Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January 2013 Volume 7 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo

  • Authors:
    • Hui Ma
    • Qing Fan
    • Jia Yu
    • Jile Xin
    • Ce Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Pharmacy, The Second Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116027, P.R. China
  • Pages: 59-64
    |
    Published online on: October 12, 2012
       https://doi.org/10.3892/mmr.2012.1129
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The natural product tanshinone (Tan) induces apoptosis and differentiation in hepatocellular carcinoma (HCC) cells, but its clinical use is limited by its poor water solubility and the lack of appropriate formulations. In this study, Tan was encapsulated into a microemulsion (ME) composed of phospholipid, ethyl oleate, glycerol and Pluronic F68. The anticancer effects and mechanisms of action of Tan ME were tested using in vitro and in vivo HCC models. The mRNA and protein levels of apoptosis related molecules (Bcl-2 and Bax) were analyzed in H22 murine hepatoma cells and H22 tumor-bearing mice by flow cytometry, RT-PCR and immunofluorescence staining. Compared with empty ME and drug solution groups, the mRNA levels of Bax were upregulated and the mRNA and protein levels of Bcl-2 were downregulated in the H22 cells treated with Tan ME in a dose-dependent manner. The mRNA and protein levels of Bax were upregulated and the Bcl-2 levels were downregulated in the H22 tumors of animals treated with Tan ME in a dose-dependent manner. Our results suggest that as a drug delivery system, the ME enhances the antitumor effect of Tan.

Introduction

Hepatocellular carcinoma (HCC) is the sixth most common tumor worldwide but, due to its poor prognosis, it ranks as the third most common cause of mortality from cancer (1). Surgical therapy, chemotherapy and radiation have been used for the treatment of HCC. However, HCC remains one of the more difficult cancers to treat. Although chemotherapy is a common therapeutic strategy following surgery, it is toxic to normal tissues and this limits its use (2). Therefore, it is important to develop safer and more effective drugs for the treatment of HCC.

Danshen has been used to treat various diseases, including heart disease, hepatitis and cancer, in China for a long time (3). Tanshinone (Tan) is the major lipid-soluble pharmacological constituent of danshen (4). The diterpenoid Tan, which includes Tan I, Tan IIA, Tan IIB, dihydrotanshinone I and cryptotanshinone, has also roused extensive attention. Tanshinones have a variety of biological activities. For example, Tan I is able to enhance learning and memory, while Tan IIA has antioxidative, anti-inflammatory, antiproliferative and antitumor properties (5,6). Previous studies have shown that Tan IIA possesses cytotoxic activity against multiple human cancer cells, inducing apoptosis and differentiation in certain human cancer cells, including HeLa and colo205 cells (7,8). However, the applications of Tan have been limited due to its poor solubility, instability and low bioavailability. The poor water solubility is likely to induce opsonization and cause rapid clearance from the blood circulation following intravenous injection. Therefore, there is a need for a better drug delivery system (DDS) for Tan.

Numerous methods have been used to improve the absorption and bioavailability of poorly water-soluble drugs. One of the more attractive types of system is a microemulsion (ME) which is composed of fine oil-in-water droplets in an aqueous medium (9). As a DDS approach, MEs are clear, stable, isotropic mixtures of oil, water and surfactant, frequently in combination with a cosurfactant (10). MEs offer an interesting and potentially quite powerful alternative carrier system for drug delivery due to their high solubilization capacity, transparency, thermodynamic stability, ease of preparation and high diffusion and absorption rates when compared with solvents without the surfactant system (11).

In the present study, Tan was encapsulated into an ME to provide a Tan ME formulation. The apoptosis- and differentiation-inducing effects of Tan ME were investigated in H22 cells in vitro and in vivo.

Materials and methods

Chemicals and reagents

Tan was purchased from Chiatai Qingchunbao Pharmaceutical Co., Ltd. (Hangzhou, China). 5-Fluorouracil (5-Fu) was purchased from Tianjin Jinyao Amino Acid Co., Ltd. (Tianjin, China). RPMI-1640, FBS and penicillin-streptomycin were purchased from Hyclone Corporation (Logan, UT, USA). Rabbit anti-mouse Bax polyclonal and mouse anti-human Bcl-2 monoclonal antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). FITC-conjugated goat anti-mouse IgG and TRITC-conjugated goat anti-mouse IgG were purchased from KPL Inc. (Gaithersburg, MD, USA). TRIzol reagent was purchased from Invitrogen Life Technologies (Carlsbad, CA, USA). The Takara RNA PCR kit (AMV) Ver3.0 was purchased from Takara Biotechnology Co., Ltd. (Dalian, China).

