This article is mentioned in:

Introduction

Ultrasound (US) is a sound wave with frequencies >20 kHz and has been widely used in diagnosis and therapy in medicine (1-6). Acoustic intensities for diagnosis are typically <100 mW/cm2 (1-3). In cancer therapy, high-intensity focused ultrasound is used (5,6). For example, the acoustic intensity used for prostate cancer ranges from 100 to 10,000 mW/cm² spatial average-temporal average intensity (ISATA) (6). Low-intensity pulsed US (LIPUS) is a well-recognized non-invasive therapy and has garnered attention as a potential adjunctive therapy for accelerating bone fracture healing (3,4). LIPUS clinical protocol for fractures involves a 1.5 MHz sine wave repeated at 1 kHz at 30 mW/cm2 ISATA with a pulsed width of 200 µsec for 20 min/day (3,4). LIPUS has been shown to augment bone fracture healing in experimental animal models, using rabbits (7), rats (8,9) and mice (10), as well as clinical settings (11,12). Although molecular mechanisms underlying the effects of LIPUS remain poorly elucidated, numerous in vitro studies have demonstrated positive osteogenic effects of LIPUS on bone cells during fracture healing (13-21).

Mammalian bone is an active mineralized connective tissue composed of three types of cell: Osteoblasts, osteoclasts and osteocytes (22). Mechanical loading has also been widely recognized as an essential factor for the maintenance of bone. It is well known that both bone matrix and osteocytes play an important role in sensing mechanical loading of bone (23-25). Similarly, the teleost scale is a unique calcified tissue in which osteoclasts, osteoblasts and two layers of the bone matrix are present (26-28). Furthermore, our previous study demonstrated the existence of osteocyte-like cells in goldfish scales (29). Fish scales are therefore a suitable model for bone mechanotransduction, the conversion of mechanical stimulus into a biological response. Osteoblasts and osteoclasts in goldfish scales respond sensitively to mechanical loading such as hypergravity (27), microgravity (30) and ultrasound (16,31,32).

RNA-sequencing (RNA-seq) using next-generation sequencing (NGS) technology is a powerful tool that applies genome-wide expression profiles to a wider range of organisms, even in non-model organisms with no established databases, compared with DNA microarray (33). Our previous studies reported that melatonin suppresses osteoclast activation and cell damage induced by space flight in goldfish scales using RNA-seq method (30,34). The present study examined the effects of LIPUS (30 mW/cm2) on the osteoblasts and osteoclasts of goldfish scales and performed global-scale gene expression analysis of scales treated with LIPUS using RNA-seq to determine the underlying mechanism.

Materials and methods

Animals and preparation of fish scales. Goldfish (Carassius auratus) were obtained from Higashikawa Fish Farm (Yamatokoriyama, Japan). A total of 12 male fish (weight, 30-40 g; age, ~2 years) were fed a commercial pellet diet (Spectrum Brands Japan) every morning and were maintained in freshwater (pH, 7.0-7.5) at 26˚C under a 12 h light/12 h dark cycle (32). All experimental procedures were conducted in accordance with the Guide for Care and Use of Laboratory Animals and approved by Animal Research Committee of Kanazawa University (approval no. 242-2023) and were performed under anesthesia to minimize pain. In addition, all experimental protocols were in strict accordance with the ARRIVE guidelines 2.0(35).

Regenerating scales that had active osteoclasts and osteoblasts were used for analysis of LIPUS treatments (27). In brief, goldfish were anesthetized in freshwater containing ethyl 3-aminobenzoate methanesulfonic acid salt (MS-222; 330 mg/l; Sigma-Aldrich; Merck KGaA) (34). Adequate anesthesia was indicated cessation of opercular movements. The normal scales that developed on the body were removed to allow the regeneration of scales under anesthesia. The anesthetized fish were returned to freshwater, allowed to recover and the goldfish were maintained as aforementioned. Behavior and feeding activity were monitored daily to check health. At 14 days after the removal of normal scales, regenerating scales were removed from the goldfish under anesthesia and were placed in a 6-well cell culture plate (Nippon Genetics, Co., Ltd.) with 2 ml Leibovitz's L-15 medium (Invitrogen; Thermo Fisher Scientific, Inc.) containing 1% penicillin-streptomycin mixture (ICN Biomedicals, Inc.) and incubated for 2 h at 15˚C before use (27,32). Goldfish were anesthetized using MS-222. Once opercular movements ceased, anesthesia was continued for an additional 40 min to euthanize the goldfish. The goldfish, which were no longer responding to stimuli and not moving, were then returned to freshwater. Death was confirmed following no recovery within 20 min.

