Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
July-2017 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells

  • Authors:
    • Xin Tian
    • Hongyan Zhang
    • Bijun Zhang
    • Jianzhu Zhao
    • Tingting Li
    • Yanyan Zhao
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Genetics, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China
  • Pages: 293-300
    |
    Published online on: June 1, 2017
       https://doi.org/10.3892/or.2017.5691
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Paclitaxel (PTX)-based chemotherapy is a standard treatment for human lung adenocarcinoma, but treatment often fails since resistance develops. Recent studies have described the activity of long non-coding RNAs (lncRNAs) in many biological processes and human diseases. Chemotherapy resistance is one of these areas, but the role of lncRNAs in paclitaxel resistance of human lung adenocarcinoma cells has not been reported. A paclitaxel resistance model was established using A549 human lung adenocarcinoma cells. lncRNAs and mRNAs were profiled in parental A549 and paclitaxel-resistant A549/PTX cells by microarray analysis. Real-time quantitative PCR (RT-qPCR) was used to validate the results of the microarray. Chromosomal distribution patterns of differentially expressed lncRNAs and mRNAs were assessed. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed using gene set enrichment. We screened 1,154 lncRNAs and 1,733 mRNAs that had a >3-fold difference in expression in A549/PTX cells compared with A549 cells, most of which were downregulated. Nine lncRNAs and six mRNAs were randomly selected and validated by RT-qPCR. Most aberrantly expressed lncRNAs and mRNAs were located on chromosomes 1, 2, 6, 12 and 17, particularly on chromosome 1. Bioinformatics, GO and KEGG pathway analyses, revealed that some differentially expressed genes regulated classical functions and pathways such as cytosol components, protein binding, gene expression and metabolic pathways. Differential expression of lncRNAs and mRNAs in A549/PTX and A549 cells indicates that various lncRNAs may be useful diagnostic or prognostic markers of resistance to treatment, or future targets for paclitaxel-based chemotherapy, providing a novel rationale for clinical treatment.

Introduction

Lung cancer is one of the most common human cancers, and with the highest worldwide incidence and mortality (1). Adenocarcinoma is one of the more common pathological types (2). Despite advances in surgery, radiotherapy and targeted treatment, survival is far from satisfactory. Most patients are given paclitaxel (PTX)-based combination chemotherapy as a standard treatment (3). Paclitaxel is a taxane, and its cytotoxic effect depends on microtubule polymerization, and inhibition of microtubule depolymerization leads to a cell cycle block in the G2/M phase resulting in tumor cell apoptosis or necrosis (4). However, eventual development of resistance to paclitaxel is inevitable and leads to treatment failure. The paclitaxel mechanism of resistance is multifactorial and complex, involving changes in drug-efflux, increased drug metabolism, interference with DNA repair and cell cycle regulation, and disorders of cell apoptosis and autophagy (5,6). Despite our knowledge of its anticancer effects, little is known concerning the development of paclitaxel resistance. A broadening of our understanding is essential for improving treatment outcomes.

Much of the human genome is transcribed as long non-coding RNAs (lncRNAs), a type of ncRNA 200 nt in length that is not translated, but does influence the regulation of gene expression and chemotherapy resistance in various ways (7,8). For example, lncRNA n375709 expression was significantly increased in paclitaxel-resistant CNE-2 nasopharyngeal carcinoma compared with parental CNE-2 cells (9). Knockdown of AK126698 activated the canonical Wnt signaling pathway and induced cisplatin resistance in A549 human lung cancer cells (10). lncRNA MEG3 overexpression in drug resistant A549/DDP cells increased their chemosensitivity to cisplatin both in vitro and in vivo by inhibiting cell proliferation and inducing apoptosis (11). Upregulation of lncRNA GAS5 overcame resistance of human lung adenocarcinoma cells to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) therapy (12). Other lncRNAs, such as HOTTIP, NEAT1, PVT1 and ODRUL have also been reported to modulate chemosensitivity (13–16). It has thus been established that the upregulation and downregulation of lncRNAs is implicated in chemotherapy resistance.

To the best of our knowledge, there have been no studies concerning the roles of lncRNAs in the acquisition of paclitaxel resistance in lung adenocarcinoma. We investigated differential expression of lncRNAs and mRNAs in paclitaxel-sensitive A549 and paclitaxel-resistant A549/PTX cells using microarray assays. Nine differentially expressed lncRNAs and six mRNAs were randomly selected for validation by real-time quantitative PCR (RT-qPCR). Subsequent bioinformatics evaluation by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses identified classical biological regulatory functions and pathways that were differentially expressed in these cell lines. Our results add to the knowledge concerning the involvement of lncRNAs in the resistance to paclitaxel-based chemotherapy in human lung adenocarcinoma cells, and thus, may provide novel molecular therapeutic targets.

