Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
November-2017 Volume 40 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 40 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling

  • Authors:
    • Zhi-Guo Zhang
    • Yan-Jing Chen
    • Li-Hua Xiang
    • Jing-Hua Pan
    • Zhen Wang
    • Gary Guishan Xiao
    • Da-Hong Ju
  • View Affiliations / Copyright

    Affiliations: Institute of Basic Theory, China Academy of Chinese Medical Sciences, Beijing 100700, P.R. China, School of Pharmaceutical Science, Dalian University of Technology, Dalian, Liaoning 116024, P.R. China
  • Pages: 1602-1610
    |
    Published online on: September 8, 2017
       https://doi.org/10.3892/ijmm.2017.3130
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to assess the effectiveness of Rhizoma Dioscoreae extract (RDE) on preventing rat alveolar bone loss induced by ovariectomy (OVX), and to determine the role of interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) signaling pathway in this effect. Female Wistar rats were subjected to OVX or sham surgery. The rats that had undergone OVX were treated with RDE (RDE group), vehicle (OVX group) or 17β-estradiol subcutaneous injection (E2 group). Subsequently, bone metabolic activity was assessed by analyzing 3-D alveolar bone construction, bone mineral density, as well as the plasma biomarkers of bone turnover. The gene expression of alveolar bone in the OVX and RDE groups was evaluated by IL-6/STAT3 signaling pathway polymerase chain reaction (PCR) arrays, and differentially expressed genes were determined through reverse transcription-quantitative PCR. The inhibitory effect of RDE on alveolar bone loss in the OVX group was demonstrated in the study. In comparison with the OVX group, the RDE group exhibited 19 downregulated genes and 1 upregulated gene associated with the IL-6/STAT3 signaling pathway in alveolar bone. Thus, RDE was shown to relieve OVX-induced alveolar bone loss in rats, an effect which was likely associated with decreased abnormal bone remodeling via regulation of the IL-6/STAT3 signaling pathway.

Introduction

Osteoporosis is a common postmenopausal disease that markedly affects the quality of life of the patients (1). There is a known association between alveolar bone loss and osteoporosis in women following pausimenia (2). Furthermore, alveolar bone provides essential tooth support through desmodontal fiber anchoring. It was previously reported that alveolar bone mass maybe reduced and alveolar bone structure may be altered in patients suffering from osteoporosis (3). During the early postmenopausal period, alveolar bone loss occurs rapidly, but this process is leveled out in the ~6th postmenopausal year, which likely results from postmenopausal estrogen reduction (4). Alveolar bone loss causes tooth loss or mobile teeth, severely compromising postmenopausal quality of life (5).

Estrogen (6), parathyroid hormone (PTH) (7) and bisphosphonates (8) are currently used for preventing postmenopausal alveolar bone loss. However, it was indicated that long-term use of these agents may be associated with side effects, including higher risk of endometrial and ovarian cancer (9,10), nervous system disorders (11), osteonecrosis of the jaws (12) and venous thromboembolism (13). A substitutive method or drug with verified safety and efficiency is urgently required for treating alveolar bone loss. In recent decades, certain herbal medicines or botanical drugs have been widely recognized as effective remedies for relieving or treating alveolar bone loss (14–16).

Rhizoma Dioscoreae (RD), a Chinese medicinal herb/medicinal food, has long been used to promote bone and tooth strength in China (17). Our previous study demonstrated that RD extract (RDE) exerts a protective effect on maintaining alveolar bone among rats subjected to ovariectomy (OVX) through the regulation of p38 mitogen-activated protein kinase (MAPK) and Wnt signaling pathway (18). However, it has not been fully elucidated whether this effect is associated with other signaling pathways.

Previous studies have demonstrated that the interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) signaling pathway in osteoclasts and osteoblasts plays a central role in osseous metabolism and remodeling (19,20). Moreover, using bioinformatics methods in our previous study, we predicted that RDE protection against alveolar bone loss may be associated with the IL-6/STAT3 signaling pathway (21). The aim of the present study was to analyze the inhibitory effect of RDE on alveolar bone loss among OVX rats, and investigate the association between this effect and the IL-6/STAT3 signaling pathway.

Materials and methods

Preparation of RDE

RDE was prepared as previously reported (22), and that same batch of extract was used in the present study.