Animals and cell lines

H22 murine hepatoma cells were purchased from the Department of Pathology, Dalian Medical University. Male and female Balb/c mice, weighing 20.0±2.0 g, were obtained from the Animal Facility of Dalian Medical University. The animals were maintained in a room with a controlled environment (12-h light/dark cycle, 24±2°C). They were also given free access to standard laboratory diet and water. All experiments were approved by the Animal Research Ethics Committee of Dalian Medical University.

Preparation of Tan ME

According to our previous study (12), 160 mg Tan was dissolved in 38 g ethyl oleate using ultrasound, to form the oil phase of the ME. A mixture of 5.4 g phospholipid, 6 g glycerol, 10.6 g pluronic F68 and 140 ml sterile water formed the aqueous phase of the ME. The oil and aqueous phases were heated to 65°C. The oil phase was added to the aqueous phase with magnetic stirring (Diamond, Jin Tian, China). The obtained emulsion was sheared using a high shearing emulsifier (FLUKO, Essen, Germany) for 5 min; an amount of water was then added to compensate for that lost by evaporation. The ME was emulsified further using a high pressure homogenizer (Mizuho, Osaka, Japan) under 85 MPa for 10 min and filtered through a 0.45-μm filter membrane. The ME was transferred to a 1-ml ampoule, sealed with N2 and flow steam sterilized for 20 min.

Cell culture and chemical treatment

H22 cells were routinely cultured in RPMI-1640 medium with 10% (v/v) FBS, penicillin (100 U/ml) and streptomycin (100 U/ml) at 37°C in a humidified 5% CO2 incubator. Exponentially growing cells were exposed to 0.2 or 0.8 μg/ml concentrations of Tan ME for 48 h. The control groups were cells grown in medium containing an equivalent amount of empty ME or Tan solution.

Measurement of Bcl-2 expression by flow cytometry (FCM)

FCM was performed as reported previously (13). At least 5,000 events were collected for each sample and washed with phosphate-buffered saline (PBS). After centrifugation, the cell pellet was resuspended in the fixation/permeabilization solution at 4°C for 15 min. The cells were then incubated with the mouse anti-human Bcl-2 monoclonal antibody at 4°C for 20 min in the dark. After washing twice in PBS, the cells were incubated with the FITC-conjugated goat anti-mouse IgG at 4°C for 20 min in the dark. After washing twice in PBS, the cells were analyzed using a FACScan flow cytometer and Cell Quest software (BD Biosciences, San Jose, CA, USA).

RT-PCR assay

Total RNA was extracted from the tumor tissues or cells using TRIzol reagent. The quality and concentration of the RNA were confirmed by spectrophotometry and electrophoresis on ethidium bromide-stained agarose gels. The RT-PCR amplification was performed using the Takara RNA PCR kit (AMV) Ver 3.0. The specific primers and the amplification conditions are shown in Table I. The initial denaturation step for all genes was set at 94°C for 5 min. Finally, an additional extension step at 72°C for 5 min was performed. The PCR products were analyzed by electrophoresis on a 3% agarose gel with EB staining using a Gel-Pro analyzer (UVP, Upland, CA, USA).

Table I

Primer sequences for PCR and amplification conditions for each target gene.

Table I

Primer sequences for PCR and amplification conditions for each target gene.

Gene namePrimer sequence (5′ to 3′)Product (base)Amplification conditions
BaxF: CGGCGAATTGGAGATGAACTG
R: GCAAAGTAGAAGAGGGCAACC
161Bax: Denaturation at 94°C for 1 min, annealing at 60°C for 1 min and synthesizing at 72°C for 30 sec for 35 cycles
Bcl-2F: TACCGTCGTGACTTCGCAGAG
R: GGCAGGCTGAGCAGGGTCTT
350Bcl-2 and β-actin: Denaturation at 94°C for 1 min, annealing at 62°C for 1 min and synthesizing at 72°C for 1 min for 35 cycles
β-actinF: TACCACAGGCATTGTGATGG
R: AATAGTGATGACCTGGCCGT
310
Animals and experimental protocol