Materials and methods

Cell lines and cell culture

The A549 human lung adenocarcinoma cell line was obtained from the Cell Bank of the Shanghai Branch of the Chinese Academy of Sciences. A549/PTX cells were established in our laboratory in a stepwise manner by exposing drug-sensitive A549 cells to increasing doses of paclitaxel (PTX; Bristol-Myers Squibb, New York, NY, USA). The cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (both from Gibco, Carlsbad, CA, USA) at 37°C in humidified incubator with 5% CO2. The A549/PTX cell culture medium also contained 200 ng/ml PTX to maintain the drug-resistant phenotype. Cells in the logarithmic phase of growth were used in all experimental procedures.

In vitro drug sensitivity assay

To evaluate differences in chemoresistance, cells were seeded into 96-well plates at 5×103 cells/well and incubated with various concentrations of PTX for 48 h. At 48 h, the number of viable cells was assayed with Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan). CCK-8 reagent (10 µl) was added to each well and incubation followed for 1 h at 37°C. The number of viable cells was estimated by assessment of the optical density (OD) at 450 nm, and the PTX concentration that produced 50% inhibition of growth (IC50) was estimated from the relative survival curves. Three independent experiments were performed in five duplicate wells.

RNA extraction and RNA quality control

Total RNA was extracted using TRIzol reagent (Takara, Otsu, Japan) following the manufacturer's protocol. RNA quantity and quality were assessed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, MA, USA), and RNA integrity was assessed by electrophoresis on a denaturing agarose gel. Isolated RNAs were stored at −80°C prior to lncRNA microarray analysis and RT-qPCR.

lncRNA microarray

The GeneChip Human Transcriptome Array 2.0 (Affymetrix, Santa Clara, CA, USA) contains >6.0 million distinct probes of both coding and non-coding transcripts. Approximately 25,000 lncRNAs and 24,500 mRNAs listed in databanks including RefSeq, Ensembl, UCSC (known genes and lincRNA transcripts), NONCODE, the Human Body Map lincRNA and TUCP catalog, and lncRNAdb, were detected.

RNA labeling and microarray hybridization

RNA labeling and microarray hybridization were performed following an Affymetrix GeneChip protocol from GMINIX BioTech (Shanghai, China). Briefly, total RNA was purified after removal of rRNA and tRNA. Each sample was amplified and transcribed into fluorescent cRNA along the entire length of the transcript, without the 3 bias, using a random priming method. After purification, the labeled cRNAs were hybridized at 45°C for 16 h in an Affymetrix hybridization oven. After being washed, the hybridized arrays were scanned using Affymetrix GeneChip Scanner 3000, and data were extracted using Transcriptome Analysis Console Software.

Validation of aberrantly expressed lncRNAs and mRNAs by RT-qPCR

Total RNA was extracted using TRIzol reagent, and was then reverse-transcribed using a PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time; Takara) following the manufacturer's instructions. Reactants were incubated for 2 min at 42°C, 15 min at 37°C, 5 sec at 85°C, 7 min at 4°C, and then stored at −20°C. The transcripts of nine differentially expressed lncRNAs and six mRNAs were randomly selected for RT-qPCR using a SYBR-Green assay (Takara, Dalian, China); GAPDH was used as an internal control. Specific lncRNA and mRNA primers were designed using Primer 5.0. The RT-qPCR reaction was set at an initial denaturation step of 10 min at 95°C followed by 40 cycles of 95°C for 10 sec and 60°C for 1 min. All experiments were performed three times, and fold changes of expression were calculated using the 2−ΔΔCt method.

Bioinformatics analysis

Affymetrix Transcriptome Analysis Console software was used to analyze the acquired array images. Differentially expressed lncRNAs and mRNAs were identified through fold-change filtering. GO categories (www.geneontology.org) and KEGG pathway analyses (http://www.genome.jp/kegg/) were performed using the standard enrichment computation method.

Statistical analysis

Statistical analysis was performed using SPSS version 17.0 software (SPSS, Inc., Chicago, IL, USA). Results are presented as the means ± standard deviation (SD) of three separate assays. Differences between groups were assessed by two tailed t-tests. P<0.05 was considered as statistically significant.