Grouping and treating animals

A total of 48 Wistar female virgin rats (aged 6 months and weighing ~310±20.0 g) were acquired from the Experimental Animal Center in the Academy of Military Medical Sciences [SCXK-(Military) 2014-005, Beijing, China]. The protocol involving animals in the present study was authorized by the Institutional Ethics Committee of China Academy of Chinese Medical Sciences (approval no. 2015-009). Sham surgery (n=12) or bilateral OVX (n=36) using a dorsal incision was conducted on the rats following acclimatization. The rats undergoing OVX were divided in three groups based on the treating agent, namely control (OVX), RDE and 17β-estradiol (E2) groups. Each group contained 12 rats. Subsequently, 17β-estradiol (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in ethanol and diluted with olive oil. The preparation was used for daily subcutaneous injection in the E2 rats at a dosage of 30 μg/kg body weight. RDE was dissolved with distilled water and force-fed to RDE rats at a dosage of 1.3 g/kg body weight/day, which was calculated using the human recommended dosage (30 g/day) proposed by Chinese Pharmacopeia and the weight ratio of rat and human. OVX and sham rats were force-fed equal quantities of distilled water, and standardized rat food was provided to all subjects throughout the study (Animal Center of the Fourth Military Medical University, Xi'an, China). The rats were treated with agents or distilled water for 7 days postoperatively and the treatment was maintained until the 13th week, with body weight monitoring of each subject once weekly.

Preparation of specimens

On the day after the final treatment, xylazine (12 mg/kg) and ketamine (80 mg/kg) were intraperitoneally injected to anesthetize the animals, which were subsequently sacrificed by exsanguination. The uteri were excised and immediately weighed (23). The abdominal aorta was punctured prior to death to collect blood specimens into heparinized tubes. Subsequently, the blood specimens were separated by centrifugation at 3,000 × g at a temperature of 4°C for 10 min, and then aliquoted and preserved at −80°C until use. The left mandibles were excised and preserved at −80°C for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and microarrays. The right mandibles were excised, immersed into normal saline solution and preserved at −20°C, with the aim of measuring bone mineral density (BMD) and studying the microscopic structure using microscopic computed tomography (micro-CT).

Biomarkers of bone turnover

Enzyme-linked immunosorbent assays (ELISA; Sunbio, Inc., Beijing, China) were conducted to assess plasma concentrations of bone formation and bone absorption biomarkers, such as alkaline phosphatase (ALP) and tartrate-resistant acid phosphatase (TRAP), in control, standardized and duplicated experiments. An ELISA reader (Bio-Tek, Colmar, France) was used to read 450 nm absorption values.

Micro-CT analyses

Untreated right mandibles were scanned with high-resolution micro-CT (SkyScan 1172 micro-CT system; SkyScan, Antwerp, Belgium) which applied cone beam reconstruction for the determination of the cone geometric construction of the X-ray source. The desktop SkyScan micro-CT system was operated as previously described (24). The desirable resolution value of 6.8 μm was obtained by placing a specimen on the rotating stage and translating it along the persistently varying magnifying stage. The rotation angle of a specimen was 185°, and an image was generated with the specimen rotating for 0.9°. The repeatability of this protocol was verified by performing repetitive scanning from the start of this experiment. The resulting gray level images were denoised with a low-pass filter, and a constant threshold value was used to determine the trabeculae.

Following image capture (100 keV, 100 μA), a quadrate region of interest (ROI) (1×1 mm) was constructed using CT analyser, which was affiliated to SkyScan on the sagittal planes of the first molar teeth. None of the selected ROIs overlapped with any tooth roots. As a 3-D rebuilding software affiliated to SkyScan, NRecon was applied for establishing a volume of interest (VOI) with a cubical mass (1×1×1 mm) underneath the bottom of the first molar crown, with a vertical distance of 1.5 mm, and the trabeculae in VOI were measured morphologically by the standardized SkyScan software package. Subsequently, degree of anisotropy (DA), structure model index (SMI), trabecular number (Tb.N), trabecular separation (Tb.Sp), trabecular thickness (Tb.Th), bone volume fraction (BV/TV) and BMD were assessed for a certain VOI using 3-D analysis (25).

RT-qPCR array assay

Alveolar bone from 6 OVX and 6 RDE rats was used for RT-qPCR. The differential expression profiles of IL-6/STAT3 signaling pathway-related genes were analyzed by the rat IL-6/STAT3 signaling pathway PCR array (PARN-160Z; Qiagen, Valencia, CA, USA) obtained from Kangchen Biotech (Shanghai, China). A total of 84 essential genes that may be involved in the activation of the IL-6/STAT3 signaling pathway and downstream reactions were profiled by this PCR array. RNA was extracted and utilized to synthesize First-Strand cDNA by RT2 First Strand kit (Qiagen, Manchester, UK) on the basis of standardized protocol and the cDNA template was mixed with RT2 SYBR-Green qPCR Master mix (Qiagen, Germantown, MD, USA), which was ready to be used in the specific kit. Subsequently, mixed reagent and template was injected into wells on PCR array plates, which contained cytokines and IL-6/STAT3 signaling-associated genes, at a dosage of 25 μl for 96-well plates, to perform RT-qPCR. An instrument-specific software was utilized to calculate quantification cycles (Cq) of all genes throughout each PCR experiment and the 2−ΔΔCq approach was applied for calculating fold-change in the gene-expressing profiles for comparing between any two means.

