Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2021 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2021 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production

  • Authors:
    • Mingtai Gui
    • Lei Yao
    • Bo Lu
    • Jing Wang
    • Xunjie Zhou
    • Jianhua Li
    • Zhenhua Dong
    • Deyu Fu
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Yueyang Hospital of Integrated Traditional Chinese and Western Medicine, Shanghai University of Traditional Chinese Medicine, Shanghai 200437, P.R. China
    Copyright: © Gui et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 1446
    |
    Published online on: October 14, 2021
       https://doi.org/10.3892/etm.2021.10881
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Continuous and irreversible cardiac hypertrophy can induce cardiac maladaptation and cardiac remodeling, resulting in increased risk of developing cardiovascular diseases. The present study was conducted to investigate the therapeutic effect of Huoxue Qianyang Qutan recipe (HQQR) on angiotensin II (Ang II)‑induced cardiomyocyte hypertrophy. Primary cardiomyocytes were isolated from the cardiac tissue of neonatal rats, followed by flow cytometry detection to confirm the proportion of primary cardiomyocytes. Cell Counting Kit‑8 assay and immunofluorescence detection were performed to examine the effect of Ang II and HQQR on cardiomyocyte hypertrophy. Reactive oxygen species (ROS) and a series of metabolic indicators were quantified to investigate the effect of HQQR on Ang II‑induced cardiomyocyte hypertrophy. Mitochondrial electron transport chain complex activity and related coding gene expression were determined to explore the effect of HQQR on mitochondrial function. HQQR significantly inhibited Ang II‑induced cardiomyocyte hypertrophy and restored Ang II‑induced ROS accumulation, metabolic indicators, and membrane potential levels. HQQR also regulated the mitochondrial function related to the sirtuin 1 pathway in Ang II‑induced cardiomyocytes by increasing the activity of the mitochondrial electron transport chain complex and affecting the expression of genes encoding mitochondrial electron transport chain complex subunits. HQQR could alleviate Ang II‑induced cardiomyocyte hypertrophy by modulating oxidative stress, accumulating ROS and increasing mitochondrial electron transport chain activity.

Introduction

Cardiovascular diseases (CVDs) are a group of heart and blood vessel disorders that cause ~17.5 million deaths each year and have become the leading cause of death worldwide (1). Cardiac hypertrophy (CH) is an adaptive reaction of cardiomyocytes to pressure overload and neurohumoral and cytokine abnormalities (2), which are manifested by increased size of cardiomyocytes and contractile protein synthesis (3,4). However, continuous pathological stress overload results in irreversible CH and induces cardiac maladaptation and cardiac remodeling (5), thereby increasing the risk of developing various CVDs such as arrhythmia, myocardial ischemia, heart failure and sudden death.

Accumulating studies have demonstrated that, in myocardial remodeling, the content of angiotensin II (Ang II) is directly proportional to the degree of myocardial hypertrophy (6-8). Ang II directly participates in the development of myocardial hypertrophy by generating reactive oxygen species (ROS), reducing membrane potential and inducing mitochondrial dysfunction (6-8). Mitochondria are critical in energy metabolism, signal transduction and cell proliferation of cardiomyocytes (9). Mitochondrial dysfunctions are the major cause of CH, which include mitochondrial ROS increase, electron transport chain protein damage, mitochondrial DNA (mtDNA) damage and a decrease in metabolic capacity (10-12). Therefore, reducing the content of Ang II and maintaining mitochondrial function in cardiomyocytes are potential strategies for the treatment of pathological CH.

Traditional Chinese medicine (TCM) has a history of >2,000 years. It is widely used in Eastern Asia to prevent or treat a multitude of diseases, including CVDs (13). Tanshinones, berberine, matrine/oxymatrine, qiliqiangxin and Radix puerariae are representative compounds that can prevent or alleviate pathological CH and cardiac remodeling (14-17). Huoxue Qianyang Qutan recipe (HQQR) is a TCM compound consisting of Salviae miltiorrhizae, Stone Cassia, Ligusticum chuanxiong, Uncaria angustifolia, mulberry parasite, hawthorn and corn whisker. A previous study demonstrated that, in rats with obesity and hypertension (OBH), HQQR could alleviate mitochondrial dysfunction and left ventricular hypertrophy by modulating the sirtuin 1 (SIRT1)/peroxisome proliferator-activated receptor-gamma coactivator-1α (PGC-1α) deacetylation pathway in vivo (18). Furthermore, one of our previous studies revealed that the TCM Huoxue Qianyang decoction synergized with the activating transcription factor 6/CHOP endoplasmic reticulum stress signaling pathway and improved heart remodeling in rats with OBH (19). However, the therapeutic effect and the specific molecular mechanisms underlying the action of HQQR in Ang II-induced cardiomyocyte hypertrophy remain unclear.

Therefore, the present study was conducted to investigate the effect of HQQR on Ang II-induced cardiomyocyte hypertrophy in isolated primary cardiomyocytes, and to evaluate the role of HQQR in mitochondrial function to explore its underlying mechanism.

Materials and methods

Animals and drugs

All experimental procedures involving animals were approved by the Institutional Animal Care and Use Committee at Yueyang Hospital of Integrated Traditional Chinese and Western Medicine Affiliated to Shanghai University of Traditional Chinese Medicine (approval no. 18922), according to the principles outlined in the National Institutes of Health Guidelines for Care and Use of Laboratory Animals.

Pregnant Sprague Dawley rats (n=2; female; 10 weeks old; 260-270 g) purchased from the Vital River Laboratory Animal Technology Co., Ltd. [animal license number, SCXK (Beijing)] were fed ad libitum in an animal facility room with a 12-h light/dark cycle at a temperature of 20-22˚C, with ~50% humidity. After pregnant rats gave birth, neonatal rats (within 24 h of birth; 5-6 g) were euthanized using CO2 inhalation at a flow rate of 1.2 l/min, which displaces 30% of the cage volume per min, followed with further cervical dislocation.