Results

CCK-8 assay of in vitro drug sensitivity

The paclitaxel-resistance of A549/PTX cells was characterized by determining the IC50 value. After treatment with various concentrations of paclitaxel for 48 h in A549 and A549/PTX cells, the cell survival was assayed using CCK-8 (Fig. 1A). The paclitaxel IC50 value for the drug-resistant A549/PTX cell line was 1240.12±6.13 and 18.21±0.84 ng/ml for the A549 cell line (Fig. 1B), with a drug-resistance index of A549/PTX relative to A549 cells of 68 (P<0.01). A previously reported criterion of high-resistance is an index >20 (17). The A549/PTX cells were revealed to be more resistant to paclitaxel than the A549 cells.

Figure 1.

Paclitaxel (PTX)-resistance of A549 and A549/PTX cells. (A) Cells were treated with increasing concentrations of paclitaxel and 48 h later, the cell survival rate was assessed using CCK-8 assay. The A549/PTX cells were more resistant to paclitaxel than the A549 cells. (B) The IC50 value of paclitaxel for the A549/PTX cells was 1240.12±6.13 ng/ml, and for the A549 cells the value was 18.21±0.84 ng/ml. The drug-resistance index of A549/PTX cells relative to A549 cells was 68. Data are presented as the mean ± standard deviation; **P<0.01.

RNA quality control

RNA quantification and quality were spectrophotometrically assayed using the NanoDrop ND-1000. The OD A260/A280 ratio of the total RNA was between 1.8 and 2.1. RNA integrity was assessed by electrophoresis on a denaturing agarose gel. The 28s and 18s ribosomal RNA bands were fairly sharp and intense, and the 28s rRNA band was about twice as intense as the 18s rRNA band. The lncRNA and mRNA samples from the A549 and A549/PTX cells were found to be suitable for microarray expression profiling.

Differentially expressed lncRNAs and mRNAs

The Affymetrix GeneChip Human Transcriptome Array 2.0 was used for profiling both parental A549 and A549/PTX cells. For microarray analysis, ~25,000 lncRNAs and 24,500 mRNAs were detected. After quantile normalization and data filtering, we found a >3-fold difference in the expression of 1,154 lncRNAs and 1,733 mRNAs in the A549/PTX cells compared with the A549 cells. Of the 1,154 differentially expressed lncRNAs, 119 were upregulated and 1,035 were downregulated (P<0.01); 28 of the mRNAs were upregulated and 1,705 were downregulated (P<0.01). The hierarchical cluster analysis of the expression of the lncRNAs and mRNAs that were identified is shown in Fig. 2. The differentially expressed lncRNAs and mRNAs are listed in Table I, and the 10 lncRNAs and mRNAs with the greatest relative upregulation or downregulation are shown in Tables II and III. lncRNA n334075 (fold change=8.77) was the most significantly upregulated and lncRNA n335556 (fold change=−308.61) was the most significantly downregulated. Norrin cystine knot growth factor (NDP) mRNA (fold change=6.75) was the most significantly upregulated and histone cluster 2 H2A family member a4 (HIST2H2AA4) (fold change=−99.71) was the most significantly downregulated. Downregulated lncRNAs and mRNAs were more common than upregulated lncRNAs and mRNAs in our microarray data.

Figure 2.

Microarray expression profiling of differentially expressed long non-coding RNAs (lncRNAs) and mRNAs in A549 and paclitaxel-resistant A549 (A549/PTX) cells. (A) Hierarchical clustering of all target lncRNAs. (B) Hierarchical clustering of all target mRNAs. Each row represents one lncRNA or mRNA, and each column represents one cell line sample. ‘Red’ indicates high relative expression, and ‘green’ indicates low relative expression. There were 1,154 lncRNAs and 1,733 mRNAs that exhibited a >3-fold differential expression in A549/PTX cells compared with A549 cells. Among them, more were downregulated.

Table I.

Number of differentially expressed lncRNAs and mRNAs.

Table I.

Number of differentially expressed lncRNAs and mRNAs.

lncRNAs and mRNAsFold change >3Total
lncRNAs 1,154
  Upregulation  119
  Downregulation1,035
mRNAs 1,733
  Upregulation     28
  Downregulation1,705

[i] lncRNAs, long non-coding RNAs.

Table III.

Ten most significantly upregulated and downregulated mRNAs.

Table III.

Ten most significantly upregulated and downregulated mRNAs.

