Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
June-2014 Volume 31 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2014 Volume 31 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma

  • Authors:
    • Wei Kang
    • Joanna H.M. Tong
    • Anthony W.H. Chan
    • Junhong Zhao
    • Shiyan Wang
    • Yujuan Dong
    • Frankie M.C. Sin
    • Saifung Yeung
    • Alfred S.L. Cheng
    • Jun Yu
    • Kafai To
  • View Affiliations / Copyright

    Affiliations: Department of Anatomical and Cellular Pathology, State Key Laboratory in Oncology in South China, Prince of Wales Hospital, The Chinese University of Hong Kong, Hong Kong SAR, P.R. China, Institute of Digestive Disease, Partner State Key Laboratory of Digestive Disease, Sir Y.K. Pao Cancer Center, The Chinese University of Hong Kong, Hong Kong SAR, P.R. China, School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong SAR, P.R. China
  • Pages: 2579-2586
    |
    Published online on: April 23, 2014
       https://doi.org/10.3892/or.2014.3148
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric adenocarcinoma. We observed the upregulation of RRM2 mRNA and protein in all nine gastric cancer cell lines examined. In paired primary gastric cancers, both mRNA and protein levels of RRM2 were significantly upregulated in tumors compared with the corresponding non-tumorous gastric tissues. RRM2 protein expression correlated with higher tumor grade, advanced T stage and poor disease-specific survival. RRM2 knockdown in gastric cancer cell lines AGS, MKN1 and MKN28 significantly suppressed cell proliferation, inhibited monolayer colony formation, reduced cell invasion and induced apoptosis. Downregulation of RRM2 suppressed xenograft formation in vivo. Collectively, these findings suggest that RRM2 plays a crucial role in gastric tumorigenesis and may serve as a potential prognostic marker and therapeutic target in gastric cancer.

Introduction

Gastric cancer remains one of the most aggressive types of cancer in the world. The highest incidence is in eastern Asia, in China, Japan and Korea and South America and Eastern Europe (1–2). When presented, most cases are in the advanced stage. Despite the advancements in various treatment modalities, prognosis remains poor (3). Enhancing our understanding of the carcinogenetic process (4) and exploring new treatment options are important to improve the outlook of gastric cancer patients. Gastric carcinogenesis is a multistep process involving genetic and epigenetic alterations of protein-coding proto-oncogenes (5) and tumor-suppressor genes (6–7). In addition, recent studies have demonstrated the involvement of microRNAs (8) and emerging evidence underscores the importance of signaling pathways such as NF-κB, Wnt/β-catenin signaling and Notch signaling involved in the gastric cancer development (9).

Human ribonucleotide reductase (RR) is an enzyme that catalyzes the conversion of ribonucleotide 5′-diphosphates into 2′-deoxyribonucleotides which is essential for DNA synthesis and cell proliferation (10,11). RR consists of two subunits, RRM1 and RRM2. These two subunits are encoded by two distinctive genes on different chromosomes, and their mRNAs are differentially expressed throughout the cell cycle. The cellular RRM1 protein level is stabilized throughout the entire cell cycle, whereas RRM2 is only expressed during the late G1/early S phase when DNA replication occurs (12). Therefore the catalytic activity of RR is tightly controlled during the cell cycle by the level of RRM2.

Given the critical role of RR in cell growth, it has been considered as a potential therapeutic target for cancer therapy. RRM2 contributes to malignant cellular phenotype in a range of human cancers and its overexpression plays a critical role in tumor invasion (13,14). A previous study showed that sequence-specific small interfering RNA (siRNA)- mediated inhibition of RRM2 effectively blocked the cell proliferation and induced G1/S phase cell cycle arrest in melanoma cell lines (15). However, the biological functions of RRM2 in gastric cancer remain unclear. The present study investigated the tumorigenic role of RRM2 in gastric cancer.

Materials and methods

Cell lines and clinical gastric adenocarcinoma samples

The ten gastric cancer cell lines (MKN28, KATO-III, MKN45, SNU16, SNU1, MKN7, MKN1, NCI-N87, AGS and MGC-803) (16), were cultured in RPMI-1640 (Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco), 100 U/ml penicillin and 10 μg/ml streptomycin in a humidified atmosphere of 5% CO2 at 37°C.