Confirmation by RT-qPCR

Alveolar bone from another 6 OVX and 6 RDE subject rats was used for RT-qPCR. The RNeasy mini kit (Qiagen, Valencia, CA, USA) was utilized to purify total extracted RNA and SuperScript First Strand Synthesis system (Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA) was used to reversely transcribe 4 μg RNA into cDNA. In an ABI-7500 Sequence Detection system (Applied Biosystems, Foster City, CA, USA), cDNA synthesized in the process of RT-qPCR was detected by SYBR-Green based on the manufacturer's instructions. The primers of the RT-qPCR analyses are listed in Table I. The RT-qPCR conditions in the present study were as follows: 10 sec of initiation at 95°C, 5 sec of thermal denaturation at 95°C, and 34 sec of annealing at 60°C for 40 cycles. The expressing quantities of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used to normalize PCR results and 2-ΔΔCq was applied for data analysis. The purity of the amplified products was assessed by melting curves of each RT-qPCR assay containing negative control without templates.

Table I

Primers used for RT-qPCR analysis.

Table I

Primers used for RT-qPCR analysis.

TranscriptSequence (5′-3′)
GapdhF: GGAAAGCTGTGGCGTGAT
R: AAGGTGGAAGAATGGGAGTT
Akt1F: CACGACCGCCTCTGCTTT
R: CACAGCCCGAAGTCCGTTA
Ccl4F: TGCTGCTTCTCTTACACCTCC
R: TCATTCACATACTCATTGACCCA
Cxcl3F: CAGTGCCTGAAGACCCTACCA
R: GATCGACTCGGACGTTATTTGA
Stat3F: TTAACATTCTGGGCACGAACA
R: TCAGTGACAATCAAGGAGGCA
Tnfsf11F: TACCTGGATAACCCTTGATGACC
R: TCTCCAGAAATCCCTACAACGG
Cd4F: TCAGCCCGACAGCAACACTT
R: AGCACGACAGCCAGGAACAT
Csf3rF: GGTTCCATTCAAGACCCCAG
R: TGTTTCCCTCAGGACCAGTAGA
HgfF: TATTGCCCTATTTCCCGTTGT
R: CCATCCACCCTACTGTTGTTTG
Il12aF: CAGCACTTCAGAGCCACAATC
R: GCCGCTGTGATTCAGAGACC
Il13F: AGTCCTGGCTCTCGCTTGC
R: TGTGTGATGTTGCTCAGCTCCT
Il1r1F: AAGTGGAATGGGTCGGAAAT
R: AAGCAGATGAACGGATAGCG
Il2F: CACTTGGAAGACGCTGGAAAT
R: CACAGTTGCTGGCTCATCATC
Il6stF: CGTGGCAGAAGTCCTCCTACA
R: GGATCGCTTGAGCCTACATAAC
Jak2F: AGAAGGGTGCCCAGACGA
R: GGTTGACATTGTTGTTCCAGC
LifrF: CCGCCCTCTTATCCATCTTT
R: ACCAGTCCCGTTATCCTTCC
Mapk14F: CTGTATTGTCAGGATTCTCGGA
R: GCAGTGATGGGCTCTGGTTAG
Mapk1F: CAGGAAAGCATTACCTTGACCAG
R: CAGAGCCTGTTCAACTTCAATCC
MetF: GAAAATACCTCAACAGCGGCA
R: AAAGATTTGGTCGGGTGGATT
MtorF: CCAACTACCTTCGGAACCTC
R: CTTCACTTCAAACTCCACATACTC
Nfkb1F: ACTCAAGAACAGCAAGGCAGC
R: GGTGTCGTCCCATCGTAGGT
OsmF: CAATGTTTACTGCATGGCTCG
R: GGTCTGATTCTGTGGTCTCCCT
OsmrF: ACTGTCCCAACCTTTAGTCATCA
R: GCGTCATCTACCATAGCCCTTA
Pias3F: CTCCTTCCCAATACTCAGCG
R: CAACCTTTATTGTAGGCGAGAA
SrcF: TGCTTCATACTGGGTGACGAG
R: TGGGTAGAGTGGGTTGAGGTT

[i] RT-qPCR, reverse transcription-quantitative polymerase chain reaction; F, forward; R, reverse.

Statistical analysis

Data are presented as mean ± standardized difference and were statistically analyzed by SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). Analysis of variance and the least significant difference (LSD) test were used to determine inter-group differences in the parameters under evaluation. The normality of all data was proven by Kolmogorov-Smirnov tests, and a P-value of <0.05 was set as the threshold of statistical significance.

Results

Effect of RDE on body and uterine weight

The weight of sham rats was significantly lower compared with that of OVX rats (Fig. 1). Administration of E2 or RDE markedly inhibited weight gain induced by OVX during the 12-week treatment.

Figure 1

Effect of RDE on body weight after 12-week treatment; **P<0.01 vs. sham group; ##P<0.01 vs. OVX group. RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; E2, 17β-estradiol.