Upregulated in A549/PTXDownregulated in A549/PTX


mRNAsFold changemRNAsFold change
NDP6.75HIST2H2AA4−99.71
TNF6.12ALDH1A1−92.66
DDR25.76FTL−77.03
WNT65.69PTPLAD1−76.91
NCAM14.58CYP24A1−73.79
LOXL14.47AKR1C2−58.71
KRTAP5-63.42NQO1−55.83
IGLV7-433.39NETO2−46.82
IGHV3-483.38RSL1D1−46.32
SPPL2C3.34HIST1H1E−41.36

[i] A549/PTX vs. parental A549 cells. A549/PTX, paclitaxel-resistant A549 cells.

RT-qPCR validation of microarray data

To validate the microarray data, nine differentially expressed lncRNAs and six mRNAs were randomly selected for RT-qPCR assay of RNA isolated from both resistant A549/PTX and sensitive A549 cells. The primers used for PCR validation are listed in Table IV. As shown in Fig. 3, the expression of lncRNA ENST00000455973, ENST00000416226, ENST00000486726 and ENST00000503218 was upregulated and the expression of ENST00000544920, NR-002206, ENST00000363046, NR-002555 and ENST00000500843 was downregulated. The expression of DDR2 and TNF mRNA was upregulated and the expression of ABCC2, MRPS30, NEDD4, and CASP2 was downregulated. The RT-qPCR results were thus, consistent with the microarray data.

Figure 3.

Validation of microarray data by RT-qPCR. (A) Nine long non-coding RNAs (lncRNAs) and (B) six mRNAs differentially expressed in A549 cells compared with paclitaxel-resistant A549 (A549/PTX) cells by microarray were randomly selected and validated by RT-qPCR. The heights of the columns in the chart represent the mean fold change of the expression. The fold change was positive when the expression was upregulated (A549/PTX vs. A549 cells) and negative when the expression was downregulated. Data are presented as the mean ± standard deviation.

Table IV.

Primers used for RT-qPCR validation.

Table IV.

Primers used for RT-qPCR validation.

lncRNAs and mRNAsForward primer sequenceReverse primer sequence
ENST00000363046 GGACTCTGTTCCTCCCCTTTC GAGCCCCGTGTGGTTGG
ENST00000500843 CCTGGCTGAGGTGAATAA TTGGACCCGAACATCTG
ENST00000544920 AAAGATGAGGCAGAGGTCCAAG CGATCAGAGGGCGATGAAG
NR-002555 (LOC613037) GGGCAGAGGACTACCACAAATG TGTTGTTGAGTTGGAGGAGGTG
NR-002206 (GTF2IP1) GCTGTGTGGTGGTTGATGG CTCTTTTATTTCTTCTGTGGCTGGA
ENST00000455973 GATGTGGGAAACAGTGGC GTAAGGCAGCAGGGAGG
ENST00000416226 AGGAGAAACTCATCAGGC ATCTCTTCTACGGTGGCT
ENST00000486726 CCTGTCTGGTGTCCTTGC CAGCAGGAGAGGCATCAG
ENST00000503218 GCAAGTGAAGCCTGATACC AAAGCGTCTGTGAGCCTAA
TNF GTGACAAGCCTGTAGCCCATGTT TTATCTCTCAGCTCCACGCCATT
DDR2 CCCAGCTGTCAGATGAACAGGTTA TCAGGACAAATGGCTGGTTGAG
CASP2 TGGCATGCATCCTCATCATC TCTGGCTGAAACTGCCCACT
ABCC2 AGTGATCACCATCGCCCACA GTTCACATTCTCAATGCCAGCTTC
MRPS30 CGAACCCGAACCTGAACCT GATATGACCTCGCTCTCCTCGT
NEDD4 TGAAGCCCAATGGGTCAGAAATA GGACCCTGTTCACAAATCTCCAC
GAP TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
Chromosomal distribution of differentially expressed lncRNAs and mRNAs

Since chromosomal imbalances have been associated with drug resistance, a distribution plot of chromosomal location was developed to show the chromosomal locations of the differentially expressed lncRNAs and mRNAs. As shown in Fig. 4, the 1,154 lncRNAs and 1,733 mRNAs were distributed throughout the genome, and were associated with every chromosome. In the present study, aberrantly expressed lncRNAs and mRNAs were most frequently found on chromosomes 1, 2, 6, 12 and 17, however, particularly on chromosome 1.

Figure 4.