Archival tissue blocks from 270 patients with gastric adenocarcinoma were retrieved from the Department of Anatomical and Cellular Pathology, Prince of Wales Hospital (PWH), Hong Kong, and arranged in tissue array blocks. Hematoxylin and eosin-stained sections were used to define tumor areas, and 3 representative 1-mm cores were obtained from each case and inserted to a recipient paraffin block using a tissue arrayer (Beecher Instruments, Silver Spring, MD, USA). Frozen tissues from another ten pairs of primary gastric cancer and non-tumorous gastric mucosa were collected from patients who underwent gastrectomy prior to any therapeutic intervention. In addition, 27 paired gastric cancer and non-tumorous gastric frozen tissue cDNAs were kindly provided by the Institute of Digestive Disease (IDD) of Prince Wales Hospital for RRM2 qRT-PCR analysis.

RNA extraction and qRT-PCR

Total RNA was extracted using RNeasy Mini Kit according to the manufacturer’s instructions (Qiagen) and the concentration was measured by NanoDrop 1000 (Thermo Fisher Scientific). High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems) were applied to achieve cDNAs. For qRT-PCR, SYBR-Green PCR Master Mix (Applied Biosystems) was applied for RRM2 expression (sense, GAAGGCAGAGGCTTCCTTTT and antisense, TACTATGCCATCGCTTGCTG). Commercially available normal gastric mRNA was obtained from Ambion (AM 7996). The relative expression level was normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and calculated using the 2−ΔΔCt method. Quantitative PCR was performed in triplicates.

Immunohistochemical staining

Immunohistochemical staining of RRM2 was performed in 4 μm sections. After de-waxing in xylene, rehydrating and rinsing in distilled water, sections were incubated at 3% H2O2 solution for 25 min to block endogenous peroxidase activities. Antigen retrieval was carried out by using a pressure cooker with 10 nM citrate buffer (pH 6.0) for a total of 30 min (high power 10 min followed by low power 20 min). The primary antibody RRM2 (Santa Cruz, 10846; 1:50 dilution in primary dilution buffer) was incubated at 4°C overnight and chromogen development was performed using the standard avidin-biotin method (Dako). The cytoplasmic expression of RRM2 was assessed by combining the proportional score and the intensity score as previously described (16). The proportion score was calculated according to the proportion of tumor cells with positive cytoplasmic staining (0, none; 1, ≤10%; 2, ≤25%; 3, >25%; 4, >50%). The intensity score was assigned for the average intensity of positive tumor cells (0, none; 1, weak; 2, intermediate; 3, strong). The cytoplasmic score of RRM2 was the product of the proportion and intensity scores, ranging from 0 to 12. The cytoplasmic expression was categorized into negative (score 0), 1+ (score 1–3), 2+ (score 4–6) and 3+ (score 7–12).

Western blot analysis

Western blot analysis was performed as previously described (17). RRM2 protein was detected with a polyclonal anti-RRM2 antibody (Santa Cruz, 10846, 1:500). Other antibodies were from Cell Signaling, cleaved-caspase 3 (Asp175) (no. 9541, 1:1,000), cleaved PARP (Asp214) (no. 9541, 1:1000), p-P44/42(T202/Y204) (no. 9154, 1:1,000), p-P38MAPK(T180/Y182) (no. 4511, 1:1,000), phospho-AKT(S473) (no. 9271, 1:1,000), phospho-Stat3 (T705) (no. 9145, 1:2,000), anti-Mouse IgG-HRP (Dako, 00049039, 1:30,000) and anti-Rabbit IgG-HRP (Dako, 00028856, 1:40,000).

In vitro functional assays

Transfection was performed using Lipofectamine 2000 transfection reagent (Invitrogen) and the anti-RRM2 siRNA (verified siRNA, SI02653441; Qiagen) at the concentration of 25 nM. Mock transfection (Lipofectamine 2000 only) and scramble siRNA were included as controls. Cell proliferation was assessed using CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT; Promega, Madison, WI, USA) according to the manufacturer’s instructions. Monolayer colony formation assay was performed as described in our previous report (17). Ten days after transfection of siRRM2 or scramble siRNA, the colonies were fixed and stained with 2% crystal violet. Colonies with >50 cells were counted. The experiments were performed in triplicate wells and repeated 3 times. Cell invasion assay was performed in a 24-well invasion chamber (BD Biocoat Matrigel Invasion Chamber, BD Biosciences). siRRM2 or scramble siRNA transfectants were seeded at 5×104 cells/well and allowed to invade for 24 h through BD Biocoat Matrigel Invasion Chambers. Cells that invaded through the Matrigel membrane were counted from 3 microscopic fields (original magnification, ×400).