The H22 cells were collected from the ascites of the mice 8 days after inoculation to prepared a cell suspension of concentration 5.0×106/ml. The Balb/c mice received a subcutaneous injection of H22 cells (1.0×106 in 0.2 ml) in the right axillary region (14). From the second day after inoculation, the Balb/c mice were randomly divided into 6 groups (10/group; half male and half female). There were 3 Tan ME treatment groups comprising 3 intravenous (i.v.) dose levels (2, 4 and 8 mg/kg); a positive control group treated with 5-Fu [25 mg/kg, intraperitonealy (i.p.)]; a negative control group which received an i.v. injection of empty ME; and a Tan control group which received a solution of Tan at an i.v. dose of 8 mg/kg. The treatments were given daily for 7 consecutive days. Prior to each treatment, the mice were weighed. At the end of the experiment, all mice were sacrificed by dislocation and the body, tumor and spleen weights were determined. The tissue samples were stored at −80°C until analysis. The tumor inhibition rate and spleen index were calculated as follows: inhibition rate (%) = (1 - tumor weight of test group/tumor weight of Tan solution group) ×100; spleen index = spleen weight (mg)/body weight (g).

Immunofluorescence staining

Double immunofluorescence staining was performed as described previously (6,15). Tumor tissues were removed immediately en bloc and post-fixed for 24 h in 4% paraformaldehyde in PBS at 4°C before cryoprotection by bathing in 30% sucrose. They were then frozen and 6-8-μm sections were prepared using a cryostat (Leica CM1850; Mannheim, Germany). The sections were rinsed with PBS 3 times for 5 min each, covered with 1% SDS solution and then incubated for 5 min at room temperature. After rinsing with PBS 3 times for 5 min each, the sections were treated with 0.3% Triton X-100, blocked with 10% horse serum and then incubated with mouse anti-human Bcl-2 monoclonal antibody (1:75) and rabbit anti-mouse Bax polyclonal antibody (1:75) at 4°C overnight. After a PBS wash, the slides were incubated with the FITC-conjugated goat anti-mouse IgG (1:75) and TRITC-conjugated goat anti-mouse IgG (1:75) for 1 h at room temperature. The nuclei were stained with DAPI. The images of double-immunostained sections were acquired with a fluorescence microscope (Nikon, TE2000U, Tokyo, Japan).

Statistical analysis

The results are expressed as the means ± SD. Comparisons of each group were performed by one-way analysis of variance (ANOVA) using SPSS 13.0 software. P<0.05 was considered to indicate a statistically significant result.

Results

Tan ME induces morphological changes in H22 cells

Under an inverted light microscope, empty ME-treated and Tan solution-treated H22 cells grew well and the cell skeletons were clear. The majority of cells treated with 0.2 or 0.8 μg/ml Tan ME for 48 h were broken and necrosed (Fig. 1).

Figure 1

Tanshinone microemulsion (Tan ME) induced morphological changes in H22 cells. (A) Empty ME; (B) Tan solution (0.8 μg/ml); (C) Tan ME (0.2 μg/ml); (D) Tan ME (0.8 μg/ml). Bar, 40 μm.

Tan ME downregulates Bcl-2 protein levels in vitro

The effects of the different treatments on Bcl-2 protein levels were evaluated by FCM analysis (Fig. 2). High levels of the Bcl-2 protein were detected by FCM 48 h after empty ME treatment and the Tan solution-treated group had markedly decreased Bcl-2 protein levels compared with the empty ME-treated group. Tan ME decreased Bcl-2 protein levels markedly compared with those of the Tan solution-treated group, in a dose-dependent manner (P<0.01).

Figure 2

Effects of tanshinone microemulsion (Tan ME) on Bcl-2 expression in H22 cells. (a) Representative flow cytometry data. (b) Quantitative data. (A) Empty ME; (B) Tan solution (0.8 μg/ml); (C) Tan ME (0.2 μg/ml); (D) Tan ME (0.8 μg/ml). **P<0.01 compared with the Tan solution group.

Tan ME downregulates Bcl-2 mRNA levels and upregulates Bax mRNA levels in vitro

Using semi-quantitative RT-PCR, we first examined the effects of Tan ME on the mRNA levels of Bcl-2 and Bax in cultured H22 cells. As shown in Fig. 3, Bax mRNA expression levels were low in the Tan solution group, but 0.2 and 0.8 μg/ml Tan ME increased the mRNA levels of Bax. In the Tan solution group, Bcl-2 mRNA was highly detectable and 0.2 and 0.8 μg/ml Tan ME markedly decreased the levels of Bcl-2 mRNA (P<0.001).

