Prognostic value of microRNA‑378 in esophageal cancer and its regulatory effect on tumor progression
- Authors:
- Published online on: May 2, 2021 https://doi.org/10.3892/etm.2021.10136
- Article Number: 704
Abstract
Introduction
Esophageal carcinoma is one of the most common malignancies of the digestive system and the sixth leading cause of cancer-associated mortality worldwide (1). Esophageal carcinoma includes esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma, of which ESCC is the most common pathological type in Asia (2,3). Currently, the treatment strategies for ESCC include surgery, radiotherapy, and chemotherapy (4,5). Despite advancements in these techniques, the 5-year survival rate of patients with ESCC was <20% in 2012 (6,7). Thus, it is important to identify effective biomarkers for the diagnosis and treatment of patients with ESCC (8,9). In recent years, research on non-coding RNAs in the field of molecular biology has attracted great interest due to its association with tumors (10,11).
MicroRNAs (miRNAs/miRs) are a class of highly conserved non-coding RNA molecules, which negatively regulate gene expression by binding to the 3'-untranslated region of target mRNAs, resulting in mRNA degradation and inhibition of translation (12,13). Increasing evidence suggest that miRNAs play key roles in gene expression regulation and signal transduction pathways in cancer (14,15). It has been reported that downregulated miR-378 expression exerts a tumor suppressive role in non-small cell lung cancer (NSCLC), which provides an innovative and candidate target for the diagnosis and treatment of patients with NSCLC (16). Yang et al (17) comprehensively analyzed the role of miRNAs and mRNAs in ESCC, and microarray analysis demonstrated that miR-378 expression was abnormally downregulated in ESCC. However, the prognostic value of miR-378 and its regulatory effect on tumor progression in ESCC remain unclear.
With the aim of exploring effects of miR-378 on ESCC, the present study determined the expression levels of miR-378 in ESCC tissues and cell lines, and then analyzed the correlation between its expression and clinical parameters as well as the prognosis value for ESCC. Preliminarily, the molecular mechanism of action of miR-378 on ESCC was investigated.
Materials and methods
Patients and tissue samples
A total of 135 patients with ESCC at Yidu Central Hospital were enrolled in the present study between June 2013 and June 2015. The mean age for all patients was 62 years old with a range of 38-72 years; males slightly predominated (54%). Included cases were histopathologically confirmed to have ESCC and all patients agreed to participate in the study. Patients who had previously received any radiation or chemotherapy for ESCC prior to surgery were excluded from the present study. Other eligibility criteria were as following: ≥18 years of age; and no history of concurrent cancer in other organs or history of previous cancer in any organ. Pathological tissue samples and paired normal tissue samples (5 cm away from the tumor tissues) were collected via surgical resection. The fresh specimens were immediately frozen in liquid nitrogen and stored at -80˚C until subsequent experimentation. Patients were classified according to the seventh edition of TNM staging criteria for malignant tumors, as revised by the International Union against Cancer and the American Cancer Federation in 2009(18). The present study was approved by the Medical Ethics Committee of Yidu Central Hospital of Weifang (Weifang, China; approval no. 201210) and written informed consent was provided by all patients prior to the study start. Survival analysis was performed via a 5-year telephone follow-up study (from the date of surgery treatment to death or the last observation).
Cell culture and transfection
The ESCC cell lines TE-1, KYSE-150, Eca-109 and TE-8 were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, while the human esophageal epithelial cell line, Het-1A, was purchased from the American Type Culture Collection. All cells were maintained in RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.), at 37˚C with 5% CO2. miR-378 mimic (50 nM; 5'-CUC CUGACUCCAGGUCCUGUGU-3'), mimic negative control (NC, 50 nM; 5'-UCACAACCUCCUAGAAAGAGUAGA-3'), miR-378 inhibitor (50 nM; 5'-ACACAGGACCUGGAGUCA GGAG -3') and inhibitor NC (50 nM; 5'-UUCUCCGAACGU GUCACGUTT-3') were synthesized by Guangzhou RiboBio Co., Ltd. 20 nM of miR-378 mimic or inhibitor transfection mix was prepared in Lipofectamine® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The transfection mix and 1.5x105 cells were seeded in medium in the same 6-well plates at 37˚C. Following 24 h, the medium along with the transfection reagent was replaced with fresh medium. After another 24 h of medium replacement at 37˚C, the cells were harvested for the subsequent experimentation.
