![Open Access](/resources/images/iconopenaccess.png)
MicroRNA‑424 alleviates neurocyte injury by targeting PDCD4 in a cellular model of cerebral ischemic stroke
- Authors:
- Published online on: October 15, 2021 https://doi.org/10.3892/etm.2021.10888
- Article Number: 1453
-
Copyright: © Ren et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Stroke is characterized with high morbidity, mortality and disability (1). Strokes can be stratified into ischemic and hemorrhagic categories, which account for ~80% and 20% of all strokes, respectively (2). Cerebral ischemic stroke is induced by the development of a thrombus within the major cerebral artery, contributing to the apoptosis of neuronal cells (3,4). The only efficacious therapies for cerebral ischemic stroke are dissolving the thrombus or using tissue plasminogen activators (5). However, the number of patients with cerebral ischemic stroke receiving these treatments is ≤4.5% (6). Additionally, secondary neuronal death may occur due to cerebral infarction, resulting in long-term neurological deficits (7). The incidence and mortality rate of ischemic stroke has been increasing annually in China (8), exerting a notable threat to public health. In 2017, a survey of 155 urban and rural centers in 31 provinces in China showed that the age-standardized prevalence, incidence and mortality rates were 1,114.8 per 100,000, 246.8 and 114.8 per 100,000 person-years, respectively (9). Therefore, there is a requirement to explore novel and effective treatment options for cerebral ischemic stroke. It has been reported that neuronal cell apoptosis following cerebral ischemia/reperfusion (I/R) is the primary cause of brain injury (10,11). Prevention of neuronal cell apoptosis is a potential treatment aim for ischemic stroke (12). Therefore, it is important to explore the underlying mechanisms of ischemic neuronal death.
MicroRNAs (miRNAs/miRs) are a family of small single-stranded non-coding RNAs (13). miRNAs serve important roles in various cellular processes, including cell proliferation, differentiation and apoptosis (14). Dysregulation of miRNAs influences various diseases, including stroke (15). Various studies have reported that aberrant expression of miRNAs influences cerebral ischemic stroke. For example, upregulation of miR-130b mediates cerebral ischemic injury in astrocytes (16). Furthermore, upregulation of miR-145 alleviates primary astrocyte injury following cerebral ischemic stroke in vitro (17). Notably, the abnormal expression of miRNAs is associated with neurological disorders and regulates the expression of apoptosis-associated genes (18). Dysregulated expression of miR-525-5p ameliorates I/R injury-induced neuronal cell death in a study in adult rats (19). Upregulation of miR-9 has been reported to suppress neuronal apoptosis in rats with ischemic stroke (20). A previous study reported that lower levels of circulating miR-424 in patients with acute cerebral infarction may predict poor prognosis, where the expression of circulating miR-424 is negatively associated with the serum levels of certain pro-inflammatory cytokines (21). This suggests that circulating miR-424 may have the potential to serve as a prognostic marker and therapeutic target for the management of acute cerebral infarction. However, the potential mechanisms of miR-424 in cerebral infarction have not been fully elucidated.
The PC12 cell line is a cloned cell line from rat adrenal pheochromocytoma that is widely used as a model to study neuronal cell differentiation and function (22,23). This cell line is favored due to its high stability, homogeneity and differentiation (24,25). Hypoxia of brain tissue after cerebral infarction causes a large amount of hypoxia inducible factor (HIF)-1 accumulation, mitochondrial dysfunction, free radical eruption, which leads to nerve cell damage (26). Chronic hypoxia occurs in nerve cells due to the inability to efficiently transport and utilize oxygen after CoCl2 treatment (27). CoCl2 induced a series of changes in nerve cells similar to the effects of hypoxia (28). Therefore, CoCl2 is an ideal compound for establishing a chronic hypoxia model.
Programmed cell death factor 4 (PDCD4) is originally described as a tumor suppressor gene that exerts antineoplastic effects by promoting apoptosis (29). The present findings suggested that miR-424 may represent a promising biomarker for cerebral ischemic stroke. However, the mechanism of miR-424 in acute cerebral infarction remains unclear. In the present study, the regulatory role of miR-424 was investigated in an in vitro model of acute cerebral infarction.