LIPUS treatment and temperature measurement of culture medium

LIPUS treatment was applied using an ultrasound irradiating system in a 6-well cell culture plate (No. US-Vitro-N04-48; Teijin Pharma, Ltd.; Fig. 1) (36). (3,4). The signal had an ISATA of 30 mW/cm2, with a frequency of 1.5 MHz in a pulsed-wave mode (0.2-sec burst sine waves repeated at 1.0 kHz). When the scales were treated with LIPUS, the 6-well cell culture plate containing scales was placed on the transducer. LIPUS was transmitted through the bottom of the cell culture plate. The scales were irradiated with LIPUS for 20 min at room temperature. For control group, the scales were incubated for 20 min without LIPUS treatment in the aforementioned LIPUS-exposure setup as described above. The treated scales were further incubation for 3, 6 or 24 h at 15˚C.

Figure 1 Schematic illustration of the low-intensity pulsed ultrasound irradiation system.

The biophysical effects of ultrasound on living tissue are divided into thermal and non-thermal effects (2). Temperature of the culture medium was monitored with a digital thermometer coupled to a type K thermocouple sensor (Sato Keiryoki MFG Co., Ltd.) at room temperature (37).

Assay of alkaline phosphatase (ALP) and tartrate-resistant acid phosphatase (TRAP) activity

ALP or TRAP activity was measured using alkaline (1 mM MgCl2 and 100 mM Tris-HCl, pH 9.5) or acidic buffer (100 mM sodium acetate and 20 mM tartrate, pH 5.3), respectively. In short, a 100 µl aliquot of alkaline or acidic buffer was added to each well at room temperature. Then, each scale was placed into a well in a 96-well microplate. This microplate was immediately frozen at -80˚C and then kept at -20˚C until analysis. A 100 µl aliquot of 20 mM para-nitrophenyl (pNP) phosphate in alkaline or acidic buffer was added to each well at room temperature. The plate was incubated at 23˚C for 20 min with shaking. The reaction was stopped by adding 50 µl 3 M NaOH. A total of 150 µl reacted solution was transferred to a new plate and the absorbance was measured at 405 nm. The absorbance was converted into the amount of pNP produced using a standard curve. After measuring both ALP and TRAP activity, the scales were measured with Image J software (Ver. 1.53; https://imagej.net/ij/index.html). ALP and TRAP activities were normalized to the surface area (mm2) of each scale (27).

RNA isolation

Total RNA was isolated from the regenerating scales of goldfish using RNeasy Fibrous Tissue Mini kit (cat. no. 74704; Qiagen GmbH). The concentration of RNA was measured by spectroscopy with an expected A260/A280 ratio close to 2. RNA quality was analyzed using a Bioanalyzer 2100 and RNA 6000 Nano kit (Cat. No. 5067-1511; Agilent Technologies, Inc.). Total RNA with RNA integrity number >9.0 was used for RNA-seq and reverse transcription-quantitative (RT-q)PCR.

RNA-seq, gene expression and gene network analyses

RNA-seq was performed by Veritas Genetics Co. The analysis was conducted with the Novaseq6000 sequencer (Illumina, Inc.), and data of nucleotide length 150 bp (directional paired-end reads) was provided.

