Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
May-2015 Volume 3 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 3 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Isolation and genetic characterization of enterovirus in patients with febrile rash illness

  • Authors:
    • Zhaohui Ni
    • Fengyang Xiang
    • Honglan Huang
    • Guoqing Wang
    • Fan Li
  • View Affiliations / Copyright

    Affiliations: Department of Pathogenobiology, The Key Laboratory of Zoonosis, Chinese Ministry of Education, College of Basic Medical Science, Jilin University, Changchun, Jilin 130021, P.R. China
  • Pages: 375-378
    |
    Published online on: March 5, 2015
       https://doi.org/10.3892/br.2015.441
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Measles and rubella virus are usually considered as the causative agents in patients with febrile rash illness (FRI). However, investigators have identified that enteroviruses are also associated with FRI, and the present study was undertaken to investigate this association. In the study, 20 throat swab samples were collected from patients suffering from rash and fever between April and July in 2013. The 20 samples tested negative for measles virus, but all were positive when reverse transcription‑polymerase chain reaction was performed using enterovirus universal primers. Specifically, five tested positive for Coxsackie B3 virus (CVB3). The titers of the five CVB3 isolates were 106.5, 106.4, 107.5, 106.5 and 106.5 tissue culture infectious dose50/100 µl respectively. The partial VP1 sequences of the five CVB3 isolates were identical to each other and were closely associated with the CVB3/MKP and CVB3/Macocy strains, which are known to induce myocarditis and neonatal diseases of the central nervous system. In conclusion, CVB3 may cause symptoms of fever and rash and should be differentiated from measles, rubella and other infectious pathogens. The five CVB3 isolates described in the study were genetically similar to each other and to other local CVB3 strains. The results provide further data on the viral pathogen spectrum associated with FRI.

Introduction

Febrile rash illness (FRI) is highly contagious and clinically manifests as fever (temperature ≥37.5°C) and a systemic, local skin or mucous membrane rash (1). FRI may be accompanied by other clinical symptoms, such as upper respiratory inflammation, conjunctivitis and systemic mucosal plaques. Viruses associated with FRI include measles (2), rubella (3), enterovirus, varicella-zoster and parvovirus B19 (4). In 1978, China implemented a policy of planned immunization in order to control the incidence of measles. As a result, the incidence of measles has reduced significantly. However, enteroviruses can also cause a similar rash and fever syndrome normally associated with atypical measles. The main enteroviruses include Coxsackie virus A16 and EV71, which cause hand, foot and mouth disease in children. Ju et al (5) reported that the main viruses causing FRI in Guangdong, China between 2010 and 2012 were EV71 and CVA16, accounting for <82% of all cases. Coxsackie B3 virus (CVB3) is the main pathogen associated with human viral myocarditis and dilated cardiomyopathy (6). In addition, studies have reported that CVB3 is associated with aseptic meningitis and encephalitis (7) and has also been isolated from patients suffering from hand, foot and mouth disease (8). However, to the best of our knowledge, there are few studies regarding the association between the enterovirus infections, particularly CVB3 infection and FRI. To improve the understanding of the genetic characteristics of enterovirus and its association with RFI in China, a study was conducted of the etiology of fever-rash illnesses in Jilin, China in 2013.

Materials and methods

Sample processing

Twenty throat swab samples were obtained from the Center for Disease Control and Prevention (CDC) of Jilin, China. Each sample was resuspended in 3 ml of Dulbecco's modified Eagle's medium (DMEM) supplemented with 2% fetal bovine serum. The samples were subsequently stored at −80°C until further use. Vero cells in DMEM containing 2% fetal bovine serum were inoculated with 200 µl of resuspended sample and incubated at 37°C in a 5% CO2 atmosphere. The cells were observed daily for cytopathic effects (CPE). At least two passages were performed before the culture was regarded as negative for CPE. Following complete CPE, the cells were freeze/thawed three times and subsequently centrifuged at 8,000 × g at 4°C for 15 min. The supernatant was collected and stored at −80°C.

Viral titer determination

Ten-fold serial dilutions (10−1 to 10−10) were made for each virus. Each dilution of virus was inoculated into 8 wells of a 96-well plate containing Vero cells. The plates were incubated at 37°C for 7 days. Viral titers were calculated using the Reed-Muench method (9).