Materials and methods
Cell culture
PC12 cells were obtained from American Type Culture Collection. Cells were incubated at 37˚C in DMEM containing 5% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin (all from Gibco; Thermo Fisher Scientific, Inc.) at 5% CO2 until they reached 60-70% confluence. The cells were then incubated either in medium supplemented with 200 µM CoCl2 (cat. no. 618519; Sigma-Aldrich; Merck KGaA) or in normal medium. After 24 h, cells were collected for subsequent experiments.
Transfection
miR-424-5p mimic (sense, 5'-CAGCAGCAA UUCAUGUUUUGAA-3' and antisense, 5'-CAAAACAUG AAUUGCUGCUGUU-3'). mimic negative control (NC; sense, 5'-UUCUCCGAACGUGUCACGUTT-3' and antisense, 5'-ACGUGACACGUUCGGAGAATT-3') were purchased from Shanghai GenePharma Co., Ltd. PC12 Cells were cultured (8x105 cells/well) in 12-well plates. After cells reached 70-80% confluence, they were transfected with 100 nM miR-424 mimics or miR-negative control (NC) mimics (Shanghai GenePharma Co., Ltd.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). For programmed cell death protein 4 (PDCD4) transfection, cells were treated with 1 µg pcDNA3.1-PDCD4 or pcDNA3.1 (Addgene, Inc.) for 48 h using Lipofectamine 2000 according to manufacturer's instructions. After transfection, cells were subjected to ischemic treatment for 12 h.
Cell Counting Kit-8 (CCK-8)
At 0, 12, 24 and 48 h post-transfection, cells were re-seeded in a 96-well plate (5x103 cells/well). Each well was supplemented with 10 µl CCK-8 solution (Dojindo Molecular Technologies, Inc.) and incubated at 37˚C for another 2 h according to the manufacturer's protocol. The absorbance value at 450 nm was determined (Bio-Rad Laboratories, Inc.).
Flow cytometry
Cells were harvested and washed with pre-cooled PBS. Then cells were resuspended in 200 µl binding buffer. Subsequently, cells were stained with FITC-Annexin V and propidium iodide (PI; BD Biosciences) in the dark for 20 min at room temperature. Subsequently, the data were evaluated with a BD FACSCalibur™ flow cytometer (Beckman Coulter, Inc.) using FlowJo software (version 10; FlowJo LLC). Sums of percentages of cells in early and late apoptosis were added as the total apoptosis ratio from each dot plot.
Reverse transcription-quantitative PCR (RT-qPCR)
Total RNA from cells was isolated with TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and the concentration of total RNA was determined with NanoDrop™ 1000 (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). A total of 1 µg RNA was reversely transcribed using a TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.), The reverse transcription were conducted under the following conditions: 42˚C for 60 min, 72˚C for 15 min. Amplification of cDNA was conducted using a RAPA3G SYBR Green qPCR Mix (cat. no. A2250A; HaiGene Biotech Co., Ltd.; https://www.haigene.cn/html/show-226.html). The PCR reactions were conducted under the following conditions: 95˚C for 10 min, followed by 35 cycles of 94˚C for 30 sec, 58˚C for 30 sec and 72˚C for 35 sec, with a final extension at 72˚C for 10 min. U6 and GAPDH were used to normalize miRNA and mRNA, respectively. The sequences of the primers used for qPCR were as follows: miR-424 forward, 5'-TTCAAAACATGAATTGCTGCTG-3' and reverse, 5'-CT CAACTGGTGTCGTGGA-3'; U6 forward, 5'-GCTTCGGC AGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACG AATTTGCGTGTCAT-3'; PDCD4 forward, 5'-TCCCTA ATTCTCCATGGTGCT-3' and reverse, 5'-CGCCTTTTT GCCTTGGCATT-3'; Bax forward, 5'-TGAAGGACGCAC GTTCAG-3' and reverse, 5'-CCTGCTCGATCCTGGATG AAA-3'; Bcl-2 forward, 5'-CTTTGAGTTCGGTGGGG TCA-3' and reverse, 5'-GGGCCGTACAGTTCCACAAA-3'; caspase-3 forward, 5'-GGAACCATCATACATGGAAGCG-3' and reverse, 5'-TTCCCTGAGGTTTGCTGCAT-3'; GAPDH forward, 5'-GGAGCGAGATCCCTCCAAAAT-3' and reverse, 5'-GGCTGTTGTCATACTTCTCATGG-3'. mRNA expression was determined using the 2-ΔΔCq method (30). Each experiment was performed in triplicate.
