleås F, Midgard R, Pedersen T, Šaltytė Benth J, et al: Inflammation markers in multiple sclerosis: CXCL16 reflects and may also predict disease activity. PLoS One. 8:e750212013. View Article : Google Scholar

17 

Canton J, Neculai D and Grinstein S: Scavenger receptors in homeostasis and immunity. Nat Rev Immunol. 13:6212013. View Article : Google Scholar : PubMed/NCBI

18 

Sheikine Y and Sirsjö A: CXCL16/SR-PSOX-a friend or a foe in atherosclerosis? Atherosclerosis. 197:487–495. 2008. View Article : Google Scholar : PubMed/NCBI

19 

Sheikine Y, Bang CS, Nilsson L, Samnegård A, Hamsten A, Jonasson L, Eriksson P and Sirsjö A: Decreased plasma CXCL16/SR-PSOX concentration is associated with coronary artery disease. Atherosclerosis. 188:462–466. 2006. View Article : Google Scholar : PubMed/NCBI

20 

National Research Council (US) Committee for the Update of the Guide for the Care and Use of Laboratory Animals, . Guide for the Care and Use of Laboratory Animals. 8th edition. National Academies Press (US); Washington, DC: 2011

21 

Crossley BM, Bai J, Glaser A, Maes R, Porter E, Killian ML, Clement T and Toohey-Kurth K: Guidelines for Sanger sequencing and molecular assay monitoring. J Vet Diagn Invest. 32:767–775. 2020. View Article : Google Scholar : PubMed/NCBI

22 

Thouas GA, Trounson AO and Jones GM: Effect of female age on mouse oocyte developmental competence following mitochondrial injury. Biol Repord. 73:366–373. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Stewart-Phillips JL, Lough J and Skamene E: Genetically determined susceptibility and resistance to diet-induced atherosclerosis in inbred strains of mice. J Lab Clin Med. 112:36–42. 1988.PubMed/NCBI

24 

Zhou YG, Lan XH, Li X and Xu R: Establishment and evaluation of an atherosclerosis model in rats. Pharm J Chin PLA. 27:399–403. 2011.

25 

Wang W, Zhang ZZ, Wu Y, Wang RQ, Chen JW, Chen J, Zhang Y, Chen YJ, Geng M, Xu ZD, et al: (−)-Epigallocatechin-3-gallate ameliorates atherosclerosis and modulates hepatic lipid metabolic gene expression in apolipoprotein E knockout mice: Involvement of TTC39B. Front Pharmacol. 9:1952018. View Article : Google Scholar : PubMed/NCBI

26 

Ishak K, Baptista A, Bianchi L, Callea F, De Groote J, Gudat F, Denk H, Desmet V, Korb G, MacSween RN, et al: Histological grading and staging of chronic hepatitis. J Hepatol. 22:696–699. 1995. View Article : Google Scholar : PubMed/NCBI

27 

Munjal A and Khandia R: Atherosclerosis: Orchestrating cells and bimolecules involved in its activation and inhibition. Adv Protein Chem Struct Biol. 120:85–122. 2020. View Article : Google Scholar : PubMed/NCBI

28 

Emini Veseli B, Perrotta P, De Meyer GRA, Roth L, Van der Donckt C, Martinet W and De Meyer GRY: Animal models of atherosclerosis. Eur J Pharmacol. 816:3–13. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Getz GS and Reardon CA: Apoprotein E as a lipid transport and signaling protein in the blood, liver, and artery wall. J Lipid Res. 50 (Suppl):S156–S161. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Zhang HL, Wu LM and Wu J: Cross-talk between apolipoprotein E and cytokines. Mediators Inflamm. 2011:9490722011. View Article : Google Scholar : PubMed/NCBI

31 

Yang XY, Yang YZ, Tan JM, Yuan ZH and Wang ZY: The estbablishment of an Atheroscleroti murine model and pathologieal observation of plaques by laser seaning confoeal mieroseopy. Chin J Arterioseler. 4:54–57. 1996.