Flow cytometry analysis

For cell cycle analysis, the cells were harvested 24 h after transfection, stained with propidium iodide (PI), and sorted by FACS Calibur Flow Cytometer (Becton, Dickinson, San Diego, CA, USA). The cell cycle profiles were determined using the ModFitLT software (Becton-Dickinson). For early apoptosis analysis, Annexin V-FITC Apoptosis Detection Kit (BioVision, Milpitas, CA, USA) and 7-Amino-actinomycin (7-AAD, KeyGEN BioTECH) were used according to the manufacturer’s instructions.

In vivo animal study

MGC-803 cells transfected with si-scramble or siRRM2 were injected subcutaneously into the dorsal flank of five 4-week-old male Balb/c nude mice (si-scramble on the left and siRRM2 on the right). When the tumors were palpable after 8 days, the synthetic siRNA complex (25 nM) with siPORT amine transfection reagent (Ambion) in 50 μl PBS was delivered intratumorally at 3-day intervals. The mice were sacrificed after 3 weeks and the xenografts were collected.

Statistical analysis

In the functional assays such as MTT proliferation, monolayer colony formation, cell invasion and in vivo tumor growth, Student’s t-test was used to compare the phenotype difference of siRRM2 knockdown cells and si-scramble transfected cells. RRM2 mRNA expression in gastric cancer and paired non-cancerous tissues were compared by the Mann-Whitney U test. Correlations between RRM2 expression with other clinicopathological parameters were evaluated by non-parametric Spearman’s rho rank test. The Kaplan-Meier method was used to estimate the survival rates according to the score of RRM2 cytoplasmic staining. For those statistically significant variables found in the univariate survival analysis (P<0.05), the multivariate survival was achieved by the Cox regression analysis. All statistical analysis was performed by SPSS software (version 16.0; SPSS Inc). A two-tailed P-value <0.05 was considered to indicate statistically significant differences.

Results

Upregulation of RRM2 in gastric cell lines and primary gastric tumors

The RRM2 mRNA expression levels were higher in all nine gastric cancer cell lines examined compared to the normal gastric tissue as shown in Fig. 1A. The upregulation of RRM2 in the gastric cancer cells was further confirmed by western blot analysis. High RRM2 protein expression was observed in all gastric cancer cell lines compared with the 2 normal gastric mucosal samples from patients who underwent weight reduction gastric surgery (Fig. 1B). In the panel of gastric cancer cell lines, RRM2 was strongly expressed in Kato-III, SNU16, SNU1 and AGS cell lines. When comparing tumor with the corresponding non-tumorous mucosa, upregulation of RRM2 protein was observed in 8/10 cases by western blot analysis (Fig. 1C). We further evaluated the RRM2 mRNA expression in a cohort of 27 pairs of gastric cancer and corresponding non-tumorous mucosa. Expression of RRM2 in tumor cells was significantly higher than in non-tumorous mucosal tissues (P=0.035, Fig. 1D). Immunohistochemical analysis of another 5 pairs of gastric cancer samples showed positive staining of RRM2 in all tumor tissues but not in the non-tumorous gastric glandular epithelium (data not shown).

Figure 1

RRM2 upregulation in gastric cancer cell lines and primary gastric tumors. (A) RRM2 mRNA expression in 9 gastric cancer cell lines compared with normal gastric mRNA commercially available from Ambion (AM 7996). The experiment was performed in triplicates. (B) RRM2 protein expression in gastric cancer cell lines and 2 normal gastric mucosal tissues from patients with weight reduction gastric surgery. (C) Western blotting of RRM2 in 10 pairs of gastric tumors (T) and the corresponding non-tumorous mucosa (N). (D) Dot plot of qRT-PCR results from RRM2 mRNA expression level in 27 pairs of gastric adenocarcinoma and the corresponding non-tumorous mucosa (P=0.035). RRM2, ribonucleotide reductase M2 subunit.