Western blotting
Total protein was extracted from PC12 cells using pre-cold RIPA buffer (Beyotime Institute of Biotechnology) including protease inhibitor. Total protein was quantified using a bicinchoninic acid kit (Sigma-Aldrich; Merck KGaA). Proteins (40 µg) were then separated via 10% SDS-PAGE, proteins were transferred onto PVDF membranes. The membranes were then blocked with 5% skimmed milk at room temperature for 1 h. The membranes were incubated overnight at 4˚C with anti-PDCD4 (1:1,000; cat. no. ab80590; Abcam), PI3K (1:1,000; cat. no. ab32089; Abcam), p-PI3K p85 (1:1,000; cat. no. ab278545; Abcam), AKT (1:1,000; cat. no. ab8805; Abcam), p-AKT (1:1,000; cat. no. ab81283; Abcam), Bax (1:1,000; cat. no. ab32503; Abcam), caspase-3 (1:1,000; cat. no. ab13847; Abcam) and GAPDH (1:1,000; cat. no. ab9485; Abcam) primary antibodies in the absence of light. Then cells were incubated with HRP-labeled anti-rabbit IgG secondary antibody (1:4,000; cat. no. ab6721; Abcam) or anti-mouse IgG secondary antibody (1:5,000, cat. no. ab6789, Abcam) for 2 h at room temperature. The bands were imaged with an Pierce™ ECL Western Blotting Substrate kit (cat. no. 32109; Thermo Fisher Scientific, Inc.) and band density was quantified using Quantity One v.6.2 software (Bio-Rad Laboratories, Inc.).
Dual-luciferase reporter assay
Bioinformatics analysis predicted using TargetScan 7.2 (http://www.targetscan.org/vert_71/) revealed that PDCD4 was a target of miR-424. For analysis of the predicted miRNA binding site, GCUGCUAA, located at the c*392-c*399 site of PDCD4 (NM_145341.4), a dual-luciferase reporter assay was performed to determine whether miR-424 directly targeted PDCD4. Complementary 50-60-bp DNA oligonucleotides consisting of the test sequence flanked by single-stranded overhangs encoding restriction enzyme sites SacI and HindIII in the multiple cloning sites of the pMIR-REPORT Luciferase plasmid (Ambion; Thermo Fisher Scientific, Inc.) were designed and synthesized. Synthetic oligonucleotides (Thermo Fisher Scientific, Inc.) annealing and ligation into the plasmid were performed according to the manufacturer's protocols. The DNA oligos used were as follows: Wild-type sense, 5'-CTATTTAGGGGGTAAAGTTAAGCTGCTAAAACCC CATGTTGGCTGCTGCTA-3' and antisense, 5'-AGCTTA GCAGCAGCCAACATGGGGTTTTAGCAGCTTAACTTT ACCCCCTAAATAGAGCT-3' and mutant sense, 5'-CTATTT AGGGGGTAAAGTTAACAGAAGAAAACCCCATGTTG GCT GCTGCTA-3' and antisense, 5'-AGCTTAGCAGC AGCCAACATGGGGTTTTCTTCTGTTAACTTTACCC CCTAAATAGAGCT-3'. PC12 cells were cultured (8x104 cells/cm2) into 12-well plates. After the cells reached 70-80% confluence, PC12 cells were co-transfected with 100 ng firefly luciferase constructs and 100 nM miR-424 mimic or miR-NC mimic using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Renilla luciferase was used as the internal control for normalization. The luciferase activity was calculated using a dual-luciferase reporter assay (Promega Corporation) at 48 h post-transfection.
Statistical analysis
All experiments were repeated ≥ three times. Statistical analyses were performed using SPSS software (version 17.0; SPSS, Inc.). Data are presented as the mean ± SD. Comparisons between two groups were performed using an unpaired Student's t-test. Comparisons of >2 groups were performed using one-way ANOVA followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
Results
Expression of miR-424 and PDCD4 in ischemia model
RT-qPCR was performed to examine the RNA expression of miR-424 and PDCD4. Compared with normal PC12 cells, the expression of miR-424 was significantly decreased following CoCl2 treatment, whereas the expression of PDCD4 was significantly upregulated (Fig. 1A and B).