Quality check of raw read sequences was performed using FastQC (Ver. 0.11.8; http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Adaptors and short, low-quality reads (Q<20; <50 bp) were trimmed using TrimGalore (Ver. 1.18; bioinformatics.babraham.ac.uk/projects/trim_galore/). For de novo transcriptome assembly and read mapping, following PCR duplicate removal using seqkit (38), de novo transcriptome assembly of processed reads was performed using Trinity (r2012-10-05; cell-innovation.nig.ac.jp/index_en.html) was used with default parameters to generate a reference sequence of transcripts (33). To estimate relative RNA expression levels as transcripts per million reads (TPM), sequence reads with PCR duplicates were pseudo-mapped to the reference sequence of transcripts using Kallisto with strict parameters (k-mer size: 31; bootstrap-samples: 0; min-size: automatically chosen; ec-max-size: no maximum) (39). To normalize gene expression, statistical analysis of TPM was performed using Strand NGS v3.3 with the Trimmed Mean of M value (TMM) (40). TMM is a normalized method that is generally used for analyzing omics data (https://genomebiology.biomedcentral.com/articles/10.1186/gb-2010-11-3-r25). Furthermore, differentially expressed genes (DEGs) in LIPUS, compared with LIPUS non-treated scales, were identified using unpaired t-test and multiple testing Benjamini-Hochberg correction. Genes were considered differentially expressed when P<0.05 and fold-change ≥1.2. The obtained data were analyzed using Ingenuity® Pathway Analysis tools (Qiagen GmbH) to examine Gene Ontology (geneontology.org/) enrichment, including biological processes, cellular components, molecular functions, and gene networks. Upregulated genes at 3, 6 and 24 h after LIPUS treatment were uploaded to the Ingenuity® Pathway Analysis tools. Core analysis was performed, followed by analysis of biological functions, especially osteoblastic differentiation. Candidate genes were analyzed using Gene Network Analysis to generate gene networks based on known interactions (37,41).

RT-qPCR

Complementary DNA was produced from total RNA using a PrimeScript™ RT kit with gDNA Eraser (Takara Bio, Inc.) according to the manufacturer's protocol. RT-qPCR was performed on an Mx3005P real-time PCR system (Agilent Technologies, Inc.) using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus; Takara Bio, Inc.). The specific primer sequences are listed in Table I. The thermocycling conditions were as follows: Initial denaturation for 10 min at 95˚C, followed by 40 cycles of 10 sec at 95˚C and 40 sec at 60˚C. For quantification, the standard curve method was used (42). Moreover, PCR products were electrophoresed through a 2% agarose gel at 100 V for 30 min using the Mupid-2plus gel electrophoresis system (Takara Bio Inc.) After staining with ethidium bromide (0.5 µg/ml) for 15 min at room temperature, gel bands were visualized using a gel imaging system (Printgraph TYPE-GX, ATTO Co.). β-actin was used as an internal control (37,43).

Table I Nucleotide sequences of primers for target genes.

Table I

Nucleotide sequences of primers for target genes.

Gene	Sequence, 5'→3'
ACTB	F: TGTGCTGTCCCTGTATGCCT
	R: ATTTCCCTCTCGGCTGTGGT
PRKD1	F: GCCATTCTCCAGAACCTC
	R: AGAAACTTGGTGATGCGT
PTGS2	F: TGTGTTCGGGGAGACTATGG
	R: CCACTTTCCCACCAAACGTG
TNFRSF11B	F: TGACAGGTGTCCTCCAGGAA
	R: TCCAGAACTCCGTGAACAGAC
WNT3A	F: ACCGAAACTGACCTGGTCTAC
	R: CAAGTCGCAGCCATCGATAC

[i] F, forward; R, reverse; ACTB, β-actin; PRKD1, protein kinase D1; PTGS2, prostaglandin-endoperoxide synthase 2; TNFRSF11B, tumor necrosis factor receptor superfamily, member 11b; WNT3A, Wnt family member 3A.

Statistical analysis

Data are presented as the mean ± SD of three or more independent experiments. The values of the control scales were compared with those of LIPUS-treated scales. Differences were analyzed using a paired t test. Statistical analysis was performed using R software (Ver. 4.3.3.; r-project.org/). P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of LIPUS on temperature of culture medium

Biophysical effects of ultrasound on living tissues are divided into thermal and nonthermal effects (2). Therefore, the effects of LIPUS on the temperature of the culture medium were determined. The initial temperature of the culture medium was 24.9±0.2˚C. The temperature of the culture medium 20 min after LIPUS treatment was not significantly increased (25.0±0.2˚C), suggesting thermal effects were not included in the bioeffects of LIPUS.

Effects of LIPUS on ALP and TRAP activity of goldfish scales

LIPUS treatment significantly increased ALP activity, a marker of osteoblasts, but did not affect TRAP activity, a marker of osteoclasts (Fig. 2A). These data indicated that LIPUS induced osteoblastic activation in goldfish scales.