Valsartan capsules (Novartis International AG) were dissolved in 100% DMSO as 10 mmol/l stock solutions and stored at -80˚C before use. The compound stock solution was diluted in cell culture medium (DMEM medium with 10% FBS and 1% double-antibiotic) to a final concentration of 10 µmol/l (20). HQQR, consisting of Salvia miltiorrhiza, Stone Cassia, Ligusticum chuanxiong, Uncaria angustifolia, corn whisker, mulberry parasite and hawthorn (5:10:3:5:10:5:5), was decocted and dried according to a common protocol (18).

Isolation and culture of rat primary cardiomyocytes

Primary cardiomyocytes were isolated from the cardiac tissue of neonatal rats (within 24 h of birth) as previously described (21). Briefly, the hearts of the neonatal rats were collected, and the atrium of each heart was put into 5-ml sterile centrifuge tubes to be fully cut into small pieces. After full digestion with 0.4% Collagenase IV (cat. no. C4-BIOC; Sigma-Aldrich; Merck KGaA) and 0.05% trypsin-EDTA (cat. no. T1300; Beijing Solarbio Science & Technology Co., Ltd.) in 37˚C constant temperature water bath for 20 min, the cell suspension was centrifuged at room temperature for 10 min at 1,000 x g. After multiple digestion, the cell suspensions were filtered through a 100-mesh filter and mixed, and the cells were cultured at 37˚C in DMEM medium (cat. no. SH30243.01; Hyclone; Cytiva) with 10% FBS (cat. no. 16000-044, Gibco; Thermo Fisher Scientific, Inc.) and 1% double-antibiotic (penicillin-streptomycin; cat. no. P1400; Beijing Solarbio Science & Technology Co., Ltd.) in a 37˚C, 5% CO2 incubator. Next, the isolated cells were subjected to flow cytometry detection of troponin I (troponin I, TnI; 1:50; cat. no. ab196384; Abcam) to identify the purity of primary cardiomyocytes. The morphology of cardiomyocytes was observed, and pictures were captured with a light microscope (magnification, x200).

Experimental procedure

Cardiomyocytes were divided into the following five groups (5x105 cells; 6-well plate): i) Vehicle (solvent group, DMSO); ii) Ang II + vehicle; iii) Ang II + 0.2 mg/ml HQQR; iv) Ang II + 0.5 mg/ml HQQR; and v) Ang II + valsartan. Ang II (cat. no. 4474-91-3) was purchased from Beijing Solarbio Science & Technology Co., Ltd., and the corresponding concentration (1 µmol/l) was prepared according to the manufacturer's instructions. Ang II and HQQR were added at the same time.

Fluorescent immunostaining

Cell suspensions containing 1x105 primary rat cardiomyocytes were added to a 24-well plate and treated with Ang II, Ang II + 0.2 mg/ml HQQR, Ang II + 0.5 mg/ml HQQR, Ang II + 10 µmol/l valsartan, or Ang II + ROS scavenger (1 mM; cat. no. S6205; Selleck Chemicals) for 24 h. Then, slides containing experimental primary cardiomyocytes were harvested, fixed with 4% formaldehyde for 30 min at room temperature, and permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature. After blocking with 1% bovine serum albumin (BSA; cat. no. A8010; Beijing Solarbio Science & Technology Co., Ltd.) in PBS for 30 min at room temperature, the slides were incubated with anti-α-actinin antibody (1:200; cat. no. ab68194; Abcam) and anti-α-smooth muscle actin (α-SMA; 1:500; ab32575; Abcam) overnight at 4˚C in a wet-box. Subsequently, the slides were incubated with Alexa Fluor 555-labeled donkey anti-rabbit IgG (H + L) antibody (1:500; cat. no. A0453; Beyotime Institute of Biotechnology) for 1 h at room temperature in a wet-box before staining the nuclei with DAPI-containing media for 15 min at room temperature (1:500; cat. no. C1002; Beyotime Institute of Biotechnology). Pictures were taken using a fluorescence microscope (Nikon Corporation).

Cell Counting Kit-8 (CCK-8) assay

CCK-8 assay was performed in accordance with the manufacturer's kit protocol (Beyotime Institute of Biotechnology). Cell suspensions containing 3x103 primary rat cardiomyocytes were added to a 96-well plate. The cells were treated with 1 µmol/l Ang II (22) and gradient concentrations of HQQR (0, 0.05, 0.1, 0.2, 0.5 and 1 mg/ml) or valsartan (10 µmol/l) after 24 h of incubation. Finally, 10 µl CCK-8 solution were added into each well, and the cells were incubated in an incubator at 37˚C with 5% CO2 for 1 h. Cell proliferation at 0, 12, 24 and 48 h was detected by recording the optical density at 450 nm (OD450).

Reverse transcription-quantitative PCR

Total RNA was extracted from primary rat cardiomyocytes using TRIzol® reagent (cat. no. 15596026; Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Complementary DNA was synthesized using the RevertAid First Strand cDNA Synthesis kit (Fermentas; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and under the following conditions: 37˚C for 60 min; 85˚C for 5 min; 4˚C for 5 min. mRNA levels were quantified using SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and under the following thermocycling conditions: 95˚C for 10 min; 40 cycles of 95˚C for 15 sec and 60˚C for 45 sec. Relative mRNA levels were obtained using the 2-ΔΔCq method (23). GAPDH was used as an internal control for normalization. The primer sequences are listed in Table I.

Table I

Primers for reverse transcription-quantitative PCR analysis.

Table I

Primers for reverse transcription-quantitative PCR analysis.