RRM2 overexpression correlates with poor prognosis in gastric cancer patients

We studied the expression of RRM2 by immunohistochemistry in a cohort of 270 primary gastric adenocarcinoma samples. The cytoplasmic expression of RRM2 was assessed by assigning a proportional score and an intensity score as described in Materials and methods. No RRM2 expression (score 0) was observed in 14 cases (5.2%), weak cytoplasmic expression (score 1+) was observed in 98 cases (36.3%), and 116 cases (42.9%) and 42 cases (15.6%) demonstrated moderate (score 2+) and strong (score 3+) cytoplasmic staining, respectively. A total of 112 cases (41.5%) were considered negative/low expression of RRM2 (score 0 and 1+), whereas 158 cases (58.5%) with scores 2+ and 3+ were considered strongly positive for RRM2. Expression of RRM2 was primarily localized in the cytoplasm of the tumor cells (Fig. 2A). The association of RRM2 expression with clinicopathological parameters is shown in Table I. Strong RRM2 expression correlated with higher tumor grade (P=0.010) and advanced T stage (P=0.025). Univariate analysis indicated that expression of RRM2 in gastric adenocarcinoma associated with poorer disease-specific survival (P=0.012, Fig. 2B). Old age (age, >60 years, P=0.043), diffuse type histology (P<0.001), higher tumor grade (P=0.035) and advanced stage (P<0.001) were also correlated with poor disease-specific survival by Univariate analysis (Table II). Using multivariate Cox proportional hazards regression analysis, only age (P<0.001) and stage (P<0.001) were independently associated with disease-specific survival (Table II).

Figure 2

RRM2 upregulation correlates with poor prognosis. (A) Representative images of RRM2 immunohistochemical staining in primary gastric cancers. Case 23, intestinal type and case 87, diffuse type (original magnification ×100, insertion ×400). (B) Kaplan-Meier survival curve according to RRM2 staining status (negative and low expression groups, 112 cases; strong expression group, 158 cases; P=0.012) in gastric adenocarcinoma. RRM2, ribonucleotide reductase M2 subunit.

Table I

Correlation between RRM2 expression and other clinicopathological parameters.

Table I

Correlation between RRM2 expression and other clinicopathological parameters.

RRM2 expression (n=270)

CharacteristicsNegative and lowStrongP-value
Gender
 Male751060.983
 Female3752
Age, years
 ≤6048530.127
 >6064105
Type
 Intestinal63840.710
 Diffuse4973
Grade
 1810.010
 24357
 36199
Stage
 I29290.241
 II1616
 III3055
 IV3757
Stage (T)
 120160.025
 23142
 35295
 494
Stage (N)
 032270.070
 13139
 23050
 31941
Stage (M)
 0931340.613
 11923
H. pylori
 Absence45750.254
 Presence6275

[i] RRM2, ribonucleotide reductase M2 subunit. Significant P-value in bold format.

Table II

Univariate and multivariate Cox regression analysis of clinicopathological factors in patients with gastric adenocarcinoma.

Table II

Univariate and multivariate Cox regression analysis of clinicopathological factors in patients with gastric adenocarcinoma.

CharacteristicsUnivariate analysis RR (95% CI)P-valueMultivariate analysis
Gender
 Male0.832 (0.593–1.167)0.286
 Female1.000
Age, years
 ≤600.700 (0.496–0.988)0.043 <0.001
 >601.000
Type
 Intestinal0.543 (0.390–0.755) <0.0010.958
 Diffuse1.000
Grade
 10.221 (0.054–0.897)0.0350.740
 20.720 (0.508–1.021)0.065
 31.000
Stage
 I0.098 (0.054–0.178) <0.001 <0.001
 II0.127 (0.061–0.264) <0.001
 III0.385 (0.265–0.560) <0.001
 IV1.000
H. pylori
 Absence1.244 (0.884–1.750)0.211
 Presence1.000
RRM2
 Negative/low0.637 (0.448–0.905)0.0120.402
 Strong1.000

[i] RRM2, ribonucleotide reductase M2 subunit. Significant P-value in bold format.

RRM2 knockdown reduces proliferation and invasiveness in gastric cancer cells

Upregulation of RRM2 in gastric cancer suggested a potential tumorigenic role of RRM2 in cancer development. To elucidate the functional role of RRM2 in gastric tumorigenesis, we first investigated the effect of RRM2 knockdown by siRNA in vitro. To avoid cell-context dependent effects, the experiments were performed in multiple gastric cancer cell lines. The 5-day MTT assay indicated that knocking down RRM2 significantly reduced cell proliferation (AGS, 62.2%, P<0.001; MKN1, 84.4%, P=0.011; MKN28, 89.1%, P=0.016; Fig. 3A) compared with the mock and the scramble siRNA control groups. In anchorage-dependent monolayer colony formation assays, we observed a significant reduction of colony number in cell lines transfected with anti-RRM2 siRNA compared with the scramble siRNA control group (reduced to 32.4, 50.2 and 25.1% in AGS, MKN1 and MKN28, respectively, P<0.001; Fig. 3B). Matrigel invasion assays were carried out to monitor the invasion potential of gastric cancer cells transfected with siRRM2. By using BD Biocoat chamber, we found that the number of invaded cells was significantly lower in siRRM2 transfectants than in the control groups (reduced to 57.3% in AGS, P=0.004; 64.9% in MKN1, P=0.009; and 36.2% in MKN28, P=0.006; Fig. 3C).