Chromosomal distribution of the differentially expressed long non-coding RNAs (lncRNAs) and mRNAs. The y-axis indicates the number of upregulated and downregulated lncRNAs and mRNAs. Aberrantly expressed lncRNAs and mRNAs were found to be mainly located on chromosomes 1, 2, 6, 12 and 17. ‘chr’, chromosome.

GO and KEGG pathway analyses

GO analysis was applied to identify the functions of the differentially expressed mRNAs. The GO database includes the primary functional classifications of the National Center for Biotechnology Information (NCBI), and includes three categories, i.e., cellular components, molecular functions and biological processes. The microarray data obtained in the present study revealed that the differentially expressed genes were enriched for GO terms related to the cytosol, cytoplasm, nucleus and nucleolus (cellular components); protein, ATP and RNA bindings, and structural constituents of ribosomes (molecular functions); and gene expression, mitotic cell cycle, small-molecule metabolic process, and translation (biological processes). The top 10 GO terms within each of the three categories, cellular components, molecular functions and biological processes, are shown in Fig. 5A-C.

Figure 5.

Analysis of significant GO and Kyoto Encyclopedia of Gene and Genome (KEGG) pathways. (A-C) GO and (D) KEGG pathways analyses. The histograms show the top 10 significant GO and KEGG pathways of the differentially expressed genes. The P-value (Fisher P-value) denotes the significance of the GO and the KEGG pathway enrichment. The lower the P-value, the more significant was the difference in the GO and KEGG pathways (the recommend P-value cut-off is 0.05).

We conducted pathway analysis of the differentially expressed mRNAs using the latest KEGG database, which identified the biological pathways involved in paclitaxel resistance. We found 96 pathways corresponding to aberrant mRNAs, and the predominant pathways are shown in Fig. 5D. The top 10 pathways were metabolic, ribosomal, RNA transport, cell cycle, endocytosis, pathways in cancer, oxidative phosphorylation, purine metabolism, mismatch repair and DNA replication.

Discussion

Paclitaxel is the standard and most effective chemotherapy drug used for lung adenocarcinoma, but drug resistance is a major clinical obstacle that limits its clinical benefits (18). Although some molecular mechanisms of paclitaxel resistance in various types of cancers have been reported in the past few decades (19), the precise cause of paclitaxel resistance in lung adenocarcinoma remains unclear. Research is urgently warranted to fully understand and overcome it. Evidence that lncRNAs are involved in chemotherapy resistance is increasing (20–22), but to the best of our knowledge there is little data on the correlations between lncRNAs and paclitaxel resistance in human lung adenocarcinoma.

To investigate the regulatory effects of lncRNAs in paclitaxel resistance of lung adenocarcinoma, we established a paclitaxel-resistant A549/PTX cell line and assayed its PTX resistance. Microarray expression profiling of lncRNAs and mRNAs in parental A549 and paclitaxel resistant A549/PTX cells identified a total of 1,154 differentially expressed lncRNAs. We also found aberrant expression of 1,733 mRNAs in A549/PTX cells compared with the parental A549 cells. Various of the differentially expressed lncRNAs and mRNAs including, MALAT1, TUG1, HOTAIR, ABCB1 (MDR1) and Wnt6 have been previously reported in other chemoresistant cancers (23–27). Whether the molecular mechanisms of chemoresistance are the same as in the A549/PTX cells warrants further investigation. However, in our screening results, the 10 predominantly upregulated and downregulated lncRNAs have not been previously related to treatment resistance. Consequently, their mechanism of resistance regulation and their function in resistant cells are not clear. lncRNAs regulate neighboring protein-coding genes (28), and we found that some of the aberrantly expressed lncRNAs may play important roles in paclitaxel resistance by regulating nearby coding genes. For example, upregulated lncRNA ENST00000447028 was found to be located near VEGF-B mRNA. VEGF-B mRNA was reported by Yang et al to take part in the resistance of lung cancer cells to the chemotherapeutic drug EGFR-TKI (29). We found that VEGF-B mRNA was strongly upregulated, therefore, ENST00000447028 may influence paclitaxel resistance by regulating VEGF-B mRNA. Another upregulated lncRNA, ENST00000416226, was found to be located near Wnt6 mRNA, which was upregulated in our results, and is involved in both oncogenesis and chemoresistance in human cancers (30). We thus, speculate that lncRNAs may influence paclitaxel resistance in human lung adenocarcinoma by regulating the expression of their nearby coding genes. Further studies of the effect of overexpression or knockdown of lncRNAs and western blot analyses should be performed to investigate the precise relationships.