GeneForward primer (5' to 3')Reverse Primer (5' to 3')
ANP GGGCTTCTTCCTCTTCCTG TCTGAGACGGGTTGACTTCC
BNP TAGCCAGTCTCCAGAACAATCC ACCTCAGCCCGTCACAGC
β-MHC TGACAACGCCTATCAGTACATG CCTGGGGTCTGGTCCTTC
Sirt1 GGTTAGGTGGCGAGTATGC TATGAAGAGGTGTTGGTGGC
Nrf1 ACCCAAGCATTACGGACC CAGTACCAACCTGGATGAGC
Tfam CGCATACCCTCGCCTGTC GTTCTGAAACTTTTGCATCTGG
Ndufa13 CGGGGACTGTCGGGATAC GGAGGAGTGGCATGAGGG
SDHB TACAAATCCATTGAGCCCTATC GCACTCATACAATCCGTCCAG
COX IV GGCGTGACTACCCCTTGC CTCATTGGTGCCCTTGTTC
COX1 AACTAGGACAACCAGGAGCAC AATCATTAGCGGCACAAGC
ATPase 6 GAGCCGTAATTCTAGGTTTCC ATTGTAGCGGTTGGTGGG
Ppargc1a AACCGCAGTCGCAACATG GGAGGAGTCGTGGGAGGAG
mtDNA AGCTCCAGCTTTTGTTCCC CTTCCGGTTCGTATGTTGTG
GAPDH GGAGTCTACTGGCGTCTTCAC ATGAGCCCTTCCACGATGC

[i] ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; β-MHC, β-myosin heavy chain; Ppargc1a, peroxisome proliferator-activated receptor-gamma coactivator-1α; Nrf1, nuclear respiratory factor 1; Tfam, mitochondrial transcription factor A; Ndufa13, NADH:ubiquinone oxidoreductase subunit A13; SDHB, succinate dehydrogenase complex iron sulfur subunit B; COX IV, cytochrome c oxidase subunit IV; COX1, anti-cyclooxygenase 1; Sirt1, sirtuin 1; mtDNA, mitochondrial DNA.

Western blot analysis

The total protein of primary rat cardiomyocytes was extracted using RIPA buffer, which contained a protease and phosphatase inhibitor (cat. no. R0010; Beijing Solarbio Science & Technology Co., Ltd.). Protein was then quantified using a BCA kit (cat. no. PICPI23223; Thermo Fisher Scientific, Inc.). Subsequently, proteins (25 µg per lane) were separated using 10% SDS-PAGE and transferred to PVDF membranes. After blocking in 5% non-fat milk for 1 h at room temperature, the protein bands were incubated with primary antibodies overnight at 4˚C, followed by incubation with the corresponding secondary antibodies [anti-rabbit (cat. no. A0208; 1:1,000; Beyotime Institute of Biotechnology) or anti-mouse (cat. no. A0216; 1:1,000; Beyotime Institute of Biotechnology) labeled with HRP] at 37°C for 1 h. After a 5-min incubation with Immobilon Western chemiluminescent HRP substrate (cat. no. WBKLS0100; MilliporeSigma) in the dark, the protein bands were visually measured using a chemiluminescent imaging system (Tanon-5200, Tanon Science and Technology Co., Ltd.), and then quantified using ImageJ software (v1.8.0.112; National Institutes of Health). Anti-SIRT1 (cat. no. ab110304; 1:1,000), anti-PGC-1α (cat. no. ab54481; 1:2,000), anti-nuclear respiratory factor 1 (NRF1; cat. no. ab175932; 1:5,000), anti-mitochondrial transcription factor A (Tfam; cat. no. ab131607; 1:2,000), anti-NADH:ubiquinone oxidoreductase subunit A13 (NDUFA13; cat. no. ab110240; 1:1,000), anti-succinate dehydrogenase complex iron sulfur subunit B (SDHB; cat. no. ab178423; 1:5,000), anti-cytochrome c oxidase subunit IV (COX IV; cat. no. ab16056; 1:500), anti-cyclooxygenase 1 (COX1; cat. no. ab695; 1:1,000), anti-ATPase 6 (cat. no. ab192423; 1:500), anti-brain natriuretic peptide (BNP; cat. no. ab239510; 1:2,000), anti-Bax (cat. no. ab32503; 1:5,000), anti-Bcl-2 (cat. no. ab196495; 1:1,000) antibodies were obtained from Abcam, anti-cleaved caspase 3 (cat. no. 9661; 1:1,000), anti-caspase 3 (cat. no. 9662; 1:1,000) were obtained from CST, anti-atrial natriuretic peptide (ANP; cat. no. RQ4453; 0.5 µg/ml) antibody was obtained from NSJ Bioreagents, anti-β-myosin heavy chain (β-MHC; cat. no. MA1-26180; 0.5 µg/ml) antibody was obtained from Invitrogen; Thermo Fisher Scientific, Inc., and anti-GAPDH as a loading control (cat. no. 60004-1-1G; 1:5,000) was obtained from ProteinTech Group, Inc. The antibodies were diluted in PBST (containing 0.05% Tween-20).

ROS detection

ROS accumulation in cardiomyocytes was quantified using the Active Oxygen Detection kit (cat. no. S0033; Beyotime Institute of Biotechnology) according to the manufacturer's instructions. After treatment with 1 µmol/l Ang II and HQQR (0.2 and 0.5 mg/ml) or valsartan (10 µmol/l), DCFH-DA probe solution was prepared and used for incubation with the harvested cell samples at 37˚C for 30 min in the dark. The cells and solution were gently inverted every 10 min. After washing three times with DMEM without serum, the samples were examined via flow cytometry (Accuri C6; BD Biosciences) using FlowJo software (v10.0.7r2; Tree Star, Inc.).

Biochemical detection

Primary rat cardiomyocytes were treated with 1 µmol/l Ang II and HQQR (0.2 and 0.5 mg/ml) or valsartan (10 µmol/l) for 24 h, and then, the cells were collected, and the supernatant was kept. The levels of ATP and protein carbonyl, and the activities of glutathione peroxidase (GSH-PX), catalase (CAT), malondialdehyde (MDA) and superoxide dismutase (SOD) were respectively detected using the BCA (cat. no. A045-3), ATP (cat. no. A095), protein carbonyl (cat. no. A087), GSH-PX (cat. no. A005), CAT (cat. no. A007-1), MDA (cat. no. A003-2) and SOD (cat. no. A001-1) kits (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions, and measured using a visible spectrophotometer. The activities of the mitochondrial complexes I-IV and V were respectively detected using the mitochondrial complex I (cat. no. BC0515), II (cat. no. BC3235), III (cat. no. BC3245), IV (cat. no. BC0945) and V (cat. no. BC1445) Activity Test kits (Beijing Solarbio Science & Technology Co., Ltd.) and measured using a UV spectrophotometer.