Figure 3

RRM2 knockdown by siRNA in gastric cancer cell lines. (A) Transfection with RRM2 siRNA reduced RRM2 protein expression in AGS, MKN1 and MKN28 cells. Five-day MTT assays revealed RRM2 siRNA suppressed gastric cancer cell proliferation. (B) siRRM2 reduced monolayer colony formation to 32.4, 50.2 and 25.1% in AGS, MKN1 and MKN28 cells, respectively. The experiments were performed in triplicates. (C) Representative images of invaded cells are shown. The number of invaded cells was reduced in siRRM2 transfectants compared to scramble controls in AGS, MKN1 and MKN28 cells. The number of cells was counted in three random microscopic fields and the error bars represented standard deviations. (D1) MGC-803-siRRM2 formed smaller xenograft tumors than MGC-803-si-scramble group 3 weeks after inoculation. (D2) Upper, xenograft images; lower, western blotting validation of RRM2 expression in the xenografts. RRM2, ribonucleotide reductase M2 subunit.

To further investigate the effects of anti-RRM2 siRNA on tumorigenicity of gastric cancer, in vivo tumor formation assay was carried out. A gastric cancer cell line MGC-803, which is able to form xenograft tumor in nude mice, was transfected with siRRM2. Three weeks later, mice were sacrificed and the transplanted tumors were removed and weighted. A significant decrease in xenograft weight was observed upon RRM2 knockdown (P<0.01; Fig. 3D1). Successful knockdown of RRM2 was confirmed by western blot analysis in xenograft tumors (Fig. 3D2). The findings support that RRM2 plays an important role in promoting malignant growth of gastric cancer cells in vivo.

RRM2 knockdown changes the cell cycle distribution in gastric cancer cells

To investigate the mechanisms underlying the growth suppressive role of anti-RRM2 siRNA, the effects of anti-RRM2 siRNA on cell cycle distribution were analyzed. Twenty-four hours after transfection, accumulation of S-phase cells was observed in the anti-RRM2-transfected group. As shown in Fig. 4A, the anti-RRM2-transfected cells showed increased percentages of S-phase cells (AGS, from 35.9 to 54.6%; MKN1, from 30.4 to 38.1%; MKN28, from 32.4 to 42.1%) and decreased percentages of G1 phase cells (AGS, from 61.6 to 33.4%; MKN1, from 54.2 to 48.4%; MKN28, from 44.0 to 34.4%) compared with the si-scramble control group cells.

Figure 4

RRM2 knockdown inhibits cell cycle progression. (A) S phase accumulation and G1 reduction of cells were observed 24 h post-transfection. Representative figures from two independent experiments are shown. (B1) Sub-G1 population of the transfectants in AGS, MKN1 and MKN28. AGS showed increased sub-G1 cell population after siRRM2 transfection (4.7–14.5%). The experiments were repeated in two independent times. (B2) Early apoptosis analysis by Annexin V staining showed increased cell population with early apoptosis after siRRM2 transfection in AGS (6.3–13.5%, P<0.01). (C) Western blot analysis of cleaved-caspase 3, cleaved-PARP, p-P44/42 (T202/Y204), p-P38MAPK (T180/Y182), P-AKT (S473) and p-Stat3 (T705). RRM2, ribonucleotide reductase M2 subunit.

Furthermore, the RRM2 knockdown was shown to induce both early and late apoptosis in AGS cells. The sub-G1 AGS cell population increased to 14.5% in siRRM2 transfectants compared with si-scramble transfectants (4.7%; Fig. 4B1). This was further validated by Annexin V-FITC apoptosis analysis, as shown in Fig. 4B2. There was an increase in early apoptotic cell population in AGS cells after anti-RRM2 siRNA transfection (from 6.3 to 13.5%, P<0.01). Late apoptosis, represented by a significant increase of cleaved-caspase 3 and cleaved-PARP (Fig. 4C), was also observed in AGS after anti-RRM2 siRNA transfection compared with the control groups.

