Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
July-August 2013 Volume 1 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-August 2013 Volume 1 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis

  • Authors:
    • Ki‑Tack Kim
    • Jong Seok Lee
    • Byoung Wook Lee
    • Hosik Seok
    • Hye Sook Jeon
    • Jun Ho Kim
    • Joo‑Ho Chung
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedic Surgery, Spine Center, Kyung Hee University East‑West Neo Medical Center, Kangdong‑gu, Seoul 134‑090, Republic of Korea, Department of Emergency Medicine, Kyung Hee University, Dongdaemun‑gu, Seoul 130‑701, Republic of Korea, Department of Biochemistry and Molecular Biology, Kyung Hee University, Dongdaemun‑gu, Seoul 130‑701, Republic of Korea, Kohwang Medical Research Institute, School of Medicine, Kyung Hee University, Dongdaemun‑gu, Seoul 130‑701, Republic of Korea
  • Pages: 619-623
    |
    Published online on: May 9, 2013
       https://doi.org/10.3892/br.2013.101
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Degenerative lumbar scoliosis (DLS) is a spinal deformity that develops after skeletal maturity and progresses with age. In contrast to adolescent idiopathic scoliosis, the genetic association of DLS has not yet been elucidated. The purpose of this study was to investigate the association between regulating synaptic membrane exocytosis 2 (RIMS2, OBOE) gene polymorphisms and DLS. Two coding single‑nucleotide polymorphisms [rs2028945 (Gln1200Gln) and rs10461 (Ala1327Ala)] of RIMS2 were selected and genotyped by direct sequencing. As a result, the rs10461 was associated with DLS in allele frequencies (P=0.008) and genotype distributions (P=0.006 in the codominant model, 0.018 in the dominant model and 0.029 in the recessive model). In the analysis of haplotypes, two haplotypes exhibited significant differences between the control and DLS groups (CC haplotype, P=0.009 in the codominant model, 0.038 in the dominant model and 0.030 in the recessive model; CT haplotype, P=0.041 in the codominant model and 0.021 in the dominant model). These findings suggest that RIMS2 may be associated with the development of DLS.

Introduction

Degenerative lumbar scoliosis (DLS) is defined as a spinal deformity with a Cobb angle of >10°, which develops after skeletal maturity without a previous history of scoliosis. It generally presents in the lumbar or thoracolumbar part of the spine and may be associated with severe back pain (1,2). The prevalence of DLS increases with age and its incidence in patients >50 years of age was reported to be ∼6% (3). The etiology of DLS has not been clearly established. However, the most commonly proposed causes of DLS were ost eoporosis and degenerative diseases of the spinal column (3). Several factors, including life-style, intrinsic mediators and hormonal or genetic factors, are likely to affect the development or the acceleration of DLS (4,5).

Rab3-interacting molecules (RIMs) are presynaptic active zone proteins that perform an essential function in neurotransmitter release (6,7). RIMs were identified as putative effectors for Rab3, which is a synaptic vesicle protein that regulates neurotransmitter release (6,7). RIMs have been shown to interact with multiple synaptic proteins, such as UNC-13 homolog B (C. elegans) (UNC13B, Munc13) (8), ELKS/Rab6-interacting/CAST family member 1 (ERC1, ELKS) (9,10), RIM-binding proteins (RIM-BPs) (11), α-liprins and synaptotagmin 1 (12–14). RIMs are encoded by four regulating synaptic membrane exocytosis genes (RIMS1–4), of which RIMS1, RIMS3 and RIMS4 express a single isoform (RIM1α, 3γ and 4γ, respectively), whereas RIMS2 (RAB3IP3, OBOE) expresses three isoforms (RIM2α, RIM2β and RIM2γ) via independent internal promoters (15).

Two single-nucleotide polymorphisms (SNPs) [rs2028945 (Gln1200Gln) and rs10461 (Ala1327Ala)] in the coding region of RIMS2 in DLS were investigated in this study.