Figure 2 Effect of LIPUS on ALP and TRAP activity. Goldfish scales were irradiated with LIPUS at 30 mW/cm2 for 20 min, then cultured at 15˚C for 24 h. (A) ALP and (B) TRAP activity was measured. *P<0.05 vs. control. LIPUS, low-intensity pulsed ultrasound; ALP, alkaline phosphatase; TRAP, tartrate-resistant acid phosphatase; pNP, para-nitrophenol.

Gene expression analysis

To identify candidate genes responsive to LIPUS treatment, the time course of the gene expression profile was examined using RNA-seq. Gene expression analysis of the scales exposed to LIPUS revealed 207, 280 and 350 upregulated genes at 3, 6 and 24 h, respectively, and 188, 368 and or 298 downregulated genes at 3, 6 and 24 h, respectively (Fig. 3). The complete lists of DEGs from the goldfish scale samples are shown in Table SI, Table SII, Table SIII, Table SIV, Table SV and Table SVI.

Figure 3 DEGs induced by LIPUS treatment. Goldfish scales were irradiated with LIPUS at 30 mW/cm2 for 20 min, then cultured at 15˚C for 3, 6 and 24 h. RNA sequencing analysis was performed. The number of DEGs with P<0.05 and fold-change ≥1.2 is shown. DEG, differentially expressed gene; LIPUS, low-intensity pulsed ultrasound.

Gene network and biological function analysis

To examine the functional association between candidate genes, gene network and biological function analyses were performed using the Ingenuity® Pathways Knowledge Base. Significant gene networks, GN-3h, GN-6h and GN-24h, were identified from upregulated genes at 3, 6 and 24 h after LIPUS treatment, respectively (Fig. 4). GN-3h consisted of nine genes: Adrenoceptor β2 (ADRB2), BAG cochaperone 3, heat shock protein 90α family class A member 1 (HSP90AA1), MAPK11, MET proto-oncogene, receptor tyrosine kinase, protein kinase D1 (PRKD1), Rho-related BTB domain containing 1, receptor tyrosine kinase-like orphan receptor 1 and tumor necrosis factor receptor superfamily, member 11b (TNFRSF11B) (Fig. 4A). GN-6h consisted of six genes: Aryl hydrocarbon receptor repressor, cytochrome P450 family 1 subfamily A member 1, DEP domain-containing 1B, OTU deubiquitinase with linear linkage specificity, TNFRSF11B and Wnt family member 3A (WNT3A; Fig. 4B). GN-24h consisted of seven genes: Caspase 9, fibrillarin, granzyme B, prostaglandin-endoperoxide synthase 2 (PTGS2), TATA box-binding protein-associated factor 15, transducin β-like 3 and transglutaminase 1 (Fig. 4C). ADRB2, MAPK11, PRKD1, PTGS2, TNFRSF11B and WNT3A were associated with biological functions of osteogenesis, including osteoblast differentiation and bone development and formation.

Figure 4 Upregulated genes in scales treated with low-intensity pulsed ultrasound after 3, 6, and 24 h were analyzed using the Ingenuity® Pathway Analysis tools. Gene networks were identified from upregulated genes at (A) 3, (B) 6 and (C) 24 h. Blue, biological functions of osteogenesis, including osteoblast differentiation and bone development and formation.

Effects of LIPUS on gene expression

PRKD1, TNFRSF11B, WNT3A and PTGS2–were selected from the three gene networks. The specificity of the primers was confirmed by a single band with the correctly amplified fragment size through agarose gel electrophoresis of the PCR products (Supplementary material Fig. S1). Expression of PRKD1 was significantly upregulated at 3 h and TNFRSF11B was significantly upregulated at all time points (Fig. 5A and B). The expression of WNT3A was significantly upregulated at 6 h and PTGS2 was significantly upregulated at 3 and 24 h after LIPUS treatment (Fig. 5C and D). These data were comparable with the RNA-seq results.