Mitochondrial potential assay

Alterations in mitochondrial membrane potential were evaluated using the Mitochondrial Membrane Potential Detection kit with JC-1 (cat. no. C2006; Beyotime Institute of Biotechnology). According to the manufacturer's instructions, the cell suspension was prepared and detected using a flow cytometer (Accuri C6; BD Biosciences) via the software of Flow Jo (v10.0.7r2 version). JC-1 is an ideal fluorescent probe widely used to detect mitochondrial membrane potential. In high mitochondrial membrane potential, JC-1 aggregates in the matrix of mitochondria and forms polymer (J-aggregates), which produces red fluorescence. When the mitochondrial membrane potential is low, JC-1 cannot aggregate in the matrix of mitochondria. At this time, JC-1 is a monomer and can produce green fluorescence.

Cell apoptosis

Primary rat cardiomyocyte cells after 24 h treatment with Ang II, Ang II + 0.2 mg/ml HQQR, Ang II + 0.5 mg/ml HQQR, Ang II + 10 µmol/l valsartan were stained using Annexin V Apoptosis kit (C1062; Beyotime Institute of Biotechnology) according to the manufacturer's instructions and a Beckman CytoFLEX Flow Cytometer (Beckman Coulter, Inc.) with FlowJo software (v10.0.7r2; Tree Star, Inc.) was used to analyze apoptosis.

Statistical analysis

Statistical analysis was conducted using GraphPad Prism 7.0 software (GraphPad Software, Inc.). Data are presented as the mean ± SD. One-way ANOVA followed by Tukey's post hoc test was applied for comparisons between groups. Results are representative of at least three repeated experiments. P<0.05 was considered to indicate a statistically significant difference.

Results

HQQR attenuates the inhibitory effect of Ang II on rat cardiomyocyte proliferation

To investigate the effect of HQQR on Ang II-induced cardiomyocyte hypertrophy, rat primary cardiomyocytes were isolated. After detection using TnI, the results of flow cytometry analysis confirmed that ~95% of the isolated cells were primary cardiomyocytes (Fig. 1A). Microscopic observations (light microscope) also indicated that the isolated cell morphology was consistent with the morphological characteristics of primary cardiomyocytes (Fig. 1B), including a short columnar form with generally only one nucleus being mostly located in the middle of the cell, while the cell shape is ellipse- or rectangle-like, and its long axis is in the same direction as in myofibrils. The cytotoxicity of HQQR was detected using a CCK-8 assay (Fig. S1), the results of which revealed that 0.2 and 0.5 mg/ml HQQR had no cytotoxicity and the 24 h after treatment had the best effect. Cell proliferation experiments revealed that, compared with normally cultured (medium without other treatment) primary cardiomyocytes, Ang II (1 µmol/l) treatment significantly inhibited the proliferation of primary cardiomyocytes, which was markedly abolished by incubation with valsartan (10 µmol/l), the antagonist of angiotensin receptor used as a positive control. The addition of HQQR solution ameliorated the inhibitory effect of Ang II on primary cardiomyocyte proliferation in a dose-dependent manner (Fig. 1C). On the basis of the present results, Ang II treatment for 24 h followed by 0.2 and 0.5 mg/ml HQQR concentrations were selected as treatment conditions for subsequent experiments. Valsartan was used as a positive control.

Figure 1

HQQR attenuates the inhibitory effect of Ang II on rat cardiomyocyte proliferation. (A) TnI was detected using flow cytometry analysis to identify the percentage of primary cardiomyocytes. (B) Image of isolated primary rat cardiomyocytes (magnification, x200; scale bar, 50 µm). (C) Cell Counting Kit-8 assays were used to examine the proliferation of primary cardiomyocytes at 0, 12, 24 and 48 h after treatment with Ang II (1 µmol/l) and HQQR powder (0, 0.05, 0.1, 0.2, 0.5 and 1 mg/ml). Vehicle and valsartan were used as negative and positive controls, respectively. ***P<0.001 vs. the vehicle group; #P<0.05, ##P<0.01 and ###P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II; TnI, troponin I; OD, optical density.

HQQR improves AngII-induced cardiomyocyte hypertrophy

To further examine the role of HQQR in Ang II-induced cardiomyocyte hypertrophy, primary cardiomyocytes were divided into the following five groups: i) Vehicle; ii) Ang II (1 µmol/l) + vehicle; iii) Ang II (1 µmol/l) + HQQR (0.2 mg/ml); iv) Ang II (1 µmol/l) + HQQR (0.5 mg/ml); and v) valsartan + Ang II (1 µmol/l). The immunofluorescence of α-actinin revealed that, compared with that in the vehicle group, cardiomyocyte hypertrophy was observed in the Ang II-treated group, indicating that Ang II induced cardiomyocyte hypertrophy. However, treatment with HQQR could significantly inhibit Ang II-induced cardiomyocyte hypertrophy (Fig. 2A) and reduce the Ang II-induced expression of the myocardial hypertrophy markers ANP, BNP and β-MHC (Fig. 2B and C). Valsartan was used as a positive control.

Figure 2

HQQR improves Ang II-induced cardiomyocyte hypertrophy. (A) Immunofluorescence experiments were performed using anti-α-actinin antibodies to analyze cardiomyocyte hypertrophy (magnification, x200; scale bar, 50 µm). (B) mRNA expression levels of the myocardial hypertrophy markers ANP, BNP and β-MHC were examined using reverse transcription-quantitative PCR. (C) Protein expression levels of the myocardial hypertrophy markers ANP, BNP and β-MHC were examined using western blotting. **P<0.01 and ***P<0.001 vs. the vehicle group; #P<0.05, ##P<0.01 and ###P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide; β-MHC, β-major histocompatibility complex.

HQQR alleviates AngII-induced cardiomyocyte hypertrophy by modulating ROS accumulation

Ang II treatment markedly enhanced ROS accumulation, whereas treatment with HQQR significantly inhibited ROS accumulation in Ang II-treated primary cardiomyocytes, in a dose-dependent manner (Fig. 3A). HQQR could also rescue the effect of Ang II treatment on the levels of MDA, SOD, ATP, CAT, GSH-Px and protein carbonyl in primary cardiomyocytes (Fig. 3B-G). Consistent with these results, the immunofluorescence of α-SMA revealed that ROS was directly involved in AngII-induced cardiomyocyte hypertrophy, and that the ROS scavenger alleviated AngII-induced cardiomyocyte hypertrophy (Fig. 3H). The present findings suggested that HQQR treatment could alleviate Ang II-induced cardiomyocyte hypertrophy, potentially by modulating ROS accumulation. Valsartan was used as a positive control.