RNA reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from ESCC tissues and cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and the RNA quality and quantity were verified using a NanoDrop 2000 (Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using the TaqMan miRNA reverse transcription kit (Thermo Fisher Scientific, Inc.) using the following temperature protocol: 16˚C holding for 30 min, 42˚C for 30 min, 85˚C for 5 min and then 4˚C. qPCR was subsequently performed using the SYBR-Green I Master mix kit (Invitrogen; Thermo Fisher Scientific, Inc.) on an ABI 7500 system. The amplification of U6 small nuclear RNA was used for the normalization. The primers used in the present study were as follows: U6 forwards, 5'-CGCTTCACGAATTTGCGTGTCAT-3' and reverse 5'-GCTTCGGCAGCACATATACTAAAAT-3'; and miR-378-5p forwards, CAAACCTCCTCCTGACTCCAG and reverse, TATGCTTGTTCTCGTCTCTGTGTC. The PCR conditions were as follows: 95˚C for 30 sec; and 40 cycles of 95˚C for 5 sec and 60˚C for 30 sec and 72˚C for 20 sec. Relative expression levels were calculated using the 2-ΔΔCq method (19). All experiments were performed in triplicate.
Cell proliferation assay
Of the four ESCC cell lines, miR-378 expression was significantly lower in TE-1 and KYSE-150 cells compared with Eca-109 and TE-8 cells. Thus, the TE-1 and KYSE-150 cell lines were selected for subsequent experimentation. Transfected TE-1 and KYSE-150 cells were centrifuged at 100 x g for 5 min at 4˚C. Thereafter, the cell suspension was prepared in RPMI-1640 medium containing 10% FBS and then seeded into 96-well plates at a density of 2x103 cells per well. Subsequently, 10 µl Cell Counting Kit-8 (CCK-8) reagent (Dojindo Molecular Technologies, Inc.) was added to each well and incubated for 1-2 h at 37˚C, with 5% CO2. Cell proliferation was analyzed at a wavelength of 450 nm, using a microplate reader system (Molecular Devices LLC).
Cell migration and invasion assays
TE-1 and KYSE-150 cells were starved for 24 hours in a serum-free medium before invasion or migration experiments. A total of 2x105 transfected ESCC cells were plated in the upper chambers of Transwell plates (8 µm pores; BD Biosciences), and finally, 200 µl serum-free RPMI-1640 was added to the upper chamber. At 37˚C, the cells were cultured for 24 h in an incubator with 5% CO2. For the invasion assay, Transwell membranes were precoated with Matrigel. RPMI-1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS was plated in the lower chambers. Cells were fixed with 4% paraformaldehyde solution for 20 min at room temperature and subsequently stained with 0.1% crystal violet for 20 min at room temperature. Stained cells were counted in five randomly selected fields using an Olympus IX-70 fluorescence microscope at 200x magnification.
Statistical analysis
Statistical analysis was performed using SPSS 21.0 software (IBM Corp.) and GraphPad Prism 5.0 software (GraphPad Software, Inc.). All experiments were performed in triplicate and data are presented as the mean ± standard deviation. Paired Student's t-test was used to compare differences between two groups, while one-way ANOVA and Tukey's post-hoc tests were used to compare differences between multiple groups. χ2 test was used to compare the association between miR-378 expression and clinic data of patients. Survival analysis was performed using the Kaplan-Meier method and compared with the use of log-rank test to determine the statistical significance. Univariate and multivariate Cox regression analysis was performed to determine the prognostic value of miR-378 in ESCC. P<0.05 was considered to indicate a statistically significant difference.
Results
miR-378 expression in ESCC tissues and cell lines
RT-qPCR analysis was performed to detect miR-378 expression in ESCC tissues and cell lines. The results demonstrated that miR-378 expression was significantly lower in ESCC tissues (0.567±0.321) compared with adjacent normal tissues (1.02±0.326; P<0.001; Fig. 1A). Similarly, miR-378 expression was significantly lower in the four ESCC cell lines compared with the normal cell line, particularly in KYSE-150 and TE-1 cells (P<0.01, P<0.001, Fig. 1B). Notably, miR-378 expression was three times higher in Het-1A cells compared with KYSE-150 cells, and twice as high compared with TE-1 cells.