Subjects and methods

Subjects and clinical phenotypes

A total of 51 DLS patients and 145 control subjects were enrolled in this study. DLS patients were recruited from the Spine Center of Kyung Hee University East-West Neo Medical Center (Seoul, Korea) and the National Medical Center (Seoul, Korea) and were selected among ∼10,000 patients per year during a 3-year period. Each patient was diagnosed by a specialized spinal surgeon and fulfilled all physical examination and radiographic criteria. The DLS group comprised 44 females and 7 males and the mean age was 68.67±8.00 years [mean ± standard deviation (SD)]. The Cobb angle in the DLS group was 19.36±7.38° and the lateral listhesis was 4.84±4.24 mm. A left convex curve was observed more frequently compared to a right convex curve (31 and 20 patients, respectively) (Table I). DLS patients were divided into two subgroups according to clinical characteristics, including Cobb angle (≤30° vs. >30°), lateral listhesis (≤5 vs. >5 mm) and curve direction (left vs. right) (16,17). The control group included 145 patients (124 females and 21 males) who were recruited from a general health check-up program after it was confirmed that they had no clinical evidence of scoliosis or any other severe disorders. The gender and age of the control group were matched with those of the DLS group. This study was conducted according to the Declaration of Helsinki guidelines. Written informed consent was obtained from each individual. The research protocol was approved by the Ethics Review Committee of the Medical Research Institute, Kyung Hee University Medical Center, Seoul, Korea.

Table I.

Demographic characteristics of the study subjects.

Table I.

Demographic characteristics of the study subjects.

CharacteristicControl groupDLS group
Number of subjects (n)14551
Male/female (n)124/2144/7
Age (mean ± SD, years)65.57±8.6568.67±8.00
Cobb angle (degrees)19.36±7.38
Lateral listhesis (mm)4.84±4.24
Curve direction (left/right)31/20

[i] DLS, degenerative lumbar scoliosis; SD, standard deviation.

SNP selection and genotyping

We investigated SNPs in the coding region of RIMS2. The related information was obtained from the SNP database (www.ncbi.nlm.nih.gov/SNP, dbSNP BUILD131). The SNPs with unknown heterozygosity, minor allele frequencies <10% and no data regarding Asian populations (rs17854256, rs76323676 and rs61753732) were excluded. Consequently, rs2028945 (Gln1200Gln) and rs10461 (Ala1327Ala) were selected for this investigation. Genomic DNA was extracted from the blood sample of each subject using Qiagen DNA Extraction kit (Qiagen, Tokyo, Japan) following the manufacturer’s instructions and was amplified using the primers for each SNP of RIMS2 (Table II). PCR products were sequenced by an ABI PRISM 3730×l DNA Analyzer (Applied Biosystems Inc., Foster City, CA, USA). Sequence data were analyzed using SeqMan II software (DNASTAR, Inc., Madison, WI, USA).

Table II.

Primer sequences used for each SNP in RIMS2.

Table II.

Primer sequences used for each SNP in RIMS2.

SNPSequence (5′-3′)Product size (bp)
rs2028945
  Sense TCCTCACTGAACACTCATTCAGG543
  Antisense CTCAGCCCAGTGGAATCTTTAAC
rs10461
  Sense AGATCATCGTCTGGGGAGATTA343
  Antisense CCCTAGAAACAGGCTCAGAAGA

[i] SNP, single-nucleotide polymorphism; RIMS2, regulating synaptic membrane exocytosis 2.

Statistical analysis

The Hardy-Weinberg equilibrium (HWE) was assessed using SNPStats (http://bioinfo.iconcologia.net/index.php) (18). The allele frequencies of each SNP were compared by the Pearson’s Chi-square test. The effect of SNP genotypes was analyzed using the codominant, dominant and recessive models. Logistic regression analysis was used to calculate the odds ratio (ORs), 95% confidence intervals (CIs) and P-values with controlling age and gender as covariables. The linkage disequilibrium (LD) was assessed using Haploview software version 4.1 (Broad Institute, Cambridge, MA, USA). LD block was constructed using the Gabriel method (19,20). The association of SNPs and haplotypes was analyzed using SNPStats, HapAnalyzer version 1.0 (http://hap.ngri.go.kr/), and HelixTree (Golden Helix Inc., Bozeman, MT, USA) software.

Statistical analysis was performed using the package of SPSS Statistics software version 17.0 (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

The clinical characteristics of control subjects and DLS patients are summarized in Table I. The mean age of the control and the DLS group was 65.57±8.65 (mean ± SD) and 68.67±8.00 years, respectively. In the DLS group, the average Cobb angle was 19.36±7.38° and the length of the lateral listhesis was 4.84±4.24 mm. Patients with a left convex curve outnumbered those with a right convex curve (31 and 20, respectively) (Table I).