Transfection of miR-424 mimics in PC12 cells
Cells were transfected with miR-NC mimics or miR-424 mimics. The expression of miR-424 was significantly increased after the treatment with miR-424 mimics compared with miR-NC mimics, while there were no significant differences between the non-transfected control group and the miR-NC mimics group (Fig. 2).
Transfection of PDCD4 in PC12 cells
Cells were transfected with pcDNA3.1-PDCD4 or pcDNA3.1. As presented in Fig. 3, the expression level of PDCD4 in cells transfected with pcDNA3.1-PDCD4 was significantly upregulated compared with cells transfected with pcDNA3.1. There was no significant difference in expression between the pcDNA3.1 group and the non-treated control group.
PDCD4 is a target of miR-424
PDCD4 was predicted as a target gene of miR-424 using TargetScan 7.2 (Fig. 4A). The results of the luciferase assay demonstrated that for the PDCD4-3'UTR-WT transfected cells, the luciferase activity was significantly decreased after transfection with miR-424 mimics compared with that in the miR-NC mimics group, whereas for the PDCD4-3'UTR-mutant transfected cells, transfection with miR-424 mimics exerted no significant effects on the luciferase activity (Fig. 4B).
Overexpression of miR-424 inhibits the apoptosis of ischemia-exposed cells
The apoptosis of ischemic PC12 cells was examined via flow cytometry. As presented in Fig. 5A and B, there was no significant difference between the control and NC group; however, the apoptosis rate significantly decreased after transfection with miR-424 mimics, which was reversed by co-transfection with pcDNA3.1-PDCD4.
Overexpression of miR-424 promotes the viability of ischemia-exposed cells
The viability of ischemic PC12 cells was determined using a CCK-8 assay. Overexpression of miR-424 significantly increased the viability of ischemic PC12 cells, which was reversed following co-transfection with pcDNA3.1-PDCD4 at 12, 24 and 48 h (Fig. 6)
miR-424 regulates the expression of PDCD4, Bcl-2, Bax, caspase-3, PI3K/AKT and phosphorylated (p)-PI3K/AKT
RT-qPCR and western blotting were conducted to evaluate mRNA and protein expression, respectively. As presented in Fig. 7A-D, the mRNA expression of PDCD4, Bax and caspase-3 was downregulated following miR-424 overexpression, whereas Bcl-2 expression was increased; these effects were significantly reversed by co-transfection with pcDNA3.1-PDCD4. There was no significant difference between the control and miR-NC mimics groups. Protein expression exhibited the same trends as mRNA expression. Furthermore, the levels of p-PI3K and p-AKT in cells transfected with miR-424 mimics were significantly increased, which was significantly reversed following co-transfection with pcDNA3.1-PDCD4. The protein levels of PI3K/AKT were not significantly affected by any transfections (Fig. 7E and F).
Discussion
Increasing evidence has indicated that aberrant expression of miRNAs in the human brain serves a crucial role in various brain diseases, including cerebral ischemic stroke (31,32). In the present study, the roles of miR-424 in cerebral ischemic stroke were investigated. The results indicated that miR-424 was downregulated in CoCl2-treated PC12 cells. Overexpression of miR-424 increased cell viability and inhibited apoptosis in the ischemia model, which suggested that miR-424 may be a neuroprotective miRNA in cerebral ischemic stroke. This was consistent with a previous study that demonstrated that miR-424 mediated neuronal damage (33). However, the potential underlying mechanisms remain to be elucidated.