Figure 5 Effects of LIPUS on the gene expression. Gene expression levels of (A) PRKD1, (B) TNFRSF11B, (C) WNT3A and (D) PTGS2 were normalized to ACTB. *P<0.05 vs. Ctr. ACTB, β-actin; PRKD1, protein kinase D1; TNFRSF11B, tumor necrosis factor receptor superfamily, member 11b; WNT3A, Wnt family member 3A; PTGS2, prostaglandin-endoperoxide synthase 2; Ctr, control.

Discussion

Numerous studies have shown that LIPUS induces osteogenic activity in in vitro experimental models (13-21). For example, ALP activity, a marker of osteoblasts, in mouse preosteoblast MC3T3-E1(14) and bone marrow mesenchymal stem cells (21) is significantly increased in response to clinical application of LIPUS (30 mW/cm2 for 20 min). Kitamura et al (16) demonstrated that LIPUS at 60 mW/cm2 for 6-20 min significantly elevates ALP activity in goldfish scales. In agreement with previous studies (14,16,21), here, LIPUS (30 mW/cm2 for 20 min) significantly increased ALP activity but did not affect TRAP activity, a marker of osteoclasts, suggesting that LIPUS induced osteoblastic activation in goldfish scales. On the other hand, in our previous study, the same clinical LIPUS application affected osteoclasts in fish scales; LIPUS directly caused apoptosis in osteoclasts 3 h after treatment in both zebrafish and goldfish scales (31) and moderately activated osteoclasts 6 and 12 h after treatment in goldfish scales (32). LIPUS was transmitted through the bottom of the cell culture plate or directly from the upper side in the present osteoblast-activating or previous osteoclast-affecting conditions (31,32), respectively. The discrepancy in the effects of LIPUS between the present and previous studies may have been related to this difference in the LIPUS-exposure conditions. In addition, 2 weeks after daily LIPUS treatment, ALP activity and regeneration rate are significantly increased in goldfish scales in vivo (32). The present results and those of previous studies (16,31,32) suggest that osteoblasts and osteoclasts in fish scales respond sensitively to LIPUS mechanical stress.

The present study used RNA-seq and Ingenuity® pathway analyses to identify DEGs and three unique gene networks. These networks included ADRB2, MAPK11, PRKD1, TNFRSF11B, WNT3A and PTGS2, which are known to be involved in various aspects of osteogenesis, including osteoblast differentiation and bone development and formation (44-53). Previous research using knockout mice demonstrated that ADRB2(44) and PRKD1(45) are key to bone formation, while TNFRSF11B (46) and MAPK11(47) serve key roles in bone development. PRKD1(48), TNFRSF11B (49), WNT3A (50) and PTGS2(51) induce osteoblast differentiation in experimental models such as MC3T3-E1 mouse preosteoblastic cells (48,49), C2C12(48) and C3H10T1/2(50) mouse mesenchymal stem cells, as well as PTGS2 knockout mice (51). Interactions have been reported between TNFRSF11B and ADRB2(44), PRKD1(52) and WNT3A (53).

The product translated from TNFRSF11B, known as osteoprotegerin (OPG) and produced by osteoblasts, functions as a decoy receptor of receptor activator for nuclear factor-κB ligand (RANKL) and suppresses osteoclastogenesis (54). One of the most effective approaches for clinically treating osteoporosis involves the use of a specific antibody to inhibit RANKL, a mechanism akin to that of OPG (55). Yu et al (49) indicated that ALP activity is significantly higher in the OPG-overexpressing preosteoblast cell line MC3T3-E1, indicating that OPG promotes matrix maturation in preosteoblasts. Moreover, reports indicate that OPG enhances osteoblastogenesis of human mesenchymal stem cells (18,56) and LIPUS (400 mW/cm2, 20 min) boosts osteoblastogenesis of human mesenchymal stem cells by increasing mRNA levels of TNFRSF11B and ALP (18). Moreover, Borsje et al (15) reported that the clinical application of LIPUS significantly increases OPG mRNA and protein expression in human osteoblast-like Saos-2 cells. Furthermore, in vivo study using an ovariectomy-induced osteoporotic fracture rat model found that clinical application of LIPUS accelerates osteoporotic fracture healing. Moreover, OPG gene expression is upregulated in LIPUS-treated rats at an earlier stage of the repair process compared with controls (9). In our previous study using goldfish scales, OPG was suggested to suppress excessive bone resorption under osteoclast-activated conditions induced by clinical application of LIPUS (32). In the present study, LIPUS induced TNFRSF11B expression and ALP activity without interfering with TRAP activity. This suggested that in LIPUS-treated goldfish scales, OPG may be involved in osteoblastic differentiation rather than suppression of osteoclastogenesis.