The genotype distributions of rs2028945 and rs10461 were in HWE equilibrium (P>0.05). In an analysis of the allele frequencies on two SNPs, the C allele of rs10461 was more frequently encountered in the DLS group compared to the control group (OR=1.857; 95% CI, 1.174–2.937 and P=0.008) (Table III). In an analysis of the genotype distributions, the rs10461 was associated with DLS (OR=1.93; 95% CI, 1.20–3.10 and P=0.006 in the codominant model; OR=2.62; 95% CI, 1.12–6.13 and P=0.018 in the dominant model, and OR=2.25; 95% CI, 1.10–4.61 and P=0.029 in the recessive model). The rs2028945 was not significantly different between the control and the DLS groups (Table IV). One LD block was constructed between rs2028945 and rs10461 with the Gabriel method (Fig. 1). Of the haplotypes in the block, the CC and CT haplotypes were associated with the risk of DLS (CC haplotype: P=0.009 in the codominant model, P=0.038 in the dominant model and P=0.030 in the recessive model; CT haplotype: P=0.041 in the codominant model and P=0.021 in the dominant model) (Table IV).

Figure 1.

Linkage disequilibrium block between rs2028945 and rs10461 in regulating synaptic membrane exocytosis 2 (RIMS2).

Table III.

Genotype and allele frequencies of RIMS2 polymorphisms in the control and DLS groups.

Table III.

Genotype and allele frequencies of RIMS2 polymorphisms in the control and DLS groups.

SNPTypeControl
DLS
ModelOR (95% CI)P-value
No.(%)No.(%)
rs2028945
Gln1200Gln
Genotype
C/C4933.82039.2Codominant0.72 (0.45–1.16)0.18
C/T6947.62651.0Dominant0.79 (0.40–1.53)0.48
T/T2718.659.8Recessive0.44 (0.16–1.23)0.09
Allele
C16757.66664.71
T12342.43635.30.74 (0.46–1.18)0.21
rs10461
Ala1327Ala
Genotype
T/T4531.0815.7Codominant1.93 (1.20–3.10)0.006
T/C7149.02549.0Dominant2.62 (1.12–6.13)0.018
C/C2920.01835.3Recessive2.25 (1.10–4.61)0.029
Allele
T16155.54140.21
C12944.56159.81.857 (1.174–2.937)0.008

[i] P-values were calculated by logistic regression analysis following adjustment for age and gender. Bold numbers indicate significant association. RIMS2, regulating synaptic membrane exocytosis 2; SNP, single-nucleotide polymorphism; DLS, degenerative lumbar scoliosis; OR, odds ratio; CI, confidence interval.

Table IV.

Haplotype distributions of RIMS2 polymorphisms (rs2028945 and rs10461) in the control and DLS groups.

Table IV.

Haplotype distributions of RIMS2 polymorphisms (rs2028945 and rs10461) in the control and DLS groups.

HaplotypeControl
DLS
ModelOR (95% CI)P-value
No.(%)FreqNo.(%)Freq
HAP1 (CC)
  HH2920.02920.0Codominant1.86 (1.16–2.96)0.009
  H -7149.00.447149.00.60Dominant2.42 (1.05–5.56)0.038
  - -4531.04531.0Recessive2.18 (1.08–4.41)0.030
HAP2 (TT)
  HH2718.62718.6Codominant0.74 (0.46–1.18)0.208
  H -6947.60.426947.60.35Dominant0.79 (0.41–1.53)0.486
  - -4933.84933.8Recessive0.48 (0.17–1.31)0.150
HAP3 (CT)
  HH42.842.8Codominant0.38 (0.15–0.96)0.041
  H -3020.70.133020.70.05Dominant0.28 (0.09–0.83)0.021
  - -11176.611176.6Recessive0.70 (0.08–6.46)0.757

[i] P-values were calculated by logistic regression analysis following adjustment for age and gender. Bold numbers indicate significant association. RIMS2, regulating synaptic membrane exocytosis 2; SNP, single-nucleotide polymorphism; DLS, degenerative lumbar scoliosis; Freq, frequency; OR, odds ratio; CI, confidence interval.