Compared with the sham group, OVX was associated with marked atrophy of the uterus, which indicated a successful surgery

E2 injection markedly reduced the atrophy of uterine tissue compared with OVX rats, whereas administration of RDE exerted a mild uterotrophic effect (Fig. 2).

Figure 2

Effect of RDE on uterine weight after a 12-week treatment; **P<0.01 vs. sham group; #P<0.05 vs. OVX group; ##P<0.01 vs. OVX group. RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; E2, 17β-estradiol.

Effect of RDE on bone turnover biomarkers

The plasma concentrations of ALP and TRAP in different subject rats after a 12-week treatment are shown in Figs. 3 and 4. After 12 weeks, the ALP and TRAP levels in OVX rats were significantly higher compared with those in sham rats (P<0.01). Moreover, the plasma ALP and TRAP levels in RDE and E2 rats were significantly lower compared with those in OVX rats (P<0.01).

Figure 3

Effect of RDE on ALP in plasma after 12-week treatment; **P<0.01 vs. sham group; #P<0.05 vs. OVX group. RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; E2, 17β-estradiol; ALP, alkaline phosphatase.

Figure 4

Effect of RDE on TRAP in plasma after 12-week treatment; **P<0.01 vs. sham group; ##P<0.05 vs. OVX group. RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; E2, 17β-estradiol; TRAP, tartrate-resistant acid phosphatase.

Effect of RDE on BMD and trabecular bone microarchitecture

It was revealed by analyzing morphological measurements that Tb.N, trabecular BV/TV and BMD were significantly decreased (P<0.01), while DA, SMI and Tb.Sp were significantly increased (P<0.01) in OVX rats compared with sham rats. Treatment with RDE or E2 relieved OVX-induced bone loss and limited the OVX-induced damage to alveolar bone trabeculae (Fig. 5 and Table II).

Figure 5

Representation of 3-D architecture of alveolar bone beneath the lowest point of the first molar crown in the (A) sham, (B) OVX, (C) E2 and (D) RDE groups. RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; E2, 17β-estradiol.

Table II

Effect of RDE on BMD and trabecular bone microarchitecture.

Table II

Effect of RDE on BMD and trabecular bone microarchitecture.

SHAMOVXE2RDE
BMD (g/cm3)0.861±0.1050.344±0.017a0.601±0.004c0.499±0.089b
BV/TV (%)27.708±4.3717.839±1.364a 17.631±1.765c 13.886±2.888b
Tb.Th (μm)24.989±0.16524.473±0.17324.568±0.51824.491±0.595
Tb.Sp (μm)48.646±12.107 93.224±7.745a 60.646±12.360c 66.763±12.060b
Tb.N (1/mm)0.011±0.0020.003±0.000a0.007±0.001c0.006±0.001b
SMI1.206±0.1182.090±0.122a1.523±0.115c1.680±0.147c
DA1.330±0.1501.834±0.095a1.455±0.267b1.584±0.111

{ label (or @symbol) needed for fn[@id='tfn2-ijmm-40-05-1602'] } Values are presented as means ± standardized difference (n=12 in each group).

a P<0.01 vs. SHAM group;

b P<0.05 vs. OVX group;

c P<0.01 vs. OVX group. RDE, Rhizoma Dioscoreae extract; BMD, bone mineral density; OVX, ovariectomy; E2, 17β-estradiol; BV/TV, bone volume fraction; Tb.Th, trabecular thickness; Tb.Sp, trabecular separation; Tb.N, trabecular number; SMI, structure model index; DA, degree of anisotropy.

Effect of RDE on gene expression profile

It was revealed by IL-6/STAT3 signaling pathway PCR arrays that the expression of 24 genes from alveolar bone exhibited differences of >3-fold between OVX and RDE rats (Table III). Specifically, 2 genes were upregulated, while 22 were downregulated.

Table III

Differential expression of genes (≥2-fold) in alveolar bone from 6 RDE and 6 OVX rats.

Table III

Differential expression of genes (≥2-fold) in alveolar bone from 6 RDE and 6 OVX rats.

SymbolP-valueFold-change
Akt10.000264−3.09
Ccl40.001408−3.26
Cd40.000581−2.34
Csf3r0.001814−4.45
Cxcl30.023671−11.72
Hgf0.004032−3.30
Il12a0.027687−2.87
Il130.0191362.06
Il1r10.000045−3.85
Il20.0274865.58
Il6st0.005906−2.88
Jak20.000009−2.31
Lifr0.009917−3.25
Mapk140.000994−2.81
Mapk10.040108−1.64
Met0.000938−5.16
Mtor0.010758−2.03
Nfkb10.000017−3.05
Osm0.040752−4.52
Osmr0.016804−2.01
Pias30.007814−2.75
Src0.030115−2.34
Stat30.004448−2.57
Tnfsf110.007872−6.58

[i] RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy.