Figure 3

HQQR alleviates AngII-induced cardiomyocyte hypertrophy by modulating ROS accumulation. (A) Flow cytometry analysis to detect the changes in ROS accumulation. Levels of (B) ATP and (C) protein carbonyl content, and activities of (D) MDA, (E) SOD, (F) CAT and (G) GSH-Px were quantified. (H) Immunofluorescence experiments were performed using anti-α-SMA antibodies to analyze cardiomyocyte hypertrophy (magnification, x200; scale bar, 50 µm). **P<0.01 and ***P<0.001 vs. the vehicle group; #P<0.05, ##P<0.01 and ###P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II; MDA, malondialdehyde; SOD, superoxide dismutase; CAT, catalase; GSH-PX, glutathione peroxidase; α-SMA, α-smooth muscle actin.

HQQR reverts cardiomyocyte hypertrophy-induced membrane potential reduction and apoptosis increase

Ang II treatment notably reduced mitochondrial membrane potential (Fig. 4A) and increased cell apoptosis (Fig. 4B). In Ang II-stimulated cardiomyocytes, treatment with HQQR significantly reversed the hypertrophy-induced membrane potential reduction and apoptosis in a dose-dependent manner. Moreover, Ang II induced the expression of apoptosis-related proteins Bax and cleaved caspase 3, which were significantly decreased upon HQQR treatment, while anti-apoptotic Bcl-2 was significantly decreased by Ang-II and increased by HQQR (Fig. S2). Valsartan was used as a positive control.

Figure 4

HQQR reverts cardiomyocyte hypertrophy-induced membrane potential reduction and apoptosis increase. (A) Flow cytometry analysis to detect the changes in membrane potential. (B) Flow cytometry analysis to detect the changes in cell apoptosis. **P<0.01 and ***P<0.001 vs. the vehicle group; #P<0.05, ##P<0.01 and ###P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II.

HQQR increases the activity of mitochondrial electron transport chain complexes in Ang II-treated rat cardiomyocytes

To further explore the mechanism by which HQQR affects Ang II-induced cardiomyocyte hypertrophy, the activities of the mitochondrial complexes I-IV and V were studied 24 h after treatment. As presented in Fig. 5A, Ang II markedly inhibited the activity of the mitochondrial complexes I-IV and V, whereas the addition of HQQR or valsartan partially rescued their activities. Furthermore, HQQR or valsartan treatment markedly inhibited Ang II-induced mtDNA leakage (Fig. 5B). The mRNA and protein expressions of genes encoding the mitochondrial complex and involved in mitochondrial biogenesis were subsequently evaluated. As indicated in Figs. 5C and S3, Ang II treatment reduced both mRNA and protein levels of SIRT1, PGC-1α, NRF1, Tfam, NDUFA13, COX IV, COX1 and ATPase 6, and elevated the expression of SDHB. These effects were notably rescued by treatment with HQQR or valsartan, which was used as a positive control.

Figure 5

HQQR increases the activity of mitochondrial electron transport chain complexes in Ang II-treated rat cardiomyocytes. (A) The activities of the mitochondrial complexes I-IV and V were determined. (B) The level of mtDNA was quantified using RT-qPCR. (C) Protein levels of SIRT1, PGC-1α, NRF1, Tfam, NDUFA13, SDHB, COX IV, COX1 and ATPase 6 in primary cardiomyocytes were examined by western blotting. **P<0.01 and ***P<0.001 vs. the vehicle group; #P<0.05 and ##P<0.01 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II; SIRT1, sirtuin 1; mtDNA, mitochondrial DNA; RT-qPCR, reverse transcription-quantitative PCR; PGC-1α, peroxisome proliferator-activated receptor-gamma coactivator-1α; NRF1, nuclear respiratory factor 1; Tfam, mitochondrial transcription factor A; NDUFA13, NADH:ubiquinone oxidoreductase subunit A13; SDHB, succinate dehydrogenase complex iron sulfur subunit B; COX IV, cytochrome c oxidase subunit IV; COX1, anti-cyclooxygenase 1; RT-qPCR, reverse transcription-quantitative PCR.

Discussion

CH is generally considered to be a major inducer of several types of CVDs (24). There is a need to explore effective therapeutic targets with low toxicity for the clinical treatment of CH and CVDs. Because of its low toxicity, TCM has been used to treat chronic diseases in East Asia throughout history. Several types of TCM have been demonstrated to be effective for CH treatment by affecting multiple signaling pathways or physiological activities. For instance, Bu-Shen-Jiang-Ya decoction suppressed left ventricular hypertrophy by regulating the extracellular signal-regulated kinase signaling pathway in spontaneously hypertensive rats (25). Moreover, QiShenYiQi pills ameliorated fatigue-induced CH through the regulation of energy metabolism (26). Qiliqiangxin was also found to attenuate phenylephrine-induced CH by upregulating peroxisome proliferator-activated receptor γ and PGC-1α (27). Combined with the role of HQQR (18,19) in hypertensive rats, these findings provide evidence that TCM or a combination therapy of TCM and western medicine has the potential to treat CH. It is necessary to investigate TCM targeting CH treatment further, along with the potential mechanisms to prevent drug resistance and improve therapeutic effectiveness.

In the present study, the CCK-8 and immunofluorescence experiments confirmed that Ang II could induce CH (6). Functional analysis of HQQR in the treatment of CH revealed that HQQR significantly alleviated Ang II-induced CH in primary cardiomyocytes, thereby suggesting the significance of HQQR in CH treatment.