Figure 3

Effects of tanshinone microemulsion (Tan ME) on Bax and Bcl-2 mRNA levels in vitro. (a) Representative RT-PCR results. (b) Quantitative data mean+SD, ***P<0.001 compared with the level of Bax mRNA in the Tan solution group; ###P<0.001 compared with the level of Bcl-2 mRNA in the Tan solution group. Lane 1, empty ME; lane 2, Tan ME (0.2 μg/ml); lane 3, Tan ME (0.8 μg/ml); lane 4, Tan solution (0.8 μg/ml).

Tan ME inhibits tumor growth in vivo

The treatment with 8 mg/kg Tan ME demonstrated significant inhibitory effects on the growth of the inoculated H22 cells in the mice; the inhibition rate was 47.66%. No significant differences in the tumor growth between the 2 and 4 mg/kg Tan ME-treated groups and the Tan solution-treated group were observed (Table II). As a positive control, 5-Fu (25 mg/kg) significantly inhibited tumor growth but it also decreased the mean body weight and spleen index of the mice (Figs. 4 and 5).

Figure 4

Images of spleens from the treated rats. Bar, 1 cm. Tan, tanshinone; ME, microemulsion.

Figure 5

Images of tumors from the treated rats. Bar, 1 cm. Tan, tanshinone; ME, microemulsion.

Table II

Effects of body weight, spleen index and inhibition rate for H22 hepatic carcinoma in mice treated with Tan ME.

Table II

Effects of body weight, spleen index and inhibition rate for H22 hepatic carcinoma in mice treated with Tan ME.

GroupDose (mg/kg)Body weight (g)Spleen index (mg/g)Tumor weight (g)Inhibition rate (%)

Pre-medicationPost-medication
Empty ME820.10±1.9322.75±2.058.01±0.701.12±0.18-
5-Fu2520.48±1.56a17.98±1.883.65±0.40b0.37±0.07b65.79
Tan solution817.87±0.5121.20±2.658.10±1.241.08±0.30-
219.40±1.1522.20±4.399.93±1.351.09±0.17−0.89
Tan ME419.93±1.7921.93±3.568.93±0.481.01±0.126.33
818.45±1.0819.60±2.269.60±1.120.56±0.08a47.66

{ label (or @symbol) needed for fn[@id='tfn1-mmr-07-01-0059'] } n=10 per group; mean ± SD. Tan, tanshinone; ME, microemulsion; 5-Fu, 5-fluorouracil.

a P<0.05,

b P<0.01 vs. the Tan solution group.

Tan ME treatment downregulates Bcl-2 and upregulates Bax mRNA levels in H22 tumors in vivo

As shown in Fig. 6, Tan ME increased Bax mRNA levels in a dose-dependent manner (P<0.001). Compared with the Tan solution-treated group, the Bcl-2 mRNA levels were significantly decreased in the tumors from the mice treated with 2 mg/kg Tan ME (P<0.01) or 4 or 8 mg/kg Tan ME (P<0.001).

Figure 6

Effects of tanshinone microemulsion (Tan ME) on Bax and Bcl-2 mRNA levels in H22 tumors in vivo. (a) Representative RT-PCR results. (b) Quantitative data mean+SD, ***P<0.001, ##P<0.01, ###P<0.001 compared with the level of Bcl-2 mRNA in the Tan solution group. Lane 1, empty ME; lane 2, Tan ME (2 mg/kg); lane 3, Tan ME (4 mg/kg); lane 4, Tan ME (8 mg/kg); lane 5: 5-fluorouracil (5-Fu; 25 mg/kg); lane 6, Tan solution (8 mg/kg).

Tan ME treatment modulates the distributions of Bcl-2 and Bax in H22-transplanted tumors

We found little staining of Bax and strong staining of Bcl-2 in the Tan solution-treated tumor tissue by immunohistochemistry. Compared with the Tan solution group, 4 and 8 mg/kg Tan ME markedly increased Bax and decreased Bcl-2 in a dose-dependent manner (Fig. 7).

Figure 7

Double immunofluorescence for Bax and Bcl-2 with DAPI counterstaining in the cytoplasms of H22-transplanted tumors. The localization of Bax and Bcl-2 in the cytoplasms of the H22-transplanted tumors was analyzed by immunostaining with TRITC-labeled anti-rabbit IgG against rabbit anti-Bax antibody and FITC-labeled anti-mouse IgG against mouse anti-Bcl-2 antibody. Nuclei were stained with DAPI. Bax immunostaining appeared red, Bcl-2 immunostaining appeared green and DAPI staining appeared blue. Bar, 40 μm. Tan, tanshinone; ME, microemulsion.