Association between miR-378 expression and the clinicopathological characteristics of patients with ESCC
The median relative expression of miR-378 was used as the threshold (20,21). All patients were divided into two groups, the miR-378 high expression group (n=67) and the miR-378 low expression group (n=68). The results demonstrated that miR-378 expression was significantly associated with the TNM stage (P=0.001) and lymph node metastasis (P=0.01) of patients with ESCC. However, no significant associations were observed between miR-378 expression and age, sex, smoking, drinking or tumor differentiation degree among patients with ESCC (P>0.05, Table I).
![]() | Table IAssociation between miR-378 expression and the clinicopathological characteristics of patients with esophageal squamous cell carcinoma (n=135). |
miR-378 expression is associated with survival outcomes of patients with ESCC
Survival analysis was performed using the Kaplan-Meier method and log-rank test, based on miR-378 expression. The results demonstrated that patients with low miR-378 expression had a significantly shorter overall survival time (P=0.026; Fig. 2) than those with high miR-378 expression. Furthermore, univariate and multivariate Cox regression analysis indicated that miR-378 expression [P=0.031; hazard ratio (HR), 2.516], TNM staging (P=0.043; HR, 2.801) and lymph node metastasis (P=0.036; HR, 0.426) are independent prognostic factors for overall survival in patients with ESCC (Table II).
![]() | Table IIMultivariate Cox regression analysis for overall survival in patients with esophageal squamous cell carcinoma. |
Downregulation of miR-378 expression promotes cell proliferation, migration and invasion
Following transfection with miR-378 mimics, mimic NC, miR-378 inhibitors and inhibitor NC, miR-378 expression in TE-1 and KYSE-150 cells was detected via RT-qPCR analysis. The results demonstrated that transfection with miR-378 mimic significantly increased miR-378 expression, the effects of which were reversed following transfection with miR-378 inhibitor (P<0.01, Fig. 3A). The CCK-8 assay was performed to assess cell proliferation. The results demonstrated that overexpression of miR-378 inhibited the proliferation of ESCC cells, while miR-378 knockdown promoted the proliferation of ESCC cells compared with the control groups (P<0.05, Fig. 3B).
The results of the Transwell assay demonstrated that the number of migratory and invasive cells significantly decreased in TE-1 and KYSE-150 cells following transfection with miR-378 mimic, the effects of which were reversed following transfection with miR-378 inhibitor (P<0.01; Fig. 4A and B).
Discussion
miRNAs can regulate the expression of target genes at the post-transcriptional level (22-24). It has been confirmed that approximately one third of genes in the human genome are regulated by miRNAs (25). Several studies have demonstrated that miRNAs play important roles in the occurrence and development of tumors, functioning as either oncogenes or tumor suppressors in different types of cancer (13,26,27). ESCC is a common malignancy worldwide, which is a major threat to human health (5,28). Given that the molecular mechanisms underlying the occurrence and progression of esophageal carcinoma are not yet fully understood, the prognosis of patients remains poor (4,29,30). Thus, it is important to identify effective molecular targets and novel therapeutic strategies for patients with esophageal carcinoma (31,32).
Previous studies have reported that miR-378 plays an important role in different types of cancer. For example, Li et al (33) demonstrated that miR-378 expression is significantly lower in glioma tissues compared with non-neoplastic brain tissues, and downregulated miR-378 expression is associated with tumor invasiveness and poor prognosis of patients with glioma. In colorectal cancer, miR-378 expression is significantly downregulated in colorectal cancer tissues and cell lines, and low miR-378 expression predicts a shorter overall survival acting as an independent prognostic factor (34).
The results of the present study demonstrated an association between miR-378 expression and the progression of ESCC. The results indicated that miR-378 expression was significantly downregulated in ESCC tissues compared with normal adjacent tissues, suggesting that miR-378 may inhibit ESCC progression. In tumors, TNM stage represents the degree of tumor development, and lymph node metastasis is an important factor affecting the survival of patients. In the present study, patients with low miR-378 expression exhibited an advanced TNM stage and positive lymph node metastasis. In addition, Kaplan-Meier survival analysis and multivariate Cox regression analysis demonstrated that patients with low miR-378 expression had a poor prognosis. Taken together, these results suggest that miR-378 may serve as a potential prognostic marker for ESCC.