32 

Roebuck KA: Oxidant stress regulation of IL-8 and ICAM-1 gene expression: Differential activation and binding of the transcription factors AP-1 and NF-kappaB (Review). Int J Mol Med. 4:223–230. 1999.PubMed/NCBI

33 

Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P and Rollins BJ: Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 2:275–281. 1998. View Article : Google Scholar : PubMed/NCBI

34 

Yadav A, Saini V and Arora S: MCP-1: Chemoattractant with a role beyond immunity: A review. Clin Chim Acta. 411:1570–1579. 2010. View Article : Google Scholar : PubMed/NCBI

35 

Kanda H, Tateya S, Tamori Y, Kotani K, Hiasa K, Kitazawa R, Kitazawa S, Miyachi H, Maeda S, Egashira K and Kasuga M: MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J Clin Invest. 116:1494–1505. 2006. View Article : Google Scholar : PubMed/NCBI

36 

Cushing SD, Berliner JA, Valente AJ, Territo MC, Navab M, Parhami F, Gerrity R, Schwartz CJ and Fogelman AM: Minimally modified low density lipoprotein induces monocyte chemotactic protein 1 in human endothelial cells and smooth muscle cells. Proc Natl Acad Sci USA. 87:5134–5138. 1990. View Article : Google Scholar : PubMed/NCBI

37 

Shyy YJ, Hsieh HJ, Usami S and Chien S: Fluid shear stress induces a biphasic response of human monocyte chemotactic protein 1 gene expression in vascular endothelium. Proc Natl Acad Sci USA. 91:4678–4682. 1994. View Article : Google Scholar : PubMed/NCBI

38 

Piga R, Naito Y, Kokura S, Handa O and Yoshikawa T: Short-term high glucose exposure induces monocyte-endothelial cells adhesion and transmigration by increasing VCAM-1 and MCP-1 expression in human aortic endothelial cells. Atherosclerosis. 193:328–334. 2007. View Article : Google Scholar : PubMed/NCBI

39 

Zhu Y, Xian X, Wang Z, Bi Y, Chen Q, Han X, Tang D and Chen R: Research progress on the relationship between atherosclerosis and inflammation. Biomolecules. 8:802018. View Article : Google Scholar : PubMed/NCBI

40 

Preiss DJ and Sattar N: Vascular cell adhesion molecule-1: A viable therapeutic target for atherosclerosis? Int J Clin Pract. 61:697–701. 2007. View Article : Google Scholar : PubMed/NCBI

41 

Marzolla V, Armani A, Mammi C, Moss ME, Pagliarini V, Pontecorvo L, Antelmi A, Rosano G, Jaffe IZ and Caprio M: Essential role of ICAM-1 in aldosterone-induced atherosclerosis. Int J Cardiol. 232:233–242. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Nakashima Y, Raines EW, Plump AS, Breslow JL and Ross R: Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothelium in the ApoE-deficient mouse. Arterioscler Thromb Vasc Biol. 18:842–851. 1998. View Article : Google Scholar : PubMed/NCBI

43 

Iiyama K, Hajra L, Iiyama M, Li H, DiChiara M, Medoff BD and Cybulsky MI: Patterns of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ Res. 85:199–207. 1999. View Article : Google Scholar : PubMed/NCBI

44 

Fotis L, Agrogiannis G, Vlachos IS, Pantopoulou A, Margoni A, Kostaki M, Verikokos C, Tzivras D, Mikhailidis DP and Perrea D: Intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 at the early stages of atherosclerosis in a rat model. In Vivo. 26:243–250. 2012.PubMed/NCBI

45 

Yi GW, Zeng QT, Mao XB, Cheng M, Yang XF, Liu HT, Mao Y, Guo M, Ji QW and Zhong YC: Overexpression of CXCL16 promotes a vulnerable plaque phenotype in apolipoprotein E-knockout mice. Cytokine. 53:320–326. 2011. View Article : Google Scholar : PubMed/NCBI

46 

Wuttge DM, Zhou X, Sheikine Y, Wågsäter D, Stemme V, Hedin U, Stemme S, Hansson GK and Sirsjö A: CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor expressed in atherosclerotic lesions. Arterioscler Thromb Vasc Biol. 24:750–755. 2004. View Article : Google Scholar : PubMed/NCBI

47 

Vandooren J, Van den Steen PE and Opdenakker G: Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): The next decade. Crit Rev Biochem Mol Biol. 48:222–272. 2013. View Article : Google Scholar : PubMed/NCBI

48 

Patterson J and Hubbell JA: Enhanced proteolytic degradation of molecularly engineered PEG hydrogels in response to MMP-1 and MMP-2. Biomaterials. 31:7836–7845. 2010. View Article : Google Scholar : PubMed/NCBI

49 

Lindsey ML and Zamilpa R: Temporal and spatial expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases following myocardial infarction. Cardiovasc Ther. 30:31–41. 2012. View Article : Google Scholar : PubMed/NCBI