RNA extraction, reverse transcription-polymerase chain reaction (RT-PCR) and sequencing

Total RNA was extracted from the infected cell suspension using the Qiagen Viral RNA Mini kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. The extracted RNA was used as a template for RT-PCR amplification using Takara RT-PCR kit version 3.0. The enterovirus universal primers and specific primers of the VP1 genes for CVB3, CVA16 and EV71 are listed in Table I. RT was performed at 42°C for 30 min followed by a denaturation step at 95°C for 5 min. The cycling conditions for enterovirus specific PCR were as follows: Initial denaturation at 94°C for 1 min, 40 cycles at 94°C for 1 min, 50°C for 1 min and 72°C for 90 sec, and a final extension at 72°C for 10 min. The thermocycling conditions for CVB3 were as follows: Initial denaturation at 94°C for 2 min, 30 cycles at 94°C for 30 sec, 55°C for 45 sec and 72°C for 45 sec, and a final elongation step at 72°C for 8 min. RT-PCR products were gel purified and sent for sequencing at the Sangon Biotech Institute Co., Ltd. (Shanghai, China).

Table I.

RT-PCR primers.

Table I.

RT-PCR primers.

PrimerSequenceProduct, bp
Enterovirus universal primerF: CAAGCACTTCTGTTTCCCCGG450
R: ATTGTCACCATAAGCAGCCA
CVB3 specific primerF: AGGAATTCATGGAAGACGCGATAAC772
R: TGTCTAGATGCTTTGCCTAGTAGTG
CVA16 specific primerF: TTGCAGACATGATTGACCAG211
R: GAGTGATGGTTCAACACACA
EV71 specific primerF: GCAGCCCAAAAGAACTTCAC226
R: ATTTCAGGAGCTTGGAGTGC

[i] RT-PCR, reverse transcription-polymerase chain reaction; CVB3, Coxsackie B3 virus; bp, base pairs.

Data analysis

The GenBank database was searched for similar sequences using the BLAST program. Nucleotide and deduced amino acid sequences of the viruses were aligned using the BioEdit 7.0.5.3 software (10) and subsequently compared with each other and with the reference sequences of homologous CVB3 retrieved from the GenBank database. Phylogenetic trees were generated using Mega 6.0 (11) and the maximum likelihood method and Kimura two-parameter model. Bootstrapping was performed with 1,000 replicates.

Results

Isolation and virus identification

Twenty throat swabs were collected from patients who presented with symptoms of FRI (temperature ≥37.5°C and a rash on the face, neck or trunk) between April and June 2013 in three different areas of Jilin, China. All the samples were provided by the Jilin Provincial CDC. The 20 samples were all positive for enterovirus by RT-PCR. When specific primers for CVB3, CVA16 and EV71 were used, only five samples were positive for CVB3. The other 15 samples were negative for these three viruses. Specific details of the five positive samples (JL-01, JL-02, JL-03, JL-04 and JL-05) are shown in Table II.

Table II.

CVB3 sample data.

Table II.

CVB3 sample data.

No.GenderAgeAreaSpecimen typeRash and fever
JL-01Male2 yHunchunThroat swabYes
JL-02Male39 yTumenThroat swabYes
JL-03Female27 yTumenThroat swabYes
JL-04Male4 mDunhuaThroat swabYes
JL-05Male1 yHunchunThroat swabYes

[i] CVB3, Coxsackie B3 virus; m, months; y, years.

Virus titers

The titers of JL-01, JL-02, JL-03, JL-04 and JL-05 were 106.5, 106.4, 107.5, 106.5 and 106.5 tissue culture infectious dose50/100 µl, respectively, indicating a strong ability to infect Vero cells.

Sequence analysis of VP1

The amplified VP1 fragments of CVB3 were 772 base pairs. Comparisons of the VP1 gene fragments indicated that the five CVB3 viruses were between 99.99–100% identical at the nucleotide and amino acid levels. In addition, all the isolates were 99.99% identical at the nucleotide and amino acid levels to the CVB3/MKP and CVB3/Macocy viruses, which have been reported to induce myocarditis and central nervous system disease (12,13), respectively. The phylogenetic analysis using the VP1 sequences (Fig. 1) showed that the five CVB3 isolates were genetically distinct from the CVB3/96HN.3/SD (JQ364844) and CVB3/01318/SD (JQ364847) viruses, which have been isolated from Shandong and are known to cause aseptic meningitis (14). DQ000164 and AF169026, which were isolated from Harbin and Beijing in 2005 and 1999, are located on the same branch with the five CVB3 isolates in the present study.