Zeng et al (35) reported that miR-378 expression is downregulated in colon cancer tissues and cell lines, and that overexpression of miR-378 inhibits the proliferation, migration and invasion of colon cancer cells. Furtherly, cell proliferative, migratory and invasive abilities are usually associated with the development of tumors (36). Thus, the present study assessed the effect of altering miR-378 expression on the biological behaviors of ESCC cells via cell transfection. The results demonstrated that miR-378 knockdown promoted the proliferation, migration and invasion of ESCC cells, while overexpression of miR-378 inhibited these cellular behaviors compared with untreated ESCC cells. Collectively, these results suggest that miR-378 plays an inhibitory role in ESCC.
miR-378 has been reported to exert similar inhibitory effects in other types of cancer, for instance, low ectopic miR-378 expression inhibits the proliferation, migration and invasion of MGC-803 gastric cancer cells, suggesting that miR-378 exerts an anticancer role in gastric cancer (37). This may provide novel diagnostic and therapeutic options for the future clinical management of human gastric cancer (37). Taken together, the results of the present study are consistent with previous findings (35,38,39).
The present study is not without limitations, such as, the sample size used was too small or the downstream target genes of miR-378 have not yet been fully investigated. Thus, further studies are required to confirm the results presented here.
In conclusion, the results of the present study demonstrated that miR-378 expression was downregulated in ESCC tissues and cell lines, which was associated with a poor prognosis of patients with ESCC. Notably, miR-378 may act as a tumor suppressor in the occurrence and development of ESCC.
Acknowledgements
Not applicable.
Funding
Funding: No funding was received.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
WJ, LW and HL conceived and designed the present study. All authors performed the experiments. WJ, LW and SC analyzed and interpreted the data. WJ and LW drafted the initial manuscript. HL critically revised the manuscript for important intellectual content. All authors have read and approved the final manuscript. WJ, LW and HL confirm the authenticity of all the raw data.
Ethics approval and consent to participate
The present study was approved by the Medical Ethics Committee of Yidu Central Hospital of Weifang (Weifang, China, approval no. 201210) and written informed consent was provided by all patients prior to the study start.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
Alsina M, Moehler M and Lorenzen S: Immunotherapy of esophageal cancer: Current status, many trials and innovative strategies. Oncol Res Treat. 41:266–271. 2018.PubMed/NCBI View Article : Google Scholar | |
Dong Z, Wang J, Zhan T and Xu S: Identification of prognostic risk factors for esophageal adenocarcinoma using bioinformatics analysis. Onco Targets Ther. 11:4327–4337. 2018.PubMed/NCBI View Article : Google Scholar | |
Hou J, Zou K, Yang C, Leng X and Xu Y: Clinicopathological and prognostic significance of circulating tumor cells in patients with esophageal cancer: A meta-analysis. Onco Targets Ther. 11:8053–8061. 2018.PubMed/NCBI View Article : Google Scholar | |
Hirano H and Kato K: Systemic treatment of advanced esophageal squamous cell carcinoma: Chemotherapy, molecular-targeting therapy and immunotherapy. Jpn J Clin Oncol. 49:412–420. 2019.PubMed/NCBI View Article : Google Scholar | |