Confirmation of differential levels of gene expression by RT-qPCR

With the aim of confirming the differential gene expression determined using IL-6/STAT3 signaling pathway PCR arrays, all 24 genes listed in Table III were verified using RT-qPCR and the results are presented in Fig. 6. Alveolar bone from 6 OVX and 6 RDE rats was used for the RT-qPCR assay. In the majority of the cases, the variations of genes in microarray analyses conformed to the RT-qPCR results, apart from 4 genes (Cxcl3, Hgf, Il2 and Il12a). The role of the IL-6/STAT3 signaling pathway in the inhibitory effect of RDE on osteoporosis is schematically represented in Fig. 7.

Figure 6

Validation of 24 differential expression genes identified by microarray and IPA in a replicated experiment by RT-qPCR. (A-E) Effect of RDE on the expressions of Akt1, Ccl4, Cd4, Csf3r, Cxcl3, Hgf, Il12a, Il13, Il1r1, Il2, Il6st, Jak2, Lifr, Mapk14, Mapk1, Met, Mtor, Nfkb1, Osm, Osmr, Pias3, Src, Stat3 and Tnfsf11. #P<0.05 and ##P<0.01 compared with the OVX group. Alveolar bone prepared from 6 RDE and 6 OVX rats was used. IPA, Ingenuity Pathway Analysis; RDE, Rhizoma Dioscoreae extract; OVX, ovariectomy; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Figure 7

Schematic diagram illustrating the role of IL-6/STAT3 signaling pathway in an anti-osteopenic effect of RDE. The downregulated genes appear in gray. The genes that are not specified but are incorporated into the network through association appear in white. RDE, Rhizoma Dioscoreae extract; IL-6, interleukin-6; STAT3, signal transducer and activator of transcription 3.

Discussion

In our previous study, using bioinformatics and PCR or western blotting to confirm the expression of Stat3, it was demonstrated that RDE inhibited osteoporosis in OVX rats, an effect which was associated with the IL-6/oncostatin M (OSM)/STAT3 pathway via miRNA regulation (21). The putative miRNAs targets' gene prediction and pathway analysis are both bioinformatics methods, and the results occasionally do not fully reflect the true effects of RDE; however, the results raise the question whether RDE exerts an anti-osteopenic effect via another IL-6 family cytokine pathway. The IL-6 cytokine family includes 10 members: IL-6, IL-31, IL-27, IL-11, neuropoietin, cardiotrophin-like cytokine, cardiotrophin-1 (CT-1), ciliary neurotrophic factor (CNTF), OSM and leukemia inhibitory factor (LIF). All IL-6 family cytokines employ the transducing receptor β-subunit gp130 as part of a multimeric receptor complex (26). The present study aimed to determine the association between the IL-6 family of cytokines pathway and the anti-osteopenic effect of RDE.

Our results demonstrated that treatment with RDE for 12 weeks prevented loss of uterine wet weight and body weight gain resulting from lack of estrogen in rats of the OVX group (Figs. 1 and 2). It was deduced that RDE exerts a mild estrogen-like effect, which may slow down OVX-induced uterine atrophy and weight gain.

Following ovary removal, OVX rats exhibited markedly reduced BMD, resulting from increasing alveolar bone metabolism, compared with the sham rats. By contrast, treatment with RDE or E2 increased the BMD of alveolar bone.

The significant and coincident increases in plasma ALP and TRAP verified mature female OVX rat as an appropriate and reliable animal model for studies on early postmenopausal osteoporosis characterized by high-turnover bone loss. Treating rats with RDE or E2 for 12 weeks inhibited the excessive bone metabolism, as shown by significantly decreased ALP and TRAP levels (Figs. 3 and 4).

From analyses of 3-D bone microarchitecture by micro-CT, it was indicated that the loss of alveolar bone among rats treated with E2 or RDE was less severe compared with that in OVX rats, which was inferred through significant variations in SMI, Tb.Sp, Tb.N and BV/TV. The inhibition of alveolar bone loss with E2 was superior to that of RDE (Table II and Fig. 5).

The results of bone metabolic biomarkers, micro-CT and BMD demonstrated that RDE significantly inhibited alveolar bone loss.

To investigate the association between the IL-6/STAT3 signaling pathway and the anti-osteopenic effect of RDE, the differential expression of genes by was screened using IL-6/STAT3 signaling pathway array. A total of 20 genes (19 downregulated and 1 upregulated) from alveolar bone were successfully identified and validated; their expression profiles differed significantly among RDE rats compared with the OVX group. The IL-6/STAT3 signaling pathway was downregulated following RDE treatment (Fig. 7).