The results obtained in this study were compared with different ethnic populations by searching the human SNP database (www.ncbi.nlm.nih.gov/SNP; dbSNP BUILD 131), which includes the genotype frequencies of each SNP. Genotype distributions in our control subjects were similar to those in Asian populations, particularly the Chinese population (Table V).

Table V.

Genotype distributions of RIMS2 polymorphisms among ethnic populations.

Table V.

Genotype distributions of RIMS2 polymorphisms among ethnic populations.

SNPPopulations
KoreanEuropeanChineseJapaneseSub-Saharan African
rs2028945
  C/C0.3380.8330.2670.1820.850
  C/T0.4760.1670.4890.3410.133
  T/T0.186-0.2440.4770.017
rs10461
  C/C0.2000.4140.2220.1590.153
  C/T0.4900.4830.3560.3410.610
  T/T0.1030.1030.4220.5000.237

[i] From dbSNP BUILD131 (www.ncbi.nlm.nih.gov/SNP). RIMS2, regulating synaptic membrane exocytosis 2; SNP, single-nucleotide polymorphism.

Discussion

DLS develops de novo in adulthood and presents more frequently in the elderly (3). With increasing life expectancy, DLS may complicate degenerative spondylolisthesis, lateral listhesis or spinal stenosis, in which the neural elements are compressed by bone and soft tissue, leading to nerve root ischemia (2). Therefore, patients with accelerated DLS may develop severe back pain and neurological deficits (3). Despite a variety of studies on DLS, the etiology remains unknown. Therefore, the potential of RIMS2 as a candidate gene was evaluated. Our results demonstrated that rs10461 (Ala1327Ala) was significantly associated with DLS. It was hypothesized that the C allele of rs10461 may be a risk factor in the development of DLS (Table III). In addition, two haplotypes (CC and CT) exhibited significant differences between the control and DLS groups. The results indicated that RIMS2 may be associated with DLS. However, RIMS2 polymorphisms were not associated with the clinical features of DLS (Cobb angle, lateral listhesis and curve direction) (data not shown).

RIMS comprise four members, RIMS1–4. RIMS1 and RIMS2 are 512.7 and 747.9 kb in size, respectively, whereas RIMS3 and RIMS4 are 15.4 and 54.5 kb, respectively (8,15). RIMS1 expresses RIM1α; the gene may encode a single isoform. By contrast, RIMS2 encodes three isoforms (RIM2α, RIM2β and RIM2γ); besides the exon for the α isoform, two additional separate exons in RIMS2 may encode the N-termini of RIM2β and RIM2γ through β- and γ-specific promoters, respectively. RIMS3 and RIMS4 express a single isoform, RIM3γ and RIM4γ, respectively (8,15). The α-RIMs (RIM1α and RIM2α) contain the full complement of domains which are the N-terminal Zn2+-finger domain, the central PDZ and C2A domains and the C-terminal C2B domain (15). They are able to bind to Rab3 and Munc13 proteins (13,21,22) and closely interact with α-liprins (13), which in turn regulate the active zone structure (23,24). Therefore, α-RIMs are considered to be essential for regulating neurotransmitter releases (8,13,25,26), some of which are involved in the neurobiology of schizophrenia (27,28).

The exocytosis of neurotransmitter-filled synaptic vesicles is under tight regulation in presynaptic nerve terminals. RIMs may mediate the regulation of exocytosis via interacting with multiple synaptic proteins, such as Rab3 (6,7), Munc13 (8), ELKS (9,10), RIM-BPs (11), α-liprins and synaptotagmin 1 (12–14). In addition, RIMs are indirectly connected with the active zone proteins Piccolo and Bassoon via ELKS (29). In a previous study, the experimental loss of α-RIMs resulted in the severe impairment of motor control, profound defects of synaptic transmission at neuromuscular junctions and increment of irregularly distributed motor synapses in skeletal muscle fibers (8). These results suggested that RIMs may affect the function of the neuromuscular system. However, no published studies assessing the potential role of RIMs in bone degeneration or the genetic association of RIMS polymorphisms in DLS are available. We demonstrated that RIMS2, known as a regulatory gene for synaptic membrane exocytosis in the central nervous system, may be a candidate gene associated with the risk of DLS in the Korean population. However, additional studies including a larger number of subjects and different populations are required to confirm these findings. In conclusion, the rs10461 in RIMS2 was associated with DLS in the Korean population. This finding suggests that RIMS2 may affect the development of DLS.