Cyclooxygenase 2 (COX-2), which is encoded by PTGS2, is a key enzyme in prostaglandin E2 (PGE2) biosynthesis. LIPUS stimulation increases expression of PTGS2 and PGE2 in bone cells (13,37,57-59). Tang et al (13) demonstrated that the clinical application of LIPUS stimulates mineralization of osteoblasts via the COX-2/PGE2 pathway. COX-2 and PGE2 are reported to play essential roles in the regulation of osteoblastic differentiation (13,51,60) and fracture healing (3,4,10). Naruse et al (10) used knockout mice to demonstrate that LIPUS accelerates endochondral bone healing during senescence in a COX-2-dependent manner. A delay in fracture healing is also observed in rats and humans administered COX inhibitors (61,62). In the present study, expression of PTGS2 was elevated 24 h after LIPUS treatment in goldfish scales. Omori et al (63) demonstrated that the addition of PGE2 to goldfish scales promotes both osteoblastic and osteoclastic activity. The present data along with the previous findings suggest that LIPUS stimulation may enhance osteoblastogenesis via the COX-2/PGE2 pathway. Investigating the effects of LIPUS on osteoblastgenesis in goldfish scales treated with either COX-2 inhibitor or small interfering RNA for PTGS2 is required.

Hsp90α, the product of HSP90AA1, belongs to the HSP family and exhibits potent chaperone activity (64). This protein is induced by stressors, including heat stress, and is mediated primarily by heat shock transcription factor 1(65). In the present study, expression of HSP90AA1 was significantly upregulated in the goldfish scales treated with LIPUS, without any temperature rise in the culture medium. This suggested that temperature had little involvement in LIPUS-induced HSP90AA1 expression. Similarly, LIPUS induces HSP90AA1 expression in zebrafish scales (31). Previous studies have also indicated that LIPUS at 30 mW/cm2 for 15 or 30 min enhances osteogenic differentiation by elevating HSP90AA1 levels in mouse calvaria-derived osteoblasts (19) and human adipose-derived stem cells (20).

Taken together, the present results provide insight into the molecular mechanisms underlying LIPUS-induced osteoblast activation. However, the present study did not conduct morphological evaluations of the LIPUS-treated goldfish scales. The biological and morphological roles of genes and their interactions in LIPUS-treated goldfish scales require further investigation.

Supplementary Material

Confirmation of PCR products with gene-specific primers. Agarose gel electrophoresis (2%) was performed and PCR products of the expected size for each gene were observed. L, DNA size ladder; 1, β-actin (210 bp); 2, tumor necrosis factor receptor superfamily, member 11b (101 bp); 3, Wnt family member 3A (129 bp); 4, protein kinase D1 (164 bp); 5, prostaglandin endoperoxide synthase 2 (116 bp). bp, base pair.

Up-regulated genes 3 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Up-regulated genes 6 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Up-regulated genes 24 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Down-regulated genes 3 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Down-regulated genes 6 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Down-regulated genes 24 h after LIPUS (low-intensity pulsed ultrasound) exposure.

Acknowledgements

The authors would like to thank Dr Hidetada Ohnishi (Teijin Pharma, Ltd.) for lending ultrasound irradiating system.

Funding

Funding: The present study was supported in part by Japan Society for the Promotion of Science KAKENHI (grant nos. JP17K01353, JP20K12619, JP23K11802 and JP23K10933).

Availability of data and materials

The data generated in the present study may be found in the DNA Data Bank of Japan under accession number PRJDB17555 or at the following URL: ddbj.nig.ac.jp/resource/bioproject/PRJDB17555.

Authors' contributions

YT, YF and NS designed the experiments and wrote the manuscript. YT, KK, YF, TH, RN, MO, HH, JH and NS performed experiments. YT, KK, YF and NS analyzed the data. YT and NS confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

All animal experiments were approved by the Animal Research Committee of Kanazawa University (Kanazawa, Japan (approval no. 242-2023).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References