Neuronal cell death is considered to be the primary cause of stroke pathophysiology (34). This process can be slowed down by miRNAs via the regulation of apoptosis in neuronal cells (35). For example, overexpression of miR-455 exerted a positive role in protecting neuronal cells from ischemic injury-induced death (36). Notably, downregulation of miR-155 serves a protective role in ischemic stroke (37). In the present study, overexpression of miR-424 inhibited the apoptosis of neuronal cells. Furthermore, increased miR-424 promoted the viability of CoCl2-treated PC12 cells, suggesting that miR-424 may serve a neuroprotective role in cerebral ischemic stroke.
miRNAs regulate gene expression via binding sites in the 3'UTR of target genes (38). PDCD4 was predicted to be a target gene of miR-424. In the present study, overexpression of miR-424 decreased the expression of PDCD4, which was reversed after co-transfection with pcDNA3.1-PDCD4. Moreover, luciferase activity was decreased after co-transfection with miR-424 mimics and PDCD4-3'UTR-WT compared with miR-NC mimics, suggesting that PDCD4 is a target of miR-424. PDCD4 is an apoptotic protein and serves an important role in short-term responses to ischemic stroke (39). Additionally, associations between PDCD4 and miRNAs have previously been reported in cerebral ischemia (40). In the present study, co-transfection with PDCD4 attenuated the decrease in apoptotic rate induced by overexpression of miR-424, and inhibited cell viability. However, the underlying mechanisms remain unclear. The possible effects of PDCD4 on the expression of various genes and proteins were examined. It was revealed that miR-424 overexpression increased the expression of Bcl-2 and the phosphorylation of PI3K and AKT, and decreased Bax and caspase-3 expression; these effects were reversed by co-transfection with pcDNA3.1-PDCD4. Taken together, the present results indicated that miR-424 may regulate neuronal apoptosis by targeting PDCD4.
In conclusion, miR-424 was downregulated in ischemia-injured cells. miR-424 may serve a neuroprotective role by inhibiting the apoptosis and promoting the viability of ischemia-injured cells, potentially by targeting PDCD4. This may be a novel therapeutic target for cerebral ischemic stroke.
Acknowledgements
Not applicable.
Funding
The present study was supported by The Scientific Research Fund of Taizhou People's Hospital (grant no. ZL202015).
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
HWR performed the majority of experiments and wrote the manuscript. BG, YZZ, TG, QW and YQS performed the remaining experiments and statistically analyzed the data. JW designed the present study. HWR and JW can authenticate the raw data in this study. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
Johnston SC, Mendis S and Mathers CD: Global variation in stroke burden and mortality: Estimates from monitoring, surveillance, and modelling. Lancet Neurol. 8:345–354. 2009.PubMed/NCBI View Article : Google Scholar | |
Zhao WJ, Zhang HF and Su JY: Downregulation of microRNA-195 promotes angiogenesis induced by cerebral infarction via targeting VEGFA. Mol Med Rep. 16:5434–5440. 2017.PubMed/NCBI View Article : Google Scholar | |
Lo EH, Dalkara T and Moskowitz MA: Mechanisms, challenges and opportunities in stroke. Nat Rev Neurosci. 4:399–415. 2003.PubMed/NCBI View Article : Google Scholar | |
Donnan GA, Fisher M, Macleod M and Davis SM: Stroke. Lancet. 371:1612–1623. 2008.PubMed/NCBI View Article : Google Scholar | |
Xu G, Ma M, Liu X and Hankey GJ: Is there a stroke belt in China and why? Stroke. 44:1775–1783. 2013.PubMed/NCBI View Article : Google Scholar | |