Abbreviations:

RIMS2

regulating synaptic membrane exocytosis 2

SNP

single-nucleotide polymorphism

HWE

Hardy-Weinberg equilibrium

LD

linkage disequilibrium

DLS

degenerative lumbar scoliosis

References

1. 

Aebi M: The adult scoliosis. Eur Spine J. 14:925–948. 2005. View Article : Google Scholar

2. 

Ploumis A, Transfledt EE and Denis F: Degenerative lumbar scoliosis associated with spinal stenosis. Spine J. 7:428–436. 2007. View Article : Google Scholar

3. 

Oskouian RJ Jr and Shaffrey CI: Degenerative lumbar scoliosis. Neurosurg Clin N Am. 17:299–315. 2006. View Article : Google Scholar

4. 

Ferrari S, Rizzoli R and Bonjour JP: Heritable and nutritional influences on bone mineral mass. Aging (Milano). 10:205–213. 1998.PubMed/NCBI

5. 

Kawaguchi Y, Kanamori M, Ishihara H, Ohmori K, Matsui H and Kimura T: The association of lumbar disc disease with vitamin-D receptor gene polymorphism. J Bone Joint Surg Am. 84-A:2022–2028. 2002.PubMed/NCBI

6. 

Dresbach T, Qualmann B, Kessels MM, Garner CC and Gundelfinger ED: The presynaptic cytomatrix of brain synapses. Cell Mol Life Sci. 58:94–116. 2001. View Article : Google Scholar : PubMed/NCBI

7. 

Lonart G: RIM1: an edge for presynaptic plasticity. Trends Neurosci. 25:329–332. 2002. View Article : Google Scholar : PubMed/NCBI

8. 

Schoch S, Mittelstaedt T, Kaeser PS, et al: Redundant functions of RIM1α and RIM2α in Ca2+-triggered neurotransmitter release. EMBO J. 25:5852–5863. 2006.

9. 

Ohtsuka T, Takao-Rikitsu E, Inoue E, et al: Cast: a novel protein of the cytomatrix at the active zone of synapses that forms a ternary complex with RIM1 and munc13-1. J Cell Biol. 158:577–590. 2002. View Article : Google Scholar : PubMed/NCBI

10. 

Wang Y, Liu X, Biederer T and Südhof TC: A family of RIM-binding proteins regulated by alternative splicing: implications for the genesis of synaptic active zones. Proc Natl Acad Sci USA. 99:14464–14469. 2002. View Article : Google Scholar : PubMed/NCBI

11. 

Wang Y, Sugita S and Südhof TC: The RIM/NIM family of neuronal C2domain proteins. Interactions with Rab3 and a new class of Src homology 3 domain proteins. J Biol Chem. 275:20033–20044. 2000.PubMed/NCBI

12. 

Coppola T, Magnin-Luthi S, Perret-Menoud V, et al: Direct interaction of the Rab3 effector RIM with Ca2+channels, SNAP-25, and synaptotagmin. J Biol Chem. 276:32756–32762. 2001. View Article : Google Scholar : PubMed/NCBI

13. 

Schoch S, Castillo PE, Jo T, et al: RIM1alpha forms a protein scaffold for regulating neurotransmitter release at the active zone. Nature. 415:321–326. 2002. View Article : Google Scholar : PubMed/NCBI

14. 

Schoch S and Gundelfinger ED: Molecular organization of the presynaptic active zone. Cell Tissue Res. 326:379–391. 2006. View Article : Google Scholar : PubMed/NCBI

15. 

Wang Y and Südhof TC: Genomic definition of RIM proteins: evolutionary amplification of a family of synaptic regulatory proteins. Genomics. 81:126–137. 2003. View Article : Google Scholar : PubMed/NCBI

16. 

Pritchett JW and Bortel DT: Degenerative symptomatic lumbar scoliosis. Spine (Phila Pa 1976). 18:700–703. 1993. View Article : Google Scholar : PubMed/NCBI

17. 