In the meantime, the expression levels of several phosphorylated proteins which were involved in cell cycle arrest, cell growth or cell apoptosis were determined. As shown in Fig. 4C, p-P44/42(T202/Y204) and p-P38MAPK(T180/Y182) were found to be phosphorylated to high level upon anti-RRM2 siRNA transfection compared with the si-scramble control, whereas p-AKT (S473) and p-Stat3 (T705) phosphorylation status showed no change between these two groups.

Discussion

In the present study, we found both mRNA and protein levels of RRM2 were highly expressed in gastric cancer samples compared with normal gastric mucosa. The expression of RRM2 in primary gastric cancer correlated with advanced T stage and poor prognosis. These results suggested that RRM2 might play a role in gastric tumorigenesis. In keeping with this finding, a previous analysis of RRM2 genomic sequence and promoter region, including consensus TATA box, three CCAAT boxes, and several GC rich sites, provided the hypothesis of its upregulation in favor of cancer transformation and drug resistance (18). According to a previous study (19), RRM2 overexpression that was significantly associated with Epstein-Barr virus, expression of survivin and DNA methyltransferase 1, predicted poor prognosis in patients with gastric cancer. Collectively, these results provided evidence that RRM2 served as a potential biomarker and therapeutic target for gastric cancer. In addition, RRM2 has been proposed to be a biomarker for a several types of human cancer. These previous studies suggested that RRM2 may serve as a potential diagnostic biomarker in breast cancer (20), bladder cancer (21) and ovarian cancer (10). RRM2 may also be a potential prognostic marker in non-small cell lung cancer receiving chemotherapeutic agents (22) and a potential therapeutic target for hepatocellular carcinoma (HCC) (23), bladder cancer (21) and pancreatic carcinoma (24,25).

The functional studies demonstrated for the first time that RRM2 knockdown by siRNA suppressed in vitro and in vivo growth of gastric cancer cells, and reduced cancer cell invasiveness. These results were concordant with a previous report (26) that anti-RRM2 siRNA exhibited anti-proliferative activity in various types of cancer cells. In addition to the apoptotic aspect, we found that anti-RRM2 siRNA induced both early and late apoptosis in AGS cells but not in MKN1 and MKN28 cells. Hence, the apoptotic response to siRRM2 appeared to be cell context-dependent. It is uncertain whether the different TP53 status might contribute to the different apoptotic responses as MKN1 and MKN28 cells harbor the TP53 mutation, whereas AGS cells carry the wild type TP53 (17). It has been reported that antisense RRM2 downregulated RRM2 expression and sensitized a prostate cancer cell line PC3 to UV radiation (27). In pancreatic adenocarcinoma, synergism between RRM2 siRNA and gemcitabine resulted in increased tumor apoptosis (28). RRM2 is a downstream target of the ATM-p53 pathway that mediates radiation-induced DNA repair (29) and silencing of RRM2 was found to enhance DNA damage as measured by histone γ-H2AX. Under DNA damage and Chk1 activation mediated by ATM and ATR, upregulation of RRM2 expression level coupled with its nuclear recruitment suggests an active role of RRM2 in the cellular process in response to DNA damage (30).

RRM2 knockdown by siRNA-reduced gastric cancer cell invasion ability was also observed in this study. RRM2 overexpression in pancreatic adenocarcinoma increases cellular invasiveness and MMP-9 expression in an NF-κB-dependent manner, whereas RNA interference-mediated silencing of RRM2 expression attenuates cellular invasiveness (13). In KB cells, RRM2 plays a positive role in angiogenesis and growth through regulation of the expression of antiangiogenic thrombospondin-1 (TSP-1) and proangiogenic vascular endothelial growth factor (VEGF) (14). These results suggested that RRM2 has a significant role in driving tumor cell invasion and metastasis.

In conclusion, we demonstrated the upregulation of RRM2 in gastric adenocarcinoma and its overexpression was correlated with poor prognosis in patients with gastric cancer, suggesting that RRM2 plays a crucial role in gastric tumorigenesis and could be used as a potential prognostic biomarker in gastric cancer. Functional studies demonstrated that downregulation of RRM2 expression by RRM2-specific siRNA quenched its oncogenic properties by inhibiting cell growth in vitro and in vivo, decreasing cell invasiveness. These findings suggested that RRM2 might be involved in gastric tumorigenesis and might potentially serve as a prognostic marker and a therapeutic target in gastric cancer.

Acknowledgements

This study was financially supported by the National Natural Science Foundation of China (81201591).

References

1 

Kelley JR and Duggan JM: Gastric cancer epidemiology and risk factors. J Clin Epidemiol. 56:1–9. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Smith MG, Hold GL, Tahara E and El-Omar EM: Cellular and molecular aspects of gastric cancer. World J Gastroenterol. 12:2979–2990. 2006.