Discussion

In our study, Tan was encapsulated into an ME. Phospholipid, ethyl oleate, glycerol and pluronic F68 are biocompatible components of the Tan ME that can be safely used for i.v. injection (16,17). The surfactant enhances the permeability of the ME. Our previous study found that empty ME itself had effects on tumor cells (12). Therefore, in the present study, we used two control groups, an empty ME group and a Tan solution group. The results showed that there was no significant difference between the empty ME and Tan solution groups, but there were significant dose-dependent differences in the three Tan ME-treated groups, demonstrating that the ME enhances the antitumor effect of Tan.

As a positive control, 5-Fu had a significant inhibitory effect on the growth of the inoculated H22 cells in mice (the inhibition rate was 65.79%) but it significantly decreased the body weight and spleen index of the mice. Compared with the empty ME and Tan solution groups, Tan ME had no significant effects on spleen index and body weight, indicating that Tan ME caused no major side effects in the mice.

It is now well established that apoptosis is a complex biological process involving many pathways. The activation of apoptosis pathways is a key mechanism by which cytotoxic drugs kill tumor cells (18). The induction of apoptosis is now considered to be an important method for the assessment of the clinical effectiveness of antitumor drugs (19). Certain evidence suggests that one of the most important regulators of the apoptotic pathway is the Bcl-2 family of genes, including Bcl-2 and Bax genes (20). One mechanism in the cell death program is the upregulation of the proapoptotic Bax protein. An increase in Bax expression levels effects a change in the permeability of mitochondrial membranes. This leads to the release of cytochrome c and the activation of caspases, which finally proteolyze cellular components. Bcl-2 is one of the key genes known to downregulate Bax and p53 and therefore has the potency to inhibit this apoptotic pathway (21). Su and Lin found that Tan IIA inhibited the proliferation of MDA-MB-231 cells in a dose- and time-dependent manner. One of the mechanisms may be through the upregulation of the expression of Bax and the downregulation of Bcl-2 expression and the induction of apoptosis (22).

In conclusion, we demonstrate that, as a drug delivery system, the ME enhances the antitumor effect of Tan. Tan ME had significant anticancer effects in vitro and in vivo, providing a basis for the further development of this novel formulation for a new class of anticancer drugs.

Acknowledgements

This study was supported by a grant from the Key Science and Technology Program of Liaoning Province, China (Grant No. 2005225013-9).

References

1 

Voiculescu M, Winkler RE, Moscovici M and Neuman MG: Chemotherapies and targeted therapies in advanced hepatocellular carcinoma: from laboratory to clinic. J Gastrointestin Liver Dis. 17:315–322. 2008.PubMed/NCBI

2 

Zhang HT, Luo H, Wu J, et al: Galangin induces apoptosis of hepatocellular carcinoma cells via the mitochondrial pathway. World J Gastroenterol. 16:3377–3384. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Tian HL, Yu T, Xu NN, et al: A novel compound modified from tanshinone inhibits tumor growth in vivo via activation of the intrinsic apoptotic pathway. Cancer Lett. 297:18–30. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Du JR, Li X, Zhang R and Qian ZM: Tanshinone inhibits intimal hyperplasia in the ligated carotid artery in mice. J Ethnopharmacol. 98:319–322. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Kai G, Xu H, Zhou C, et al: Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab Eng. 13:319–327. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Brown D, Lydon J, McLaughlin M, Stuart-Tilley A, Tyszkowski R and Alper S: Antigen retrieval in cryostat tissue sections and cultured cells by treatment with sodium dodecyl sulfate (SDS). Histochem Cell Biol. 105:261–267. 1996. View Article : Google Scholar : PubMed/NCBI

7 

Su CC and Lin YH: Tanshinone IIA down-regulates the protein expression of ErbB-2 and up-regulates TNF-α in colon cancer cells in vitro and in vivo. Int J Mol Med. 22:847–851. 2008.PubMed/NCBI

8 

Zhou L, Chan WK, Xu N, et al: Tanshinone IIA, an isolated compound from Salvia miltiorrhiza Bunge, induces apoptosis in HeLa cells through mitotic arrest. Life Sci. 83:394–403. 2008.PubMed/NCBI