Chin KR, Furey C and Bohlman HH: Risk of progression in de novo low-magnitude degenerative lumbar curves: natural history and literature review. Am J Orthop (Belle Mead NJ). 38:404–409. 2009.PubMed/NCBI

18. 

Solé X, Guinó E, Valls J, Iniesta R and Moreno V: SNPStats: a web tool for the analysis of association studies. Bioinformatics. 22:1928–1929. 2006.

19. 

Gabriel SB, Schaffner SF, Nguyen H, et al: The structure of haplotype blocks in the human genome. Science. 296:2225–2229. 2002. View Article : Google Scholar : PubMed/NCBI

20. 

Barrett JC, Fry B, Maller J and Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 21:263–265. 2005. View Article : Google Scholar : PubMed/NCBI

21. 

Betz A, Thakur P, Junge HJ, et al: Functional interaction of the active zone proteins Munc13-1 and RIM1 in synaptic vesicle priming. Neuron. 30:183–196. 2001. View Article : Google Scholar : PubMed/NCBI

22. 

Wang X, Hu B, Zimmermann B and Kilimann MW: Rim1 and rabphilin-3 bind Rab3-GTP by composite determinants partially related through N-terminal alpha-helix motifs. J Biol Chem. 276:32480–32488. 2001. View Article : Google Scholar : PubMed/NCBI

23. 

Zhen M and Jin Y: The liprin protein SYD-2 regulates the differentiation of presynaptic termini in C. elegans. Nature. 401:371–375. 1999. View Article : Google Scholar : PubMed/NCBI

24. 

Kaufmann N, DeProto J, Ranjan R, et al: Drosophila liprin-alpha and the receptor phosphatase Dlar control synapse morphogenesis. Neuron. 34:27–38. 2002. View Article : Google Scholar

25. 

Koushika SP, Richmond JE, Hadwiger G, et al: A post-docking role for active zone protein Rim. Nat Neurosci. 4:997–1005. 2001. View Article : Google Scholar : PubMed/NCBI

26. 

Castillo PE, Schoch S, Schmitz F, et al: RIM1alpha is required for presynaptic long-term potentiation. Nature. 415:327–330. 2002. View Article : Google Scholar : PubMed/NCBI

27. 

Weidenhofer J, Bowden NA, Scott RJ and Tooney PA: Altered gene expression in the amygdala in schizophrenia: up-regulation of genes located in the cytomatrix active zone. Mol Cell Neurosci. 31:243–250. 2006. View Article : Google Scholar : PubMed/NCBI

28. 

Weidenhofer J, Scott RJ and Tooney PA: Investigation of the expression of genes affecting cytomatrix active zone function in the amygdala in schizophrenia: effects of antipsychotic drugs. J Psychiatr Res. 43:282–290. 2009. View Article : Google Scholar : PubMed/NCBI

29. 

Takao-Rikitsu E, Mochida S, Inoue E, et al: Physical and functional interaction of the active zone proteins, CAST, RIM1, and Bassoon, in neurotransmitter release. J Cell Biol. 164:301–311. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim KT, Lee J, Lee B, Seok H, Jeon H, Kim J and Chung JH: Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis. Biomed Rep 1: 619-623, 2013.
APA
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., & Chung, J. (2013). Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis. Biomedical Reports, 1, 619-623. https://doi.org/10.3892/br.2013.101
MLA
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., Chung, J."Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis". Biomedical Reports 1.4 (2013): 619-623.
Chicago
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., Chung, J."Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis". Biomedical Reports 1, no. 4 (2013): 619-623. https://doi.org/10.3892/br.2013.101
Copy and paste a formatted citation
x
Spandidos Publications style
Kim KT, Lee J, Lee B, Seok H, Jeon H, Kim J and Chung JH: Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis. Biomed Rep 1: 619-623, 2013.
APA
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., & Chung, J. (2013). Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis. Biomedical Reports, 1, 619-623. https://doi.org/10.3892/br.2013.101
MLA
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., Chung, J."Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis". Biomedical Reports 1.4 (2013): 619-623.
Chicago
Kim, K., Lee, J., Lee, B., Seok, H., Jeon, H., Kim, J., Chung, J."Association between regulating synaptic membrane exocytosis 2 gene polymorphisms and degenerative lumbar scoliosis". Biomedical Reports 1, no. 4 (2013): 619-623. https://doi.org/10.3892/br.2013.101
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team