We found that the aberrantly expressed lncRNAs and mRNAs were distributed throughout the genome and could be found in every chromosome, particularly on chromosome 1. Perhaps, all the chromosomes participate in paclitaxel resistance. The importance of chromosome 1 in the occurrence of paclitaxel resistance in lung adenocarcinoma warrants investigation.

The biological functions and signaling pathways associated with the lncRNAs and mRNAs identified in the present study, were evaluated by GO and KEGG pathway analyses. The most enriched GOs were cytosol (cellular components), protein binding (molecular function) and gene expression (biological processes). In addition, many of the identified GO terms in our results have been reported in other cancer chemoresistance studies. For example, protein and nucleotide binding, and metabolic processes have been reported to be involved in the chemoresistance of lung and colorectal cancer (31). This suggests that lncRNAs among those we identified may have regulated chemoresistance of the A549/PTX cells by influencing the expression of these GO database genes. Pathway analysis revealed a total of 96 pathways corresponding to all the differentially expressed mRNAs. Some of the top 10 pathways that we identified have previously been associated with chemoresistance. For example, Wu et al using genome-wide microarrays found that the metabolic pathway participated in EGFR-TKI resistance of lung adenocarcinoma (32). Zhu et al reported that the cell cycle pathway was associated with the development of doxorubicin resistance in the MG63/DXR human osteosarcoma cell line (33). Zhou et al found that the DNA replication pathway contributed to the occurrence of gemcitabine resistance in SW1990 pancreatic cancer cells (34). These data revealed that the differentially expressed lncRNAs may regulate paclitaxel resistance in lung adenocarcinoma through these classical pathways.

In conclusion, the present study reveals, for the first time, numerous differentially expressed lncRNAs and mRNAs in A549 and A549/PTX cells which may play an important role in regulating paclitaxel resistance through various biological functions and signaling pathways. We described a novel approach to clarify the molecular mechanisms of paclitaxel resistance in human lung adenocarcinoma. The results provide a novel rationale for studies on reversal of paclitaxel resistance and for identifying patients who can benefit the most from chemotherapy. Evaluation of clinical samples for in vivo validation is warranted.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 31571198), and the Outstanding Scientific Fund of Shengjing Hospital (no. 201601).

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Morgensztern D, Ng SH, Gao F and Govindan R: Trends in stage distribution for patients with non-small cell lung cancer: A National Cancer Database survey. J Thorac Oncol. 5:29–33. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Sun QL, Sha HF, Yang XH, Bao GL, Lu J and Xie YY: Comparative proteomic analysis of paclitaxel sensitive A549 lung adenocarcinoma cell line and its resistant counterpart A549-Taxol. J Cancer Res Clin Oncol. 137:521–532. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Khongkow P, Gomes AR, Gong C, Man EP, Tsang JW, Zhao F, Monteiro LJ, Coombes RC, Medema RH, Khoo US, et al: Paclitaxel targets FOXM1 to regulate KIF20A in mitotic catastrophe and breast cancer paclitaxel resistance. Oncogene. 35:990–1002. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Park SH, Seong MA and Lee HY: p38 MAPK-induced MDM2 degradation confers paclitaxel resistance through p53-mediated regulation of EGFR in human lung cancer cells. Oncotarget. 7:8184–8199. 2016.PubMed/NCBI

6 

Holleman A, Chung I, Olsen RR, Kwak B, Mizokami A, Saijo N, Parissenti A, Duan Z, Voest EE and Zetter BR: miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo. Oncogene. 30:4386–4398. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Hirano T, Yoshikawa R, Harada H, Harada Y, Ishida A and Yamazaki T: Long noncoding RNACCDC26, controls myeloid leukemia cell growth through regulation of KIT expression. Mol Cancer. 14:902015. View Article : Google Scholar : PubMed/NCBI

8 

Wang Y, Wu K, Yang Z, Zhao Q and Fan D, Xu P, Nie Y and Fan D: Multidrug-resistance related long non-coding RNA expression profile analysis of gastric cancer. PLoS One. 10:e01354612015. View Article : Google Scholar : PubMed/NCBI

9 

Ren S, Li G, Liu C, Cai T, Su Z, Wei M, She L, Tian Y, Qiu Y, Zhang X, et al: Next generation deep sequencing identified a novel lncRNA n375709 associated with paclitaxel resistance in nasopharyngeal carcinoma. Oncol Rep. 36:1861–1867. 2016.PubMed/NCBI