The mechanism by which HQQR abolished Ang II-induced CH was investigated. Mitochondria are double-membrane organelles that support a variety of physiological activities, including energy production, cell death and oxidative metabolism (9). Mitochondrial dysfunction has been implicated in the occurrence and development of cardiomyocyte hypertrophy (28). Mitochondrial biogenesis is essential for sustaining mitochondrial function and is related to ROS production (29). Although acute or mild oxidative stress can trigger mitochondrial biogenesis due to the involvement of mitochondrial quality control (30), the present study reported that Ang II treatment promoted the accumulation of ROS in cardiomyocytes and induced the disturbance of mitochondrial biogenesis, which may further result in cardiomyocyte injury and hypertrophy. HQQR treatment attenuated oxidative stress and restored the levels of mitochondrial transcription factors in cardiomyocytes. The inhibition of ROS accumulation and the normal activity of mitochondrial electron transport chain are crucial for alleviating mitochondrial-related diseases (10). After Ang II-induced ROS production, ROS activate several critical signaling pathways related to cell death and fibrosis, such as the mitogen-activated protein kinase pathway, the extracellular regulated protein kinase signaling pathway, protein kinase C signaling and NF-κB; these signaling pathways participate in the process of CH (31-33). Therefore, drugs that directly or indirectly target ROS production might inhibit the occurrence or development of CH. As anticipated, HQQR treatment significantly reduced the accumulation of ROS and the indicators of oxidative stress, and elevated the levels of scavenging system indicators, such as SOD, CAT and GSH-PX, thus suggesting that HQQR partially prevented Ang II-induced CH by reducing the accumulation of ROS and repressing oxidative stress in myocardial cells. Ang II reduced the activity of the mitochondrial electron transport chain and suppressed the expression of mitochondrial complex subunits in cardiomyocytes; however, this impact was significantly reverted by HQQR treatment, indicating that HQQR could also exert its therapeutic effect by maintaining normal electron transfer.

HQQR treatment increased the ATP content in cardiomyocytes and elevated the levels of NRF1 and Tfam, which are critical for mitochondrial biogenesis. SIRT1 is a deacetylase that plays a key role in cell proliferation, differentiation, senescence, apoptosis and metabolism (34). The SIRT1/PGC-1α pathway contributes to mitochondrial dysfunction and mitochondrial biogenesis (35,36). Inhibition of PGC-1α or PGC-1α deacetylation significantly abolishes the process leading to CH (27). The present study indicated that HQQR rescued Ang II-inhibited SIRT1 and PGC-1α expression, thus implying that HQQR protected cardiomyocytes from the development of CH by enhancing the SIRT1/PGC-1α regulatory pathway. It can be speculated that HQQR improves mitochondrial biosynthesis, leading to the reduction of oxidative stress.

Currently, there are relatively few studies on the efficacy of HQQR in CVDs. The present study provided evidence for the protective role of HQQR in CH, enriching the strategies for CH treatment. Furthermore, our previous study (18) confirmed the effect of HQQR in glucolipid metabolism and blood pressure regulation, thereby demonstrating the potential of HQQR in treating metabolic diseases and CVDs.

However, the effect of HQQR on the development of CH was only investigated at the cellular level. Therefore, in vivo experiments are required to further confirm the therapeutic effect of HQQR on CH and further explore underlying molecular mechanisms to expand the clinical application of HQQR.

The present study provided evidence that Ang II treatment could induce CH in primary cardiomyocytes, and that HQQR could significantly prevent Ang II-induced CH by preventing mitochondrial dysfunction and oxidative stress, reducing ROS accumulation and protecting the electron transport chain. Although additional studies are required to further verify the function and mechanisms of HQQR in the development of CH, the present study implied that HQQR could be considered a novel approach for CH treatment.

Supplementary Material

HQQR cytotoxicity. (A) CCK-8 assays were performed to examine the proliferation of primary cardiomyocytes at 0 and 24 h after treatment with various doses of HQQR solution (0, 0.05, 0.1, 0.2, 0.5 and 1 mg/ml). *P<0.05, **P<0.01 and * * *P<0.001, vs. the 0 mg/ml HQQR group; #P<0.05 and ##P<0.01 vs. 0.1 mg/ml HQQR group. (B) CCK-8 assays to examine the proliferation of primary cardiomyocytes at 0, 12, 24 and 48 h after treatment with 0.2 and 0.5 mg/ml HQQR solution. *P<0.05, **P<0.01 and ***P<0.001 vs. the 0 mg/ml HQQR group. OD, optical density; HQQR, Huoxue Qianyang Qutan recipe; CCK-8, Cell Counting Kit-8.
Protein expression levels of apoptosis-related proteins Bax, Bcl-2 and cleaved caspase 3 were examined using western blotting. ***P<0.001 vs. the vehicle group; #P<0.05, # #P<0.01 and # # #P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II.
(A) mRNA levels of SIRT1, PGC-1α, NRF1, Tfam, NDUFA13, SDHB, COX IV, COX1 and ATPase 6 in primary cardiomyocytes were examined via reverse transcription-quantitative PCR. (B) Histogram of protein levels quantification was shown. **P<0.01 and ***P<0.001 vs. the vehicle group; #P<0.05, ##P<0.01 and ###P<0.001 vs. the Ang II + vehicle group. HQQR, Huoxue Qianyang Qutan recipe; Ang II, angiotensin II; SIRT1, sirtuin 1; mtDNA, mitochondrial DNA; PGC-1α, peroxisome proliferator-activated receptor-gamma coactivator-1α; NRF1, nuclear respiratory factor 1; Tfam, mitochondrial transcription factor A; NDUFA13, NADH:ubiquinone oxidoreductase subunit A13; SDHB, succinate dehydrogenase complex iron sulfur subunit B; COX IV, cytochrome c oxidase subunit IV; COX1, anti-cyclooxygenase 1.

Acknowledgements

Not applicable.