9 

Han DH, Jin ZH, Jin YZ, Yin XZ, Shen YY and Gao ZG: Thermal reversible microemulsion system for poorly water-soluble YH439 for oral delivery. Chem Pharm Bull (Tokyo). 58:11–15. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Lawrence MJ and Rees GD: Microemulsion-based media as novel drug delivery systems. Adv Drug Deliv Rev. 45:89–121. 2000. View Article : Google Scholar : PubMed/NCBI

11 

Jadhav KR, Shaikh IM, Ambade KW and Kadam VJ: Applications of microemulsion based drug delivery system. Curr Drug Deliv. 3:267–273. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Fan Q, Fan GJ, Yang PM and Zhao JY: Effect of tanshinone microemulsion on reversing MDR in human tumor cells. Zhongguo Zhong Yao Za Zhi. 29:1079–1081. 2004.(In Chinese).

13 

Cibelli M, Fidalgo AR, Terrando N, et al: Role of interleukin-1beta in postoperative cognitive dysfunction. Ann Neurol. 68:360–368. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Yan D, Bao HY, Bau T, Li Y and Kim YH: Antitumor components from Naematoloma fasciculare. J Microbiol Biotechnol. 19:1135–1138. 2009.

15 

Sawada K, Kalam-Azad A, Sakata-Haga H, Lee NS, Jeong YG and Fukui Y: Striking pattern of Purkinje cell loss in cerebellum of an ataxic mutant mouse, tottering. Acta Neurobiol Exp (Warsaw). 69:138–145. 2009.PubMed/NCBI

16 

Nornoo AO, Osborne DW and Chow DS: Cremophor-free intravenous microemulsions for paclitaxel I: formulation, cytotoxicity and hemolysis. Int J Pharm. 349:108–116. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Tsai YH, Hsieh YH, Huang YB, Chang JS, Huang CT and Wu PC: Microemulsions for intravesical delivery of gemcitabine. Chem Pharm Bull (Tokyo). 58:1461–1465. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Debatin KM: Apoptosis pathways in cancer and cancer therapy. Cancer Immunol Immunother. 53:153–159. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Liu XD, Fan RF, Zhang Y, et al: Down-regulation of telomerase activity and activation of caspase-3 are responsible for tanshinone I-induced apoptosis in monocyte leukemia cells in vitro. Int J Mol Sci. 11:2267–2280. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Wang W, Guo QL, You QD, et al: The anticancer activities of wogonin in murine sarcoma S180 both in vitro and in vivo. Biol Pharm Bull. 29:1132–1137. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Kernt M, Neubauer AS, Eibl KH, et al: Minocycline is cytoprotective in human trabecular meshwork cells and optic nerve head astrocytes by increasing expression of XIAP, survivin, and Bcl-2. Clin Ophthalmol. 4:591–604. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Su CC and Lin YH: Tanshinone IIA inhibits human breast cancer cells through increased Bax to Bcl-xL ratios. Int J Mol Med. 22:357–361. 2008.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma H, Fan Q, Yu J, Xin J and Zhang C: Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo. Mol Med Rep 7: 59-64, 2013.
APA
Ma, H., Fan, Q., Yu, J., Xin, J., & Zhang, C. (2013). Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo. Molecular Medicine Reports, 7, 59-64. https://doi.org/10.3892/mmr.2012.1129
MLA
Ma, H., Fan, Q., Yu, J., Xin, J., Zhang, C."Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo". Molecular Medicine Reports 7.1 (2013): 59-64.
Chicago
Ma, H., Fan, Q., Yu, J., Xin, J., Zhang, C."Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo". Molecular Medicine Reports 7, no. 1 (2013): 59-64. https://doi.org/10.3892/mmr.2012.1129
Copy and paste a formatted citation
x
Spandidos Publications style
Ma H, Fan Q, Yu J, Xin J and Zhang C: Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo. Mol Med Rep 7: 59-64, 2013.
APA
Ma, H., Fan, Q., Yu, J., Xin, J., & Zhang, C. (2013). Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo. Molecular Medicine Reports, 7, 59-64. https://doi.org/10.3892/mmr.2012.1129
MLA
Ma, H., Fan, Q., Yu, J., Xin, J., Zhang, C."Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo". Molecular Medicine Reports 7.1 (2013): 59-64.
Chicago
Ma, H., Fan, Q., Yu, J., Xin, J., Zhang, C."Anticancer activities of tanshinone microemulsion against hepatocellular carcinoma in vitro and in vivo". Molecular Medicine Reports 7, no. 1 (2013): 59-64. https://doi.org/10.3892/mmr.2012.1129
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team