10 

Yang Y, Li H, Hou S, Hu B, Liu J and Wang J: The noncoding RNA expression profile and the effect of lncRNA AK126698 on cisplatin resistance in non-small-cell lung cancer cell. PLoS One. 8:e653092013. View Article : Google Scholar : PubMed/NCBI

11 

Liu J, Wan L, Lu K, Sun M, Pan X, Zhang P, Lu B, Liu G and Wang Z: The long noncoding RNA MEG3 contributes to cisplatin resistance of human lung adenocarcinoma. PLoS One. 10:e01145862015. View Article : Google Scholar : PubMed/NCBI

12 

Dong S, Qu X, Li W, Zhong X, Li P, Yang S, Chen X, Shao M and Zhang L: The long non-coding RNA GAS5, enhances gefitinib-induced cell death in innate EGFR tyrosine kinase inhibitor-resistant lung adenocarcinoma cells with wide-type EGFR via downregulation of the the via downregulation of the IGF-1R expression. J Hematol Oncol. 8:432015. View Article : Google Scholar : PubMed/NCBI

13 

Li Z, Zhao X, Zhou Y, Liu Y, Zhou Q, Ye H, Wang Y, Zeng J, Song Y, Gao W, et al: The long non-coding RNA HOTTIP promotes progression and gemcitabine resistance by regulating HOXA13 in pancreatic cancer. J Transl Med. 13:842015. View Article : Google Scholar : PubMed/NCBI

14 

Gao C, Zhang J, Wang Q and Ren C: Overexpression of lncRNA NEAT1 mitigates multidrug resistance by inhibiting ABCG2 in leukemia. Oncol Lett. 12:1051–1057. 2016.PubMed/NCBI

15 

Ding J, Li D, Gong M, Wang J, Huang X, Wu T and Wang C: Expression and clinical significance of the long non-coding RNA PVT1 in human gastric cancer. Onco Targets Ther. 7:1625–1630. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Zhang CL, Zhu KP, Shen GQ and Zhu ZS: A long non-coding RNA contributes to doxorubicin resistance of osteosarcoma. Tumour Biol. 37:2737–2748. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Snow K and Judd W: Characterisation of adriamycin- and amsacrine-resistant human leukaemic T cell lines. Br J Cancer. 63:17–28. 1991. View Article : Google Scholar : PubMed/NCBI

18 

Liu R, Liu X, Zheng Y, Gu J, Xiong S, Jiang P, Jiang X, Huang E, Yang Y, Ge D, et al: MicroRNA-7 sensitizes non-small cell lung cancer cells to paclitaxel. Oncol Lett. 8:2193–2200. 2014.PubMed/NCBI

19 

Chatterjee A, Chattopadhyay D and Chakrabarti G: miR-17-5p downregulation contributes to paclitaxel resistance of lung cancer cells through altering beclin1 expression. PLoS One. 9:e957162014. View Article : Google Scholar : PubMed/NCBI

20 

Lee H, Kim C, Ku JL, Kim W, Yoon SK, Kuh HJ, Lee JH, Nam SW and Lee EK: A long non-coding RNA snaR contributes to 5-fluorouracil resistance in human colon cancer cells. Mol Cells. 37:540–546. 2014. View Article : Google Scholar : PubMed/NCBI

21 

You L, Chang D, Du HZ and Zhao YP: Genome-wide screen identifies PVT1 as a regulator of Gemcitabine sensitivity in human pancreatic cancer cells. Biochem Biophys Res Commun. 407:1–6. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Fang S, Gao H, Tong Y, Yang J, Tang R, Niu Y, Li M and Guo L: Long noncoding RNA-HOTAIR affects chemoresistance by regulating HOXA1 methylation in small cell lung cancer cells. Lab Invest. 96:60–68. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Jiao F, Hu H, Han T, Yuan C and Wang L, Jin Z, Guo Z and Wang L: Long noncoding RNA MALAT-1 enhances stem cell-like phenotypes in pancreatic cancer cells. Int J Mol Sci. 16:6677–6693. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Li J, Zhang M, An G and Ma Q: LncRNA TUG1 acts as a tumor suppressor in human glioma by promoting cell apoptosis. EExp Biol Med. 241:644–649. 2016. View Article : Google Scholar

25 

Liu Z, Sun M, Lu K, Liu J, Zhang M, Wu W, De W, Wang Z and Wang R: The long noncoding RNA HOTAIR contributes to cisplatin resistance of human lung adenocarcinoma cells via downregualtion of p21WAF1/CIP1 expression. PLoS One. 8:e772932013. View Article : Google Scholar : PubMed/NCBI