In the IL-6 family cytokine signaling cascade, oligomerization of receptor subunits induced by a specific ligand may activate janus protein-tyrosine kinases (JAKs), which further activate the MAPKs or the STATs (mainly STAT1 and STAT3). Another signaling cascade activated by cytokines of the IL-6 family is the phosphoinositide-3-kinase/AKT (27,28). Receptor complexes that are capable of signaling after being activated by cytokines of the IL-6 family may provide specificity in a given signal transduction pathway. For example, OSM is considered to be a unique gp130-binding cytokine, as it binds first to gp130, and then develops a signaling complex with either the OSM receptor (OSMR) or the LIF receptor (LIFR), which are both capable of intracellular signaling (29,30).

Cytokines of the IL-6 family exert a major effect on osseous remodeling through osteoclasts or osteoblasts, despite seemingly functioning as a double-edged sword. These cytokines maintain bone generation while driving bone absorption induced by a variety of osteolytic factors. This dual effect is apparent in two main signaling pathways (STAT and MAPK signaling) bidirectionally affecting osteocytes (19).

Certain members of the IL-6 family (OSM, CNTF, LIF, IL-11 and IL-6) may promote bone formation. This effect was mainly reflected in three aspects: First, these cytokines promote the differentiation of osteoblast precursors or maturing osteoblasts isolated from the bone marrow or calvaria. During this process, STAT3 must be activated (31,32). Thus, the expression of osteoblastic biomarkers, such as bone sialoprotein, osteocalcin or ALP, was increased, while extracellular matrix mineralization and bone nodule formation were enhanced. Second, the biomarkers inhibit certain osteoblasts from proliferating via activating gp130/STAT3 and increasing the expression of p21WAF1, which is a cell cycle inhibitor and is also required for cytokines of the IL-6 family to induce ALP (33). Finally, these cytokines may protect osteoblasts from apoptosis caused by tumor necrosis factor-α (TNF-α) or serum depletion (34).

As regards bone absorption, cytokines of the IL-6 family promote osteoclast differentiation and bone absorption by accelerating the interactions between osteoclasts and osteoblasts. In co-cultures of osteoclast precursors and stromal cells or osteoblasts, certain IL-6-type cytokines (OSM, CNTF, LIF, IL-11 and IL-6) are able to promote osteoclast differentiation and bone absorption. In fact, these cytokines induce production of various osteoblastic downstream effectors that, in turn, promote osteoclast differentiation or activity, such as IL-1, receptor activator of nuclear factor-κB (NF-κB) ligand (RANKL), prostaglandin E2 and PTH-related protein. Recent studies implicated activation of IL-6-type cytokines/STAT3 signaling as the pivotal event in the induction of RANKL in osteoblasts, which leads to pro-resorption action of osteoclasts (35,36).

It was observed that the gene expression of certain signaling molecules (Osm, Osmr, Lifr, Il6st, Jak2, Stat3, Mtor, Nfkb1 and Mapk1) in the IL-6/STAT3 pathway were downregulated following RDE treatment (Fig. 7), which subsequently inhibited IL-6/STAT3 signaling. The RT-qPCR analysis of Osm, Osmr, Lifr, Il6st, Jak2, Stat3, Mtor, Nfkb1 and Mapk1 expression (Fig. 6) proved that RDE effectively reduced excessive alveolar bone formation and bone absorption synchronously caused by attenuated canonical IL-6/STAT3 signaling following OVX.

Further studies are required for RDE to be developed into a novel promising drug for the prevention or treatment of alveolar bone loss in postmenopausal women.

In conclusion, RDE was effective in inhibiting rat alveolar bone loss caused by OVX, by simultaneously inhibiting bone formation as well as bone resorption through regulation of the IL-6/STAT3 signaling pathway. The present study verified that RDE may be used as an oral agent for the treatment of alveolar osteopenia in postmenopausal women.

Acknowledgments

The present study was supported by the National Natural Science Foundation of China (grant no. 81473450) and the Fundamental Research Funds for the Beijing Administration of Traditional Chinese Medicine (grant no. JJ2015-54).

References

1 

Gallagher JC and Levine JP: Preventing osteoporosis in symptomatic postmenopausal women. Menopause. 18:109–118. 2011. View Article : Google Scholar

2 

Sultan N and Rao J: Association between periodontal disease and bone mineral density in postmenopausal women: A cross sectional study. Med Oral Patol Oral Cir Bucal. 16:e440–e447. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Lee BD and White SC: Age and trabecular features of alveolar bone associated with osteoporosis. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 100:92–98. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Streckfus CF, Johnson RB, Nick T, Tsao A and Tucci M: Comparison of alveolar bone loss, alveolar bone density and second metacarpal bone density, salivary and gingival crevicular fluid interleukin-6 concentrations in healthy premenopausal and postmenopausal women on estrogen therapy. J Gerontol A Biol Sci Med Sci. 52:M343–M351. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Tezal M, Wactawski-Wende J, Grossi SG, Dmochowski J and Genco RJ: Periodontal disease and the incidence of tooth loss in postmenopausal women. J Periodontol. 76:1123–1128. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Civitelli R, Pilgram TK, Dotson M, Muckerman J, Lewandowski N, Armamento-Villareal R, Yokoyama-Crothers N, Kardaris EE, Hauser J, Cohen S, et al: Alveolar and postcranial bone density in postmenopausal women receiving hormone/estrogen replacement therapy: A randomized, double-blind, placebo-controlled trial. Arch Intern Med. 162:1409–1415. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Liu J, Cao Z and Li C: Intermittent PTH administration: A novel therapy method for periodontitis-associated alveolar bone loss. Med Hypotheses. 72:294–296. 2009. View Article : Google Scholar