3 

Alberts SR, Cervantes A and van de Velde CJ: Gastric cancer: epidemiology, pathology and treatment. Ann Oncol. 14(Suppl 2): ii31–36. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Fox JG and Wang TC: Inflammation, atrophy, and gastric cancer. J Clin Invest. 117:60–69. 2007. View Article : Google Scholar

5 

Li J, Ng EK, Ng YP, et al: Identification of retinoic acid-regulated nuclear matrix-associated protein as a novel regulator of gastric cancer. Br J Cancer. 101:691–698. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Cheung KF, Lam CN, Wu K, et al: Characterization of the gene structure, functional significance, and clinical application of RNF180, a novel gene in gastric cancer. Cancer. 118:947–959. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Yu J, Cheng YY, Tao Q, et al: Methylation of protocadherin 10, a novel tumor suppressor, is associated with poor prognosis in patients with gastric cancer. Gastroenterology. 136:640–651. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Wu WK, Lee CW, Cho CH, et al: MicroRNA dysregulation in gastric cancer: a new player enters the game. Oncogene. 29:5761–5771. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Wu WK, Cho CH, Lee CW, et al: Dysregulation of cellular signaling in gastric cancer. Cancer Lett. 295:144–153. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Ferrandina G, Mey V, Nannizzi S, et al: Expression of nucleoside transporters, deoxycitidine kinase, ribonucleotide reductase regulatory subunits, and gemcitabine catabolic enzymes in primary ovarian cancer. Cancer Chemother Pharmacol. 65:679–686. 2010. View Article : Google Scholar

11 

Goan YG, Zhou B, Hu E, Mi S and Yen Y: Overexpression of ribonucleotide reductase as a mechanism of resistance to 2,2-difluorodeoxycytidine in the human KB cancer cell line. Cancer Res. 59:4204–4207. 1999.PubMed/NCBI

12 

Engström Y, Eriksson S, Jildevik I, Skog S, Thelander L and Tribukait B: Cell cycle-dependent expression of mammalian ribonucleotide reductase. Differential regulation of the two subunits. J Biol Chem. 260:9114–9116. 1985.PubMed/NCBI

13 

Duxbury MS and Whang EE: RRM2 induces NF-kappaB -dependent MMP-9 activation and enhances cellular invasiveness. Biochem Biophys Res Commun. 354:190–196. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Zhang K, Hu S, Wu J, et al: Overexpression of RRM2 decreases thrombspondin-1 and increases VEGF production in human cancer cells in vitro and in vivo: implication of RRM2 in angiogenesis. Mol Cancer. 8:112009. View Article : Google Scholar : PubMed/NCBI

15 

Zuckerman JE, Hsueh T, Koya RC, Davis ME and Ribas A: siRNA knockdown of ribonucleotide reductase inhibits melanoma cell line proliferation alone or synergistically with temozolomide. J Invest Dermatol. 131:453–460. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Kang W, Tong JH, Chan AW, et al: Stathmin1 plays oncogenic role and is a target of microRNA-223 in gastric cancer. PLoS One. 7:e339192012. View Article : Google Scholar : PubMed/NCBI

17 

Kang W, Tong JH, Chan AW, et al: Yes-associated protein 1 exhibits oncogenic property in gastric cancer and its nuclear accumulation associates with poor prognosis. Clin Cancer Res. 7:2130–2139. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Zhou B and Yen Y: Characterization of the human ribonucleotide reductase M2 subunit gene; genomic structure and promoter analyses. Cytogenet Cell Genet. 95:52–59. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Morikawa T, Hino R, Uozaki H, et al: Expression of ribonucleotide reductase M2 subunit in gastric cancer and effects of RRM2 inhibition in vitro. Hum Pathol. 41:1742–1748. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Kretschxmer C, Sterner-Kock A, Siedentopf F, Schoenegg W, Schlag PM and Kemmner W: Identification of early molecular markers for breast cancer. Mol Cancer. 10:152011. View Article : Google Scholar : PubMed/NCBI

21 

Morikawa T, Maeda D, Kume H, Homma Y and Fukayama M: Ribonucleotide reductase M2 subunit is a novel diagnostic marker and a potential therapeutic target in bladder cancer. Histopathology. 57:885–892. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Souglakos J, Boukovinas I, Taron M, et al: Ribonucleotide reductase subunits M1 and M2 mRNA expression levels and clinical outcome of lung adenocarcinoma patients treated with docetaxel/gemcitabine. Br J Cancer. 98:1710–1715. 2008. View Article : Google Scholar