50 

Van Lint P and Libert C: Chemokine and cytokine processing by matrix metalloproteinases and its effect on leukocyte migration and inflammation. J Leukoc Biol. 82:1375–1381. 2007. View Article : Google Scholar : PubMed/NCBI

51 

Gong Y, Hart E, Shchurin A and Hoover-Plow J: Inflammatory macrophage migration requires MMP-9 activation by plasminogen in mice. J Clin Invest. 118:3012–3024. 2008. View Article : Google Scholar : PubMed/NCBI

52 

Li F, Sun XJ, Xie H, Wang Y and Zhang YK: The relationship between chronic periodontitis and the instability of carotid atherosclerotic plaque by serum level of MMP-9, MCP-1 and MMP-7. Shanghai Kou Qiang Yi Xue. 24:589–593. 2015.(In Chinese). PubMed/NCBI

53 

Loftus IM, Naylor AR, Goodall S, Crowther M, Jones L, Bell PR and Thompson MM: Increased matrix metalloproteinase-9 activity in unstable carotid plaques. A potential role in acute plaque disruption. Stroke. 31:40–47. 2000. View Article : Google Scholar : PubMed/NCBI

54 

Rao VH, Kansal V, Stoupa S and Agrawal DK: MMP-1 and MMP-9 regulate epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells. Physiol Rep. 2:e002242014. View Article : Google Scholar : PubMed/NCBI

55 

Huang Z, Wang L, Meng S, Wang Y, Chen T and Wang C: Berberine reduces both MMP-9 and EMMPRIN expression through prevention of p38 pathway activation in PMA-induced macrophages. Int J Cardiol. 146:153–158. 2011. View Article : Google Scholar : PubMed/NCBI

56 

Gostiljac D, Dorđević PB, Djurić D, Peruničić J, Lasica R, Colak E, Canovic F, Srećković VD, Ilić M and Obrenović R: The importance of defining serum MMP-9 concentration in diabetics as an early marker of the rupture of atheromatous plaque in acute coronary syndrome. Acta Physiol Hung. 98:91–97. 2011. View Article : Google Scholar : PubMed/NCBI

57 

NCD Risk Factor Collaboration (NCD-RisC), . Trends in adult body-mass index in 200 countries from 1975 to 2014: A pooled analysis of 1698 population-based measurement studies with 19·2 million participants. Lancet. 387:1377–1396. 2016. View Article : Google Scholar : PubMed/NCBI

58 

Öörni K, Lehti S, Sjövall P and Kovanen PT: Triglyceride-rich lipoproteins as a source of proinflammatory lipids in the arterial wall. Curr Med Chem. 26:1701–1710. 2019. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao J, Yang M and Wu J: CXCL16 may be a predisposing factor to atherosclerosis: An animal study. Mol Med Rep 24: 716, 2021.
APA
Zhao, J., Yang, M., & Wu, J. (2021). CXCL16 may be a predisposing factor to atherosclerosis: An animal study. Molecular Medicine Reports, 24, 716. https://doi.org/10.3892/mmr.2021.12355
MLA
Zhao, J., Yang, M., Wu, J."CXCL16 may be a predisposing factor to atherosclerosis: An animal study". Molecular Medicine Reports 24.4 (2021): 716.
Chicago
Zhao, J., Yang, M., Wu, J."CXCL16 may be a predisposing factor to atherosclerosis: An animal study". Molecular Medicine Reports 24, no. 4 (2021): 716. https://doi.org/10.3892/mmr.2021.12355
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao J, Yang M and Wu J: CXCL16 may be a predisposing factor to atherosclerosis: An animal study. Mol Med Rep 24: 716, 2021.
APA
Zhao, J., Yang, M., & Wu, J. (2021). CXCL16 may be a predisposing factor to atherosclerosis: An animal study. Molecular Medicine Reports, 24, 716. https://doi.org/10.3892/mmr.2021.12355
MLA
Zhao, J., Yang, M., Wu, J."CXCL16 may be a predisposing factor to atherosclerosis: An animal study". Molecular Medicine Reports 24.4 (2021): 716.
Chicago
Zhao, J., Yang, M., Wu, J."CXCL16 may be a predisposing factor to atherosclerosis: An animal study". Molecular Medicine Reports 24, no. 4 (2021): 716. https://doi.org/10.3892/mmr.2021.12355
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team