8 

Palomo L, Bissada NF and Liu J: Periodontal assessment of postmenopausal women receiving risedronate. Menopause. 12:685–690. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Strom BL, Schinnar R, Weber AL, Bunin G, Berlin JA, Baumgarten M, DeMichele A, Rubin SC, Berlin M, Troxel AB, et al: Case-control study of postmenopausal hormone replacement therapy and endometrial cancer. Am J Epidemiol. 164:775–786. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Rossing MA, Cushing-Haugen KL, Wicklund KG, Doherty JA and Weiss NS: Menopausal hormone therapy and risk of epithelial ovarian cancer. Cancer Epidemiol Biomarkers Prev. 16:2548–2556. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Rizzoli R, Reginster JY, Boonen S, Bréart G, Diez-Perez A, Felsenberg D, Kaufman JM, Kanis JA and Cooper C: Adverse reactions and drug-drug interactions in the management of women with postmenopausal osteoporosis. Calcif Tissue Int. 89:91–104. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Woo SB, Hellstein JW and Kalmar JR: Narrative [corrected] review: Bisphosphonates and osteonecrosis of the jaws. Ann Intern Med. 144:753–761. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Clemett D and Spencer CM: Raloxifene: A review of its use in postmenopausal osteoporosis. Drugs. 60:379–411. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Sugimoto H1, Watanabe K, Toyama T, Takahashi SS, Sugiyama S, Lee MC and Hamada N: Inhibitory effects of French pine bark extract, Pycnogenol®, on alveolar bone resorption and on the osteoclast differentiation. Phytother Res. 29:251–259. 2015. View Article : Google Scholar

15 

Sağlam M, Köseoğlu S, Hatipoğlu M, Esen HH and Köksal E: Effect of sumac extract on serum oxidative status, RANKL/OPG system and alveolar bone loss in experimental periodontitis in rats. J Appl Oral Sci. 23:33–41. 2015. View Article : Google Scholar

16 

Guimarães MV, Melo IM, Adriano Araújo VM, Tenazoa Wong DV, Roriz Fonteles CS, Moreira Leal LK, Ribeiro RA and Lima V: Dry extract of Matricaria recutita L. (Chamomile) prevents ligature-induced alveolar bone resorption in rats via inhibition of tumor necrosis factor-α and interleukin-1β. J Periodontol. 87:706–715. 2016. View Article : Google Scholar

17 

Feng XF, Huang LQ, Ge XG, Yang LJ and Yang JY: Textual research on origin and development of genuine medicinal herbs of Shanyao. Zhongguo Zhong Yao Za Zhi. 33:859–862. 2008.In Chinese. PubMed/NCBI

18 

Zhang Z, Xiang L, Bai D, Wang W, Li Y, Pan J, Liu H, Wang S, Xiao GG and Ju D: The protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulating Wnt and p38 MAPK signaling. Nutrients. 6:5853–5870. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Blanchard F, Duplomb L, Baud' huin M and Brounais B: The dual role of IL-6-type cytokines on bone remodeling and bone tumors. Cytokine Growth Factor Rev. 20:19–28. 2009. View Article : Google Scholar

20 

Sims NA and Walsh NC: GP130 cytokines and bone remodelling in health and disease. BMB Rep. 43:513–523. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Zhang Z, Song C, Zhang F, Xiang L, Chen Y, Li Y, Pan J, Liu H, Xiao GG and Ju D: Rhizoma Dioscoreae extract protects against alveolar bone loss in ovariectomized rats via microRNAs regulation. Nutrients. 7:1333–1351. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Zhang Z, Xiang L, Bai D, Fu X, Wang W, Li Y, Liu H, Pan J, Li Y, Xiao GG, et al: Treatment with Rhizoma Dioscoreae extract has protective effect on osteopenia in ovariectomized rats. ScientificWorldJournal. 2014:6459752014.PubMed/NCBI

23 

Hidaka S, Okamoto Y, Yamada Y, Kon Y and Kimura T: A Japanese herbal medicine, Chujo-to, has a beneficial effect on osteoporosis in rats. Phytother Res. 13:14–19. 1999. View Article : Google Scholar : PubMed/NCBI