Figure 1.

Phylogenetic tree of the CVB3 strains based on partial sequencing of the VP1 gene. All the strains are from different locations in China. CVB3, Coxsackie B3 virus.

Discussion

Rash and fever can be caused by infections, allergies and connective tissue diseases. Currently, the primary viruses known to cause rash and fever are measles, varicella, parvovirus B19 and enterovirus. Measles is a highly contagious disease and is often accompanied by serious complications. Since the global implementation of the measles immunization program, the incidence of measles has decreased significantly, while parvovirus B19 infection rates have been increasing. The enteroviruses most frequently reported are EV71 and CVA16, which cause hand, foot and mouth disease in children. CVB3 is reported less often, however, it is most often associated with viral myocarditis. With the development of molecular biological techniques, the biology of CVB3 has become clearer (15). However, due to variability in the CVB3 genome, the same serotypes can exhibit differences in virulence and cell tropism (16). The susceptibility and clinical manifestations of different populations to CVB3 can vary. In addition, CVB3 infections are predominantly asymptomatic, so they can be missed or misdiagnosed.

In the present study, 20 samples from individuals suffering from RFI tested negative for measles and positive for enterovirus. Specifically, CVB3 was isolated from five of the samples. The isolates were able to infect Vero cells, indicating pathogenicity (12). Further studies are required to identify the enterovirus(es) present in the remaining 15 samples.

The VP1 region is particularly important in the molecular characterization of enteroviruses. VP1 possesses neutralizing epitopes that directly affect the antigenicity of the virus. By analyzing the CVB3 VP1 sequence, five CVB3 viruses isolated in the present study were similar to each other and other local Chinese isolates. The homology of nucleotides and amino acids were 99.73–99.99% and 99.93–99.99%, respectively, suggesting that the VP1 region of Chinese CVB3 isolates is highly conservative. These results indicate that the CVB3/MKP and CVB3/Macocy viruses, which induce myocarditis and central nervous system disease, respectively, are located in the same clade as the five isolates identified in the present study, suggesting that they may have tropism characteristics for the heart and the central nervous system. However, further studies are required to confirm this observation.

In conclusion, CVB3 may be responsible for RFI. In addition, sequence data was generated for the VP1 gene from CVB3 isolates. The present study provides a basis for future research on these viruses in Jilin, China.

Acknowledgements

The authors would like to thank Dr Jiang Bian from the CDC of Jilin, China, for collecting the samples used in the present study. The study was supported by the National Natural Science Foundation of China (grant nos. 81271897 and 81472662), Foundation of Jilin Provincial Health Department (grant no. 2012Z083) and the Basic Scientific Research Program of Jilin University.

References

1 

de Moraes JC, Toscano CM, de Barros EN, Kemp B, Lievano F, Jacobson S, Afonso AMS, Strebel PM and Cairns KL: VigiFex Group: Etiologies of rash and fever illnesses in Campinas, Brazil. J Infect Dis. 204:(Suppl 2). S627–S636. 2011. View Article : Google Scholar : PubMed/NCBI

2 

World Health Organization: Manual for the laboratory diagnosis of measles and rubella virus infection2nd. Geneva, Switzerland: 2007

3 

Andrus JK and Periago MR: Elimination of rubella and congenital rubella syndrome in the Americas: Another opportunity to address inequities in health. Rev Panam Salud Publica. 15:145–146. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Ramsay M, Reacher M, O'Flynn C, Buttery R, Hadden F, Cohen B, Knowles W, Wreghitt T and Brown D: Causes of morbilliform rash in a highly immunised English population. Arch Dis Child. 87:202–206. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Ju XF, Xu AG, Fang QY and Huang JM: Etiology study on febrile rash illness in Guangdong 2010–2012. Chin J Dis Control Prev ISTIC. 17:670–673. 2013.