Kleindorfer D, de los Rios La Rosa F, Khatri P, Kissela B, Mackey J and Adeoye O: Temporal trends in acute stroke management. Stroke. 44 (Suppl 1):S129–S131. 2013.PubMed/NCBI View Article : Google Scholar | |
Vemuganti R: All's well that transcribes well: Non-coding RNAs and post-stroke brain damage. Neurochem Int. 63:438–449. 2013.PubMed/NCBI View Article : Google Scholar | |
Truelsen T and Bonita R: Epidemiological transition of stroke in China? Stroke. 39:1653–1654. 2008.PubMed/NCBI View Article : Google Scholar | |
Wang W, Jiang B, Sun H, Ru X, Sun D, Wang L, Wang L, Jiang Y, Li Y, Wang Y, et al: NESS-China Investigators: Prevalence, Incidence, and Mortality of Stroke in China: Results from a Nationwide Population-Based Survey of 480,687 Adults. Circulation. 135:759–771. 2017.PubMed/NCBI View Article : Google Scholar | |
Xing B, Chen H, Zhang M, Zhao D, Jiang R, Liu X and Zhang S: Ischemic postconditioning inhibits apoptosis after focal cerebral ischemia/reperfusion injury in the rat. Stroke. 39:2362–2369. 2008.PubMed/NCBI View Article : Google Scholar | |
Townsend PA, Scarabelli TM, Pasini E, Gitti G, Menegazzi M, Suzuki H, Knight RA, Latchman DS and Stephanou A: Epigallocatechin-3-gallate inhibits STAT-1 activation and protects cardiac myocytes from ischemia/reperfusion-induced apoptosis. FASEB J. 18:1621–1623. 2004.PubMed/NCBI View Article : Google Scholar | |
Li P, Shen M, Gao F, Wu J, Zhang J, Teng F and Zhang C: An Antagomir to MicroRNA-106b-5p Ameliorates Cerebral Ischemia and Reperfusion Injury in Rats Via Inhibiting Apoptosis and Oxidative Stress. Mol Neurobiol. 54:2901–2921. 2017.PubMed/NCBI View Article : Google Scholar | |
Pasquinelli AE: MicroRNAs and their targets: Recognition, regulation and an emerging reciprocal relationship. Nat Rev Genet. 13:271–282. 2012.PubMed/NCBI View Article : Google Scholar | |
Ghelani HS, Rachchh MA and Gokani RH: MicroRNAs as newer therapeutic targets: A big hope from a tiny player. J Pharmacol Pharmacother. 3:217–227. 2012.PubMed/NCBI View Article : Google Scholar | |
Croce CM and Calin GA: miRNAs, cancer, and stem cell division. Cell. 122:6–7. 2005.PubMed/NCBI View Article : Google Scholar | |
Zheng Y, Wang L, Chen M, Pei A, Xie L and Zhu S: Upregulation of miR-130b protects against cerebral ischemic injury by targeting water channel protein aquaporin 4 (AQP4). Am J Transl Res. 9:3452–3461. 2017.PubMed/NCBI | |
Zheng L, Cheng W, Wang X, Yang Z, Zhou X and Pan C: Overexpression of MicroRNA-145 Ameliorates Astrocyte Injury by Targeting Aquaporin 4 in Cerebral Ischemic Stroke. BioMed Res Int. 2017(9530951)2017.PubMed/NCBI View Article : Google Scholar | |
Yin KJ, Hamblin M and Chen YE: Non-coding RNAs in cerebral endothelial pathophysiology: Emerging roles in stroke. Neurochem Int. 77:9–16. 2014.PubMed/NCBI View Article : Google Scholar | |
Zhao L, Hua C, Li Y, Sun Q and Wu W: miR-525-5p inhibits ADAMTS13 and is correlated with Ischemia/reperfusion injury-induced neuronal cell death. Int J Clin Exp Med. 8:18115–18122. 2015.PubMed/NCBI | |
Wei N, Xiao L, Xue R, Zhang D, Zhou J, Ren H, Guo S and Xu J: MicroRNA-9 Mediates the Cell Apoptosis by Targeting Bcl2l11 in Ischemic Stroke. Mol Neurobiol. 53:6809–6817. 2016.PubMed/NCBI View Article : Google Scholar | |
Zhang YZ, Wang J and Xu F: Circulating miR-29b and miR-424 as Prognostic Markers in Patients with Acute Cerebral Infarction. Clin Lab. 63:1667–1674. 2017.PubMed/NCBI View Article : Google Scholar | |
Darbinian N: Cultured Cell Line Models of Neuronal Differentiation: NT2, PC12, and SK-N-MC. Methods Mol Biol. 2311:25–38. 2021.PubMed/NCBI View Article : Google Scholar | |
Katarzyna B and Benita W: PC12 and THP-1 Cell Lines as Neuronal and Microglia Model in Neurobiological Research. Appl Sci (Basel). 11(3729)2021. | |