Reichenbach ZW, Murray MG, Saxena R, Farkas D, Karassik EG, Klochkova A, Patel K, Tice C, Hall TM, Gang J, et al: Clinical and translational advances in esophageal squamous cell carcinoma. Adv Cancer Res. 144:95–135. 2019.PubMed/NCBI View Article : Google Scholar | |
Dong Z, Wang J, Zhang H, Zhan T, Chen Y and Xu S: Identification of potential key genes in esophageal adenocarcinoma using bioinformatics. Exp Ther Med. 18:3291–3298. 2019.PubMed/NCBI View Article : Google Scholar | |
Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012.PubMed/NCBI View Article : Google Scholar | |
Jamali L, Tofigh R, Tutunchi S, Panahi G, Borhani F, Akhavan S, Nourmohammadi P, Ghaderian SMH, Rasouli M and Mirzaei H: Circulating microRNAs as diagnostic and therapeutic biomarkers in gastric and esophageal cancers. J Cell Physiol. 233:8538–8550. 2018.PubMed/NCBI View Article : Google Scholar | |
Li Y, Huang HC, Chen LQ, Xu LY, Li EM and Zhang JJ: Predictive biomarkers for response of esophageal cancer to chemo(radio)therapy: A systematic review and meta-analysis. Surg Oncol. 26:460–472. 2017.PubMed/NCBI View Article : Google Scholar | |
Jiang Z, Song Q, Yang S, Zeng R, Li X, Jiang C, Ding W, Zhang J and Zheng Y: Serum microRNA-218 is a potential biomarker for esophageal cancer. Cancer Biomark. 15:381–389. 2015.PubMed/NCBI View Article : Google Scholar | |
Mei LL, Qiu YT, Zhang B and Shi ZZ: MicroRNAs in esophageal squamous cell carcinoma: Potential biomarkers and therapeutic targets. Cancer Biomark. 19:1–9. 2017.PubMed/NCBI View Article : Google Scholar | |
Correia de Sousa M, Gjorgjieva M, Dolicka D, Sobolewski C and Foti M: Deciphering miRNAs' action through miRNA editing. Int J Mol Sci. 20(20)2019.PubMed/NCBI View Article : Google Scholar | |
Mishra S, Yadav T and Rani V: Exploring miRNA based approaches in cancer diagnostics and therapeutics. Crit Rev Oncol Hematol. 98:12–23. 2016.PubMed/NCBI View Article : Google Scholar | |
Kang M, Li Y, Zhu S, Zhang S, Guo S and Li P: MicroRNA-193b acts as a tumor suppressor gene in human esophageal squamous cell carcinoma via target regulation of KRAS. Oncol Lett. 17:3965–3973. 2019.PubMed/NCBI View Article : Google Scholar | |
Xia D, Tian S, Chen Z, Qin W and Liu Q: miR-302a inhibits the proliferation of esophageal cancer cells through the MAPK and PI3K/Akt signaling pathways. Oncol Lett. 15:3937–3943. 2018.PubMed/NCBI View Article : Google Scholar | |
Ji KX, Cui F, Qu D, Sun RY, Sun P, Chen FY, Wang SL and Sun HS: miR-378 promotes the cell proliferation of non-small cell lung cancer by inhibiting FOXG1. Eur Rev Med Pharmacol Sci. 22:1011–1019. 2018.PubMed/NCBI View Article : Google Scholar | |
Yang H, Su H, Hu N, Wang C, Wang L, Giffen C, Goldstein AM, Lee MP and Taylor PR: Integrated analysis of genome-wide miRNAs and targeted gene expression in esophageal squamous cell carcinoma (ESCC) and relation to prognosis. BMC Cancer. 20(388)2020.PubMed/NCBI View Article : Google Scholar | |
Edge S, Byrd DR, Compton CC, Fritz AG, Greene F and Trotti A (eds): AJCC Cancer Staging Manual. 7th Edition. Springer-Verlag, New York, NY, 2010. | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar | |
Goto T, Fujiya M, Konishi H, Sasajima J, Fujibayashi S, Hayashi A, Utsumi T, Sato H, Iwama T, Ijiri M, et al: An elevated expression of serum exosomal microRNA-191, - 21, -451a of pancreatic neoplasm is considered to be efficient diagnostic marker. BMC Cancer. 18(116)2018.PubMed/NCBI View Article : Google Scholar | |
Nie X, Su Z, Yan R, Yan A, Qiu S and Zhou Y: MicroRNA-562 negatively regulated c-MET/AKT pathway in the growth of glioblastoma cells. Onco Targets Ther. 12:41–49. 2018.PubMed/NCBI View Article : Google Scholar | |