6 

Fairweather D, Stafford KA and Sung YK: Update on coxsackievirus B3 myocarditis. Curr Opin Rheumatol. 24:401–407. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Tao Z, Wang H, Li Y, Liu G, Xu A, Lin X, Song L, Ji F, Wang S, Cui N, et al: Molecular epidemiology of human enterovirus associated with aseptic meningitis in Shandong Province, China, 2006–2012. PLoS One. 9:e897662014. View Article : Google Scholar : PubMed/NCBI

8 

Wong AH, Lau CS, Cheng PK, Ng AY and Lim WW: Coxsackievirus B3-associated aseptic meningitis: An emerging infection in Hong Kong. J Med Virol. 83:483–489. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Reed LJ and Muench H: A simple method of estimating fifty per cent endpoints. Am J Epidemiol. 27:493–497. 1938.

10 

Hall TA: BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 41:95–98. 1999.

11 

Tamura K, Stecher G, Peterson D, Filipski A and Kumar S: MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 30:2725–2729. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Liu B, Li Z, Xiang F, Li F, Zheng Y and Wang G: The whole genome sequence of coxsackievirus B3 MKP strain leading to myocarditis and its molecular phylogenetic analysis. Virol J. 11:332014. View Article : Google Scholar : PubMed/NCBI

13 

Wang L, Dong C, Chen D-E and Song Z: Coxsackievirus-induced acute neonatal central nervous system disease model. Int J Clin Exp Pathol. 7:858–869. 2014.PubMed/NCBI

14 

Tao Z, Song Y, Li Y, Liu Y, Jiang P, Lin X, Liu G, Song L, Wang H and Xu A: Coxsackievirus B3, Shandong Province, China, 1990–2010. Emerg Infect Dis. 18:1865–1867. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Chapman NM1, Tu Z, Tracy S and Gauntt CJ: An infectious cDNA copy of the genome of a non-cardiovirulent coxsackievirus B3 strain: its complete sequence analysis and comparison to the genomes of cardiovirulent coxsackieviruses. Arch Virol. 135:115–130. 1994. View Article : Google Scholar : PubMed/NCBI

16 

Tu Z, Chapman NM, Hufnagel G, Tracy S, Romero JR, Barry WH, Zhao L, Currey K and Shapiro B: The cardiovirulent phenotype of coxsackievirus B3 is determined at a single site in the genomic 5′ nontranslated region. J Virol. 69:4607–4618. 1995.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ni Z, Xiang F, Huang H, Wang G and Li F: Isolation and genetic characterization of enterovirus in patients with febrile rash illness. Biomed Rep 3: 375-378, 2015.
APA
Ni, Z., Xiang, F., Huang, H., Wang, G., & Li, F. (2015). Isolation and genetic characterization of enterovirus in patients with febrile rash illness. Biomedical Reports, 3, 375-378. https://doi.org/10.3892/br.2015.441
MLA
Ni, Z., Xiang, F., Huang, H., Wang, G., Li, F."Isolation and genetic characterization of enterovirus in patients with febrile rash illness". Biomedical Reports 3.3 (2015): 375-378.
Chicago
Ni, Z., Xiang, F., Huang, H., Wang, G., Li, F."Isolation and genetic characterization of enterovirus in patients with febrile rash illness". Biomedical Reports 3, no. 3 (2015): 375-378. https://doi.org/10.3892/br.2015.441
Copy and paste a formatted citation
x
Spandidos Publications style
Ni Z, Xiang F, Huang H, Wang G and Li F: Isolation and genetic characterization of enterovirus in patients with febrile rash illness. Biomed Rep 3: 375-378, 2015.
APA
Ni, Z., Xiang, F., Huang, H., Wang, G., & Li, F. (2015). Isolation and genetic characterization of enterovirus in patients with febrile rash illness. Biomedical Reports, 3, 375-378. https://doi.org/10.3892/br.2015.441
MLA
Ni, Z., Xiang, F., Huang, H., Wang, G., Li, F."Isolation and genetic characterization of enterovirus in patients with febrile rash illness". Biomedical Reports 3.3 (2015): 375-378.
Chicago
Ni, Z., Xiang, F., Huang, H., Wang, G., Li, F."Isolation and genetic characterization of enterovirus in patients with febrile rash illness". Biomedical Reports 3, no. 3 (2015): 375-378. https://doi.org/10.3892/br.2015.441
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team