23 

Satow R, Shitashige M, Kanai Y, et al: Combined functional genome survey of therapeutic targets for hepatocellular carcinoma. Clin Cancer Res. 16:2518–2528. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Itoi T, Sofuni A, Fukushima N, et al: Ribonucleotide reductase subunit M2 mRNA expression in pretreatment biopsies obtained from unresectable pancreatic carcinomas. J Gastroenterol. 42:389–394. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Duxbury MS, Ito H, Benoit E, Zinner MJ, Ashley SW and Whang EE: Retrovirally mediated RNA interference targeting the M2 subunit of ribonucleotide reductase: a novel therapeutic strategy in pancreatic cancer. Surgery. 136:261–269. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Heidel JD, Liu JY, Yen Y, et al: Potent siRNA inhibitors of ribonucleotide reductase subunit RRM2 reduce cell proliferation in vitro and in vivo. Clin Cancer Res. 13:2207–2215. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Zhou B, Liu X, Mo X, et al: The human ribonucleotide reductase subunit hRRM2 complements p53R2 in response to UV-induced DNA repair in cells with mutant p53. Cancer Res. 63:6583–6594. 2003.PubMed/NCBI

28 

Duxbury MS, Ito H, Zinner MJ, Ashley SW and Whang EE: RNA interference targeting the M2 subunit of ribonucleotide reductase enhances pancreatic adenocarcinoma chemosensitivity to gemcitabine. Oncogene. 23:1539–1548. 2004. View Article : Google Scholar

29 

Hu ZZ, Huang H, Cheema A, Jung M, Dritschilo A and Wu CH: Integrated bioinformatics for radiation-induced pathway analysis from proteomics and microarray data. J Proteomics Bioinform. 1:47–60. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Zhang YW, Jones TL, Martin SE, Caplen NJ and Pommier Y: Implication of checkpoint kinase-dependent up-regulation of ribonucleotide reductase R2 in DNA damage response. J Biol Chem. 284:18085–18095. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kang W, Tong JH, Chan AW, Zhao J, Wang S, Dong Y, Sin FM, Yeung S, Cheng AS, Yu J, Yu J, et al: Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma. Oncol Rep 31: 2579-2586, 2014.
APA
Kang, W., Tong, J.H., Chan, A.W., Zhao, J., Wang, S., Dong, Y. ... To, K. (2014). Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma. Oncology Reports, 31, 2579-2586. https://doi.org/10.3892/or.2014.3148
MLA
Kang, W., Tong, J. H., Chan, A. W., Zhao, J., Wang, S., Dong, Y., Sin, F. M., Yeung, S., Cheng, A. S., Yu, J., To, K."Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma". Oncology Reports 31.6 (2014): 2579-2586.
Chicago
Kang, W., Tong, J. H., Chan, A. W., Zhao, J., Wang, S., Dong, Y., Sin, F. M., Yeung, S., Cheng, A. S., Yu, J., To, K."Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma". Oncology Reports 31, no. 6 (2014): 2579-2586. https://doi.org/10.3892/or.2014.3148
Copy and paste a formatted citation
x
Spandidos Publications style
Kang W, Tong JH, Chan AW, Zhao J, Wang S, Dong Y, Sin FM, Yeung S, Cheng AS, Yu J, Yu J, et al: Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma. Oncol Rep 31: 2579-2586, 2014.
APA
Kang, W., Tong, J.H., Chan, A.W., Zhao, J., Wang, S., Dong, Y. ... To, K. (2014). Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma. Oncology Reports, 31, 2579-2586. https://doi.org/10.3892/or.2014.3148
MLA
Kang, W., Tong, J. H., Chan, A. W., Zhao, J., Wang, S., Dong, Y., Sin, F. M., Yeung, S., Cheng, A. S., Yu, J., To, K."Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma". Oncology Reports 31.6 (2014): 2579-2586.
Chicago
Kang, W., Tong, J. H., Chan, A. W., Zhao, J., Wang, S., Dong, Y., Sin, F. M., Yeung, S., Cheng, A. S., Yu, J., To, K."Targeting ribonucleotide reductase M2 subunit by small interfering RNA exerts anti-oncogenic effects in gastric adenocarcinoma". Oncology Reports 31, no. 6 (2014): 2579-2586. https://doi.org/10.3892/or.2014.3148
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team