Lu TX and Rothenberg ME: MicroRNA. J Allergy Clin Immunol. 141:1202–1207. 2018.PubMed/NCBI View Article : Google Scholar | |
Rupaimoole R and Slack FJ: MicroRNA therapeutics: Towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov. 16:203–222. 2017.PubMed/NCBI View Article : Google Scholar | |
Tomaselli S, Panera N, Gallo A and Alisi A: Circulating miRNA profiling to identify biomarkers of dysmetabolism. Biomarkers Med. 6:729–742. 2012.PubMed/NCBI View Article : Google Scholar | |
Zhang C, Ji Q, Yang Y, Li Q and Wang Z: Exosome: Function and role in cancer metastasis and drug resistance. Technol Cancer Res Treat. 17(1533033818763450)2018.PubMed/NCBI View Article : Google Scholar | |
Lee YS and Dutta A: MicroRNAs in cancer. Annu Rev Pathol. 4:199–227. 2009.PubMed/NCBI View Article : Google Scholar | |
Vishnoi A and Rani S: MiRNA biogenesis and regulation of diseases: An overview. Methods Mol Biol. 1509:1–10. 2017.PubMed/NCBI View Article : Google Scholar | |
Codipilly DC, Qin Y, Dawsey SM, Kisiel J, Topazian M, Ahlquist D and Iyer PG: Screening for esophageal squamous cell carcinoma: Recent advances. Gastrointest Endosc. 88:413–426. 2018.PubMed/NCBI View Article : Google Scholar | |
Fu JH: Biomarkers of predicting response to neoadjuvant chemoradiotherapy in esophageal cancer. Zhonghua Wei Chang Wai Ke Za Zhi. 16:805–810. 2013.PubMed/NCBI(In Chinese). | |
Hou X, Wen J, Ren Z and Zhang G: Non-coding RNAs: New biomarkers and therapeutic targets for esophageal cancer. Oncotarget. 8:43571–43578. 2017.PubMed/NCBI View Article : Google Scholar | |
Su X, Gao C, Feng X and Jiang M: miR-613 suppresses migration and invasion in esophageal squamous cell carcinoma via the targeting of G6PD. Exp Ther Med. 19:3081–3089. 2020.PubMed/NCBI View Article : Google Scholar | |
Yi Y, Lu X, Chen J, Jiao C, Zhong J, Song Z, Yu X and Lin B: Downregulated miR-486-5p acts as a tumor suppressor in esophageal squamous cell carcinoma. Exp Ther Med. 12:3411–3416. 2016.PubMed/NCBI View Article : Google Scholar | |
Li B, Wang Y, Li S, He H, Sun F, Wang C, Lu Y, Wang X and Tao B: Decreased expression of miR-378 correlates with tumor invasiveness and poor prognosis of patients with glioma. Int J Clin Exp Pathol. 8:7016–7021. 2015.PubMed/NCBI | |
Zhang GJ, Zhou H, Xiao HX, Li Y and Zhou T: miR-378 is an independent prognostic factor and inhibits cell growth and invasion in colorectal cancer. BMC Cancer. 14(109)2014.PubMed/NCBI View Article : Google Scholar | |
Zeng M, Zhu L, Li L and Kang C: miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1. Cell Mol Biol Lett. 22(12)2017.PubMed/NCBI View Article : Google Scholar | |
Nie X, Xia F, Liu Y, Zhou Y, Ye W, Hean P, Meng J, Liu H, Liu L, Wen J, et al: Downregulation of Wnt3 suppresses colorectal cancer development through inhibiting cell proliferation and migration. Front Pharmacol. 10(1110)2019.PubMed/NCBI View Article : Google Scholar | |
Fei B and Wu H: MiR-378 inhibits progression of human gastric cancer MGC-803 cells by targeting MAPK1 in vitro. Oncol Res. 20:557–564. 2012.PubMed/NCBI View Article : Google Scholar | |
Guo XB, Zhang XC, Chen P, Ma LM and Shen ZQ: miR-378a-3p inhibits cellular proliferation and migration in glioblastoma multiforme by targeting tetraspanin 17. Oncol Rep. 42:1957–1971. 2019.PubMed/NCBI View Article : Google Scholar | |
Cui Z, Sun S, Liu Q, Zhou X, Gao S, Peng P and Li Q: MicroRNA-378-3p/5p suppresses the migration and invasiveness of oral squamous carcinoma cells by inhibiting KLK4 expression. Biochem Cell Biol. 98:154–163. 2020.PubMed/NCBI View Article : Google Scholar |