Funding

The present study was funded by the National Natural Science Foundation of China (grant nos. 81774111 and 81803892) and Scientific research projects of Shanghai Science and Technology Commission (grant no. 19401970400).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

DF conceived and designed the study. MG, LY, BL, JW, XZ, JL and ZD performed the experiments. DF wrote the manuscript. DF and MG have confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

All the experiments conducted in the present study were approved by the Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine Affiliated to Shanghai University of Traditional Chinese Medicine (approval no. 18922, Shanghai, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Badimon L, Chagas P and Chiva-Blanch G: Diet and cardiovascular disease: Effects of foods and nutrients in classical and emerging cardiovascular risk factors. Curr Med Chem. 26:3639–3651. 2019.PubMed/NCBI View Article : Google Scholar

2 

Xu L, Su Y, Zhao Y, Sheng X, Tong R, Ying X, Gao L, Ji Q, Gao Y, Yan Y, et al: Melatonin differentially regulates pathological and physiological cardiac hypertrophy: Crucial role of circadian nuclear receptor RORα signaling. J Pineal Res. 67(e12579)2019.PubMed/NCBI View Article : Google Scholar

3 

Shimizu I and Minamino T: Physiological and pathological cardiac hypertrophy. J Mol Cell Cardiol. 97:245–262. 2016.PubMed/NCBI View Article : Google Scholar

4 

Heineke J and Molkentin JD: Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol. 7:589–600. 2006.PubMed/NCBI View Article : Google Scholar

5 

Nakamura M and Sadoshima J: Mechanisms of physiological and pathological cardiac hypertrophy. Nat Rev Cardiol. 15:387–407. 2018.PubMed/NCBI View Article : Google Scholar

6 

Tsuruda T, Sekita-Hatakeyama Y, Hao Y, Sakamoto S, Kurogi S, Nakamura M, Udagawa N, Funamoto T, Sekimoto T, Hatakeyama K, et al: Angiotensin II stimulation of cardiac hypertrophy and functional decompensation in osteoprotegerin-deficient mice. Hypertension. 67:848–856. 2016.PubMed/NCBI View Article : Google Scholar

7 

Luo YX, Tang X, An XZ, Xie XM, Chen XF, Zhao X, Hao DL, Chen HZ and Liu DP: SIRT4 accelerates Ang II-induced pathological cardiac hypertrophy by inhibiting manganese superoxide dismutase activity. Eur Heart J. 38:1389–1398. 2017.PubMed/NCBI View Article : Google Scholar

8 

Liu Y, Jiao R, Ma ZG, Liu W, Wu QQ, Yang Z, Li FF, Yuan Y, Bian ZY and Tang QZ: Sanguinarine inhibits angiotensin II-induced apoptosis in H9c2 cardiac cells via restoring reactive oxygen species-mediated decreases in the mitochondrial membrane potential. Mol Med Rep. 12:3400–3408. 2015.PubMed/NCBI View Article : Google Scholar

9 

Murphy E, Ardehali H, Balaban RS, DiLisa F, Dorn GW II, Kitsis RN, Otsu K, Ping P, Rizzuto R, Sack MN, et al: Mitochondrial function, biology, and role in disease: A scientific statement from the American heart association. Circ Res. 118:1960–1991. 2016.PubMed/NCBI View Article : Google Scholar

10 

Peoples JN, Saraf A, Ghazal N, Pham TT and Kwong JQ: Mitochondrial dysfunction and oxidative stress in heart disease. Exp Mol Med. 51:1–13. 2019.PubMed/NCBI View Article : Google Scholar

11 

Cai J, Shi G, Zhang Y, Zheng Y, Yang J, Liu Q, Gong Y, Yu D and Zhang Z: Taxifolin ameliorates DEHP-induced cardiomyocyte hypertrophy via attenuating mitochondrial dysfunction and glycometabolism disorder in chicken. Environ Pollut. 255(113155)2019.PubMed/NCBI View Article : Google Scholar

12 

Tian H, Yu D, Hu Y, Zhang P, Yang Y, Hu Q and Li M: Angiotensin II upregulates cyclophilin A by enhancing ROS production in rat cardiomyocytes. Mol Med Rep. 18:4349–4355. 2018.PubMed/NCBI View Article : Google Scholar

13 

Hao P, Jiang F, Cheng J, Ma L, Zhang Y and Zhao Y: Traditional Chinese medicine for cardiovascular disease: Evidence and potential mechanisms. J Am Coll Cardiol. 69:2952–2966. 2017.PubMed/NCBI View Article : Google Scholar

14 

Gao S, Liu Z, Li H, Little PJ, Liu P and Xu S: Cardiovascular actions and therapeutic potential of tanshinone IIA. Atherosclerosis. 220:3–10. 2012.PubMed/NCBI View Article : Google Scholar

15 

Tan X, Li J, Wang X, Chen N, Cai B, Wang G, Shan H, Dong D, Liu Y, Li X, et al: Tanshinone IIA protects against cardiac hypertrophy via inhibiting calcineurin/NFATc3 pathway. Int J Biol Sci. 7:383–389. 2011.PubMed/NCBI View Article : Google Scholar

16 

Huang XY and Chen CX: Effect of oxymatrine, the active component from Radix Sophorae flavescentis (Kushen), on ventricular remodeling in spontaneously hypertensive rats. Phytomedicine. 20:202–212. 2013.PubMed/NCBI View Article : Google Scholar

17 

Liu Y, Liang S, Bu P, Liang E, Yan F, Xing Y and Zhang P: Radix Puerariae rebalances vasomotor factors and improves left ventricular diastolic dysfunction in patients with essential hypertension. Exp Ther Med. 20:705–713. 2020.PubMed/NCBI View Article : Google Scholar

18 

Wang J, Dong ZH, Gui MT, Yao L, Li JH, Zhou XJ and Fu DY: HuoXue QianYang QuTan recipe attenuates left ventricular hypertrophy in obese hypertensive rats by improving mitochondrial function through SIRT1/PGC-1α deacetylation pathway. Biosci Rep. 39(BSR20192909)2019.PubMed/NCBI View Article : Google Scholar

19 

Zhou X, Lu B, Fu D, Gui M, Yao L and Li J: Huoxue Qianyang decoction ameliorates cardiac remodeling in obese spontaneously hypertensive rats in association with ATF6-CHOP endoplasmic reticulum stress signaling pathway regulation. Biomed Pharmacother. 121(109518)2020.PubMed/NCBI View Article : Google Scholar

20 

Vaskova E, Ikeda G, Tada Y, Wahlquist C, Mercola M and Yang PC: Sacubitril/valsartan improves cardiac function and decreases myocardial fibrosis via downregulation of exosomal miR-181a in a rodent chronic myocardial infarction model. J Am Heart Assoc. 9(e015640)2020.PubMed/NCBI View Article : Google Scholar

21 

Ehler E, Moore-Morris T and Lange S: Isolation and culture of neonatal mouse cardiomyocytes. J Vis Exp. (50154)2013.PubMed/NCBI View Article : Google Scholar

22 

Xing L and Li Z: Angiotensin II induced myocardial hypertrophy in neonatal rats could be attenuated by activated κ-opioid receptor via modulating the calcineurin signal pathways. Zhonghua Xin Xue Guan Bing Za Zhi. 43:254–258. 2015.PubMed/NCBI(In Chinese).