26 

Aldonza MB, Hong JY, Bae SY, Song J, Kim WK, Oh J, Shin Y, Lee SH and Lee SK: Correction: Suppression of MAPK signaling and reversal of mTOR-dependent MDR1-associated multidrug resistance by 21α-methylmelianodiol in lung cancer cells. PLoS One. 10:e01278412015. View Article : Google Scholar : PubMed/NCBI

27 

Fan Y, Shen B, Tan M, Mu X, Qin Y, Zhang F and Liu Y: Long non-coding RNA UCA1 increases chemoresistance of bladder cancer cells by regulating Wnt signaling. FEBS J. 281:1750–1758. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Cheng N, Li X, Zhao C, Ren S, Chen X, Cai W, Zhao M, Zhang Y, Li J, Wang Q, et al: Microarray expression profile of long non-coding RNAs in EGFR-TKIs resistance of human non-small cell lung cancer. Oncol Rep. 33:833–839. 2015.PubMed/NCBI

29 

Yang X, Zhang Y, Hosaka K, Andersson P, Wang J, Tholander F, Cao Z, Morikawa H, Tegnér J, Yang Y, et al: VEGF-B promotes cancer metastasis through a VEGF-A-independent mechanism and serves as a marker of poor prognosis for cancer patients. Proc Natl Acad Sci USA. 112:E2900–E2909. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Su HY, Lai HC, Lin YW, Liu CY, Chen CK, Chou YC, Lin SP, Lin WC, Lee HY and Yu MH: Epigenetic silencing of SFRP5 is related to malignant phenotype and chemoresistance of ovarian cancer through Wnt signaling pathway. Int J Cancer. 127:555–567. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Xiong W, Jiang YX, Ai YQ, Liu S, Wu XR, Cui JG, Qin JY, Liu Y, Xia YX, Ju YH, et al: Microarray analysis of long non-coding RNA expression profile associated with 5-fluorouracil-based chemoradiation resistance in colorectal cancer cells. Asian Pac J Cancer Prev. 16:3395–3402. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Wu Y, Yu DD, Hu Y, Yan D, Chen X, Cao HX, Yu SR, Wang Z and Feng JF: Genome-wide profiling of long non-coding RNA expression patterns in the EGFR-TKI resistance of lung adenocarcinoma by microarray. Oncol Rep. 35:3371–3386. 2016.PubMed/NCBI

33 

Zhu KP, Zhang CL, Shen GQ and Zhu ZS: Long noncoding RNA expression profiles of the doxorubicin-resistant human osteosarcoma cell line MG63/DXR and its parental cell line MG63 as ascertained by microarray analysis. Int J Clin Exp Pathol. 8:8754–8773. 2015.PubMed/NCBI

34 

Zhou M, Ye Z, Gu Y, Tian B, Wu B and Li J: Genomic analysis of drug resistant pancreatic cancer cell line by combining long non-coding RNA and mRNA expression profling. Int J Clin Exp Pathol. 8:38–52. 2015.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tian X, Zhang H, Zhang B, Zhao J, Li T and Zhao Y: Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells. Oncol Rep 38: 293-300, 2017.
APA
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., & Zhao, Y. (2017). Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells. Oncology Reports, 38, 293-300. https://doi.org/10.3892/or.2017.5691
MLA
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., Zhao, Y."Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells". Oncology Reports 38.1 (2017): 293-300.
Chicago
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., Zhao, Y."Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells". Oncology Reports 38, no. 1 (2017): 293-300. https://doi.org/10.3892/or.2017.5691
Copy and paste a formatted citation
x
Spandidos Publications style
Tian X, Zhang H, Zhang B, Zhao J, Li T and Zhao Y: Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells. Oncol Rep 38: 293-300, 2017.
APA
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., & Zhao, Y. (2017). Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells. Oncology Reports, 38, 293-300. https://doi.org/10.3892/or.2017.5691
MLA
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., Zhao, Y."Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells". Oncology Reports 38.1 (2017): 293-300.
Chicago
Tian, X., Zhang, H., Zhang, B., Zhao, J., Li, T., Zhao, Y."Microarray expression profile of long non-coding RNAs in paclitaxel-resistant human lung adenocarcinoma cells". Oncology Reports 38, no. 1 (2017): 293-300. https://doi.org/10.3892/or.2017.5691
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team