Kudo TA, Tominami K, Izumi S, Hayashi Y, Noguchi T, Matsuzawa A, Hong G and Nakai J: Characterization of PC12 Cell Subclones with Different Sensitivities to Programmed Thermal Stimulation. Int J Mol Sci. 21(8356)2020.PubMed/NCBI View Article : Google Scholar | |
Wiatrak B and Balon K: Protective Activity of Aβ on Cell Cultures (PC12 and THP-1 after Differentiation) Preincubated with Lipopolysaccharide (LPS). Mol Neurobiol. 58:1453–1464. 2021.PubMed/NCBI View Article : Google Scholar | |
Amalia L, Sadeli HA, Parwati I, Rizal A and Panigoro R: Hypoxia-inducible factor-1α in acute ischemic stroke: Neuroprotection for better clinical outcome. Heliyon. 6(e04286)2020.PubMed/NCBI View Article : Google Scholar | |
Tripathi VK, Subramaniyan SA and Hwang I: Molecular and Cellular Response of Co-cultured Cells toward Cobalt Chloride (CoCl2)-Induced Hypoxia. ACS Omega. 4:20882–20893. 2019.PubMed/NCBI View Article : Google Scholar | |
Kim HB, Yoo JY, Yoo SY, Lee JH, Chang W, Kim HS, Baik TK and Woo RS: Neuregulin-1 inhibits CoCl2-induced upregulation of excitatory amino acid carrier 1 expression and oxidative stress in SH-SY5Y cells and the hippocampus of mice. Mol Brain. 13(153)2020.PubMed/NCBI View Article : Google Scholar | |
Matsuhashi S, Manirujjaman M, Hamajima H and Ozaki I: Control mechanisms of the tumor suppressor PDCD4: Expression and functions. Int J Mol Sci. 20(2304)2019.PubMed/NCBI View Article : Google Scholar | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar | |
Saugstad JA: MicroRNAs as effectors of brain function. Stroke. 44 (Suppl 1):S17–S19. 2013.PubMed/NCBI View Article : Google Scholar | |
Yan H, Fang M and Liu XY: Role of microRNAs in stroke and poststroke depression. ScientificWorldJournal. 2013(459692)2013.PubMed/NCBI View Article : Google Scholar | |
Gui SH, Wang YM, Fan CY, Han LK, Wang TG, Di MQ and Gu JQ: miR-424 Inhibits neuronal apoptosis in rats with cerebral infarction through regulating TGF-β1/Smad3 signaling pathway. J Biol Regul Homeost Agents. 34:1285–1296. 2020.PubMed/NCBI View Article : Google Scholar | |
Sun H, Zhong D, Wang C, Sun Y, Zhao J and Li G: MiR-298 Exacerbates Ischemia/Reperfusion Injury Following Ischemic Stroke by Targeting Act1. Cell Physiol Biochem. 48:528–539. 2018.PubMed/NCBI View Article : Google Scholar | |
Baczyńska D, Michałowska D and Witkiewicz W: The role of microRNA in ischemic diseases - impact on the regulation of inflammatory, apoptosis and angiogenesis processes. Przegl Lek. 70:135–142. 2013.PubMed/NCBI(In Polish). | |
Yao S, Tang B, Li G, Fan R and Cao F: miR-455 inhibits neuronal cell death by targeting TRAF3 in cerebral ischemic stroke. Neuropsychiatr Dis Treat. 12:3083–3092. 2016.PubMed/NCBI View Article : Google Scholar | |
Xing G, Luo Z, Zhong C, Pan X and Xu X: Influence of miR-155 on Cell Apoptosis in Rats with Ischemic Stroke: Role of the Ras Homolog Enriched in Brain (Rheb)/mTOR Pathway. Med Sci Monit. 22:5141–5153. 2016.PubMed/NCBI View Article : Google Scholar | |
Schwarzenbach H, Nishida N, Calin GA and Pantel K: Clinical relevance of circulating cell-free microRNAs in cancer. Nat Rev Clin Oncol. 11:145–156. 2014.PubMed/NCBI View Article : Google Scholar | |
Guo YB, Ji TF, Zhou HW and Yu JL: Effects of microRNA-21 on Nerve Cell Regeneration and Neural Function Recovery in Diabetes Mellitus Combined with Cerebral Infarction Rats by Targeting PDCD4. Mol Neurobiol. 55:2494–2505. 2018.PubMed/NCBI View Article : Google Scholar | |
Yan H, Rao J, Yuan J, Gao L, Huang W, Zhao L and Ren J: Long non-coding RNA MEG3 functions as a competing endogenous RNA to regulate ischemic neuronal death by targeting miR-21/PDCD4 signaling pathway. Cell Death Dis. 8(3211)2017.PubMed/NCBI View Article : Google Scholar |