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

24 

Li H, Sureda A, Devkota HP, Pittalà V, Barreca D, Silva AS, Tewari D, Xu S and Nabavi SM: Curcumin, the golden spice in treating cardiovascular diseases. Biotechnol Adv. 38(107343)2020.PubMed/NCBI View Article : Google Scholar

25 

Xiong X, Yang X, Duan L, Liu W, Zhang Y, Liu Y, Wang P, Li S and Li X: Traditional Chinese medicine suppresses left ventricular hypertrophy by targeting extracellular signal-regulated kinases signaling pathway in spontaneously hypertensive rats. Sci Rep. 7(42965)2017.PubMed/NCBI View Article : Google Scholar

26 

Huang R, Cui YC, Wei XH, Pan CS, Li Q, He SY, Fan JY and Han JY: A novel traditional Chinese medicine ameliorates fatigue-induced cardiac hypertrophy and dysfunction via regulation of energy metabolism. Am J Physiol Heart Circ Physiol. 316:H1378–H1388. 2019.PubMed/NCBI View Article : Google Scholar

27 

Gao RR, Wu XD, Jiang HM, Zhu YJ, Zhou YL, Zhang HF, Yao WM, Li YQ and Li XL: Traditional Chinese medicine Qiliqiangxin attenuates phenylephrine-induced cardiac hypertrophy via upregulating PPARγ and PGC-1α. Ann Transl Med. 6(153)2018.PubMed/NCBI View Article : Google Scholar

28 

Zou R, Tao J, Qiu J, Shi W, Zou M, Chen W, Li W, Zhou N, Wang S, Ma L and Chen X: Ndufs1 deficiency aggravates the mitochondrial membrane potential dysfunction in pressure overload-induced myocardial hypertrophy. Oxid Med Cell Longev. 2021(5545261)2021.PubMed/NCBI View Article : Google Scholar

29 

Thirupathi A and de Souza CT: Multi-regulatory network of ROS: The interconnection of ROS, PGC-1 alpha, and AMPK-SIRT1 during exercise. J Physiol Biochem. 73:487–494. 2017.PubMed/NCBI View Article : Google Scholar

30 

St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jäger S, Handschin C, Zheng K, Lin J, Yang W, et al: Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell. 127:397–408. 2006.PubMed/NCBI View Article : Google Scholar

31 

Rababa'h AM, Guillory AN, Mustafa R and Hijjawi T: Oxidative stress and cardiac remodeling: An updated edge. Curr Cardiol Rev. 14:53–59. 2018.PubMed/NCBI View Article : Google Scholar

32 

Gallo S, Vitacolonna A, Bonzano A, Comoglio P and Crepaldi T: ERK: A key player in the pathophysiology of cardiac hypertrophy. Int J Mol Sci. 20(2164)2019.PubMed/NCBI View Article : Google Scholar

33 

Singh RM, Cummings E, Pantos C and Singh J: Protein kinase C and cardiac dysfunction: A review. Heart Fail Rev. 22:843–859. 2017.PubMed/NCBI View Article : Google Scholar

34 

Lee Y, Jeong GS, Kim KM, Lee W and Bae JS: Cudratricusxanthone A attenuates sepsis-induced liver injury via SIRT1 signaling. J Cell Physiol. 233:5441–5446. 2018.PubMed/NCBI View Article : Google Scholar

35 

Cui L, Guo J, Zhang Q, Yin J, Li J, Zhou W, Zhang T, Yuan H, Zhao J, Zhang L, et al: Erythropoietin activates SIRT1 to protect human cardiomyocytes against doxorubicin-induced mitochondrial dysfunction and toxicity. Toxicol Lett. 275:28–38. 2017.PubMed/NCBI View Article : Google Scholar

36 

Zhang T, Chi Y, Ren Y, Du C, Shi Y and Li Y: Resveratrol reduces oxidative stress and apoptosis in podocytes via Sir2-related enzymes, sirtuins1 (SIRT1)/peroxisome proliferator-activated receptor γ co-activator 1α (PGC-1α) axis. Med Sci Monit. 25:1220–1231. 2019.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gui M, Yao L, Lu B, Wang J, Zhou X, Li J, Dong Z and Fu D: Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. Exp Ther Med 22: 1446, 2021.
APA
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J. ... Fu, D. (2021). Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. Experimental and Therapeutic Medicine, 22, 1446. https://doi.org/10.3892/etm.2021.10881
MLA
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J., Dong, Z., Fu, D."Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production". Experimental and Therapeutic Medicine 22.6 (2021): 1446.
Chicago
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J., Dong, Z., Fu, D."Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production". Experimental and Therapeutic Medicine 22, no. 6 (2021): 1446. https://doi.org/10.3892/etm.2021.10881
Copy and paste a formatted citation
x
Spandidos Publications style
Gui M, Yao L, Lu B, Wang J, Zhou X, Li J, Dong Z and Fu D: Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. Exp Ther Med 22: 1446, 2021.
APA
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J. ... Fu, D. (2021). Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production. Experimental and Therapeutic Medicine, 22, 1446. https://doi.org/10.3892/etm.2021.10881
MLA
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J., Dong, Z., Fu, D."Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production". Experimental and Therapeutic Medicine 22.6 (2021): 1446.
Chicago
Gui, M., Yao, L., Lu, B., Wang, J., Zhou, X., Li, J., Dong, Z., Fu, D."Huoxue Qianyang Qutan recipe attenuates Ang II‑induced cardiomyocyte hypertrophy by regulating reactive oxygen species production". Experimental and Therapeutic Medicine 22, no. 6 (2021): 1446. https://doi.org/10.3892/etm.2021.10881
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team