24 

Yang J, Pham SM and Crabbe DL: High-resolution micro-CT evaluation of mid- to long-term effects of estrogen deficiency on rat trabecular bone. Acad Radiol. 10:1153–1158. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ and Müller R: Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J Bone Miner Res. 25:1468–1486. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Garbers C, Hermanns HM, Schaper F, Müller-Newen G, Grötzinger J, Rose-John S and Scheller J: Plasticity and cross-talk of interleukin 6-type cytokines. Cytokine Growth Factor Rev. 23:85–97. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Grant SL and Begley CG: The oncostatin M signalling pathway: Reversing the neoplastic phenotype? Mol Med Today. 5:406–412. 1999. View Article : Google Scholar : PubMed/NCBI

28 

Heinrich PC, Behrmann I, Haan S, Hermanns HM, Müller-Newen G and Schaper F: Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J. 374:1–20. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Mosley B, De Imus C, Friend D, Boiani N, Thoma B, Park LS and Cosman D: Dual oncostatin M (OSM) receptors. Cloning and characterization of an alternative signaling subunit conferring OSM-specific receptor activation. J Biol Chem. 271:32635–32643. 1996. View Article : Google Scholar : PubMed/NCBI

30 

Lindberg RA, Juan TS, Welcher AA, Sun Y, Cupples R, Guthrie B and Fletcher FA: Cloning and characterization of a specific receptor for mouse oncostatin M. Mol Cell Biol. 18:3357–3367. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Bellido T, Borba VZ, Roberson P and Manolagas SC: Activation of the Janus kinase/STAT (signal transducer and activator of transcription) signal transduction pathway by interleukin-6-type cytokines promotes osteoblast differentiation. Endocrinology. 138:3666–3676. 1997. View Article : Google Scholar : PubMed/NCBI

32 

Itoh S, Udagawa N, Takahashi N, Yoshitake F, Narita H, Ebisu S and Ishihara K: A critical role for interleukin-6 family-mediated Stat3 activation in osteoblast differentiation and bone formation. Bone. 39:505–512. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Bellido T, O' Brien CA, Roberson PK and Manolagas SC: Transcriptional activation of the p21(WAF1, CIP1, SDI1) gene by interleukin-6 type cytokines. A prerequisite for their pro-differentiating and anti-apoptotic effects on human osteoblastic cells. J Biol Chem. 273:21137–21144. 1998. View Article : Google Scholar : PubMed/NCBI

34 

Jilka RL, Weinstein RS, Bellido T, Parfitt AM and Manolagas SC: Osteoblast programmed cell death (apoptosis): modulation by growth factors and cytokines. J Bone Miner Res. 13:793–802. 1998. View Article : Google Scholar : PubMed/NCBI

35 

Palmqvist P, Persson E, Conaway HH and Lerner UH: IL-6, leukemia inhibitory factor, and oncostatin M stimulate bone resorption and regulate the expression of receptor activator of NF-kappa B ligand, osteoprotegerin, and receptor activator of NF-kappa B in mouse calvariae. J Immunol. 169:3353–3362. 2002. View Article : Google Scholar : PubMed/NCBI

36 

Kim S, Yamazaki M, Shevde NK and Pike JW: Transcriptional control of receptor activator of nuclear factor-kappaB ligand by the protein kinase A activator forskolin and the transmembrane glycoprotein 130-activating cytokine, oncostatin M, is exerted through multiple distal enhancers. Mol Endocrinol. 21:197–214. 2007. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang Z, Chen Y, Xiang L, Pan J, Wang Z, Xiao GG and Ju D: Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling. Int J Mol Med 40: 1602-1610, 2017.
APA
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G.G., & Ju, D. (2017). Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling. International Journal of Molecular Medicine, 40, 1602-1610. https://doi.org/10.3892/ijmm.2017.3130
MLA
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G. G., Ju, D."Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling". International Journal of Molecular Medicine 40.5 (2017): 1602-1610.
Chicago
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G. G., Ju, D."Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling". International Journal of Molecular Medicine 40, no. 5 (2017): 1602-1610. https://doi.org/10.3892/ijmm.2017.3130
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang Z, Chen Y, Xiang L, Pan J, Wang Z, Xiao GG and Ju D: Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling. Int J Mol Med 40: 1602-1610, 2017.
APA
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G.G., & Ju, D. (2017). Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling. International Journal of Molecular Medicine, 40, 1602-1610. https://doi.org/10.3892/ijmm.2017.3130
MLA
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G. G., Ju, D."Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling". International Journal of Molecular Medicine 40.5 (2017): 1602-1610.
Chicago
Zhang, Z., Chen, Y., Xiang, L., Pan, J., Wang, Z., Xiao, G. G., Ju, D."Protective effect of Rhizoma Dioscoreae extract against alveolar bone loss in ovariectomized rats via regulation of IL-6/STAT3 signaling". International Journal of Molecular Medicine 40, no. 5 (2017): 1602-1610. https://doi.org/10.3892/ijmm.2017.3130
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team