Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
November-2022 Volume 50 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2022 Volume 50 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway

  • Authors:
    • Weichao Sun
    • Wei Xie
    • Dixi Huang
    • Yinxing Cui
    • Jiaji Yue
    • Qifei He
    • Luoyong Jiang
    • Jianyi Xiong
    • Wei Sun
    • Qian Yi
  • View Affiliations / Copyright

    Affiliations: Department of Orthopaedics, Shenzhen Second People's Hospital (The First Affiliated Hospital of Shenzhen University), Shenzhen, Guangdong 518035, P.R. China, Department of Physiology, School of Basic Medical Science, Southwest Medical University, Luzhou, Sichuan 646000, P.R. China
    Copyright: © Sun et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 134
    |
    Published online on: September 14, 2022
       https://doi.org/10.3892/ijmm.2022.5190
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Osteoarthritis (OA) is the most common degenerative disease affecting the joints, and inflammation appears to play a critical role in the initiation and progression of OA. Caffeic acid phenethyl ester (CAPE), a natural flavonoid compound, has anti‑inflammatory and antioxidant functions. However, its anti‑inflammatory effects on OA and the underlying mechanisms of action of CAPE in the treatment of OA remain elusive. Therefore, the present study investigated the anti‑inflammatory effects of CAPE on IL‑1β‑stimulated chondrocytes in vitro and surgically induced rat models of OA in vivo. In vitro, CAPE reduced the expression of inducible nitric oxide synthase and cyclooxygenase‑2 in IL‑1β‑stimulated chondrocytes, as well as the extracellular secretion of nitric oxide and prostaglandin E2 in the cell culture supernatants. In addition, CAPE attenuated the degradation of extracellular matrix by increasing the expression of aggrecan and collagen II, and decreasing the expression of MMP3, MMP13 and a disintegrin and metalloproteinase with thrombospondin motif‑5. Furthermore, CAPE attenuated NF‑κB signaling and activated the nuclear factor erythroid 2‑related factor 2/heme oxygenase‑1 signaling pathway in IL‑1β‑stimulated chondrocytes. In vivo, CAPE protected cartilage from destruction and delayed the progression of OA in rats. Taken together, the findings of the present study indicated that CAPE may be a potential therapeutic agent for the prevention or treatment of OA.

Introduction

Osteoarthritis (OA) is the most common degenerative disease affecting the joints worldwide, and frequently affects the elderly population. The pathological features of OA include the erosion of articular cartilage, subchondral bone sclerosis and synovitis (1,2). Although various studies have reported that sex, age and obesity are the main risks factors for OA, the pathophysiology of OA has not been fully elucidated to date (3,4). It has been demonstrated that inflammatory cytokines play a critical role in the initiation and progression of OA, including interleukin (IL)-1β, tumor necrosis factor (TNF), IL-6, etc. (5,6). Among these, IL-1β is considered the most crucial one (7). The expression level of IL-1β has been found to be increased in the synovial fluid and cartilage tissue of patients with OA (8). IL-1β affects the metabolic process of chondrocytes by increasing the expression of MMPs, which contributes to cartilage degradation (9). IL-1β also induces the production of the inflammatory mediators, nitric oxide (NO) and prostaglandin E2 (PGE2), which leads to bone resorption and extracellular matrix (ECM) degradation (10). Therefore, novel effective agents aiming to suppress IL-1β expression, thus inhibiting IL-1β-induced MMPs and inflammatory mediators, may attenuate the progression of OA (11-14). For example, wogonin, a plant-derived small molecule, has been shown to play a potent anti-inflammatory and cartilage protective role by activating the reactive oxygen species (ROS)/ERK/nuclear factor erythroid 2-related factor 2 (NRF2) signaling pathway in chondrocytes of patients with OA (11). Stachydrine, a bioactive alkaloid, has been found to attenuate IL-1β-induced inflammation through the NF-κB signaling pathway in chondrocytes of patients with OA (14). The NF-κB pathway is known to be involved in IL-1β-induced inflammation. Following stimulation with IL-1β, p65 is translocated from the cytoplasm to the nucleus, where it stimulates the expression of multiple inflammatory or catabolic genes, including inducible NO synthase (iNOS), TNF-α and MMPs (15). NF-κB signaling plays a critical role in the pathogenesis of OA (164). It has been reported that the activation of the NRF2/heme oxygenase-1 (HO-1) signaling inhibits the IL-1β-induced activation of NF-κB in chondrocytes (17). NRF2 is a transcription factor that regulates the cellular response to oxidative stress and affects the expression of superoxide dismutase and HO-1 (18). Previous studies have demonstrated that NRF2 plays a pivotal role in cartilage integrity through anti-oxidative and anti-apoptotic functions (19,20). In addition, an in vivo study demonstrated that the deletion of NRF2 led to more severe damage in cartilage (21). Therefore, the activation of the NRF2 signaling pathway and the inhibition of the NF-κB signaling pathway play major chondroprotective roles in alleviating the symptoms of OA.

Caffeic acid phenethyl ester (CAPE), a natural flavonoid compound, is one of the major bioactive ingredients of propolis (22). It is also widely found in fruits, vegetables and grains, and has been shown to exhibit multiple health benefits (23). Previous studies have indicated that CAPE has antioxidant, antitumor, anti-apoptotic, anti-inflammatory and neuroprotective functions (24-27). CAPE has been reported to be a potent inhibitor of NF-κB (28). Liang et al (29) reported that CAPE suppressed the proliferation and metastasis of nasopharyngeal carcinoma cells by inhibiting the NF-κB signaling pathway. Lim et al (30) reported that CAPE suppressed skin inflammation by inhibiting NF-κB activation. Furthermore, another study demonstrated that CAPE decreased ROS levels and exerted a neuroprotective effect in a mouse model of Alzheimer's disease via the activation of the NRF2/HO-1 signaling pathway (31). In addition, as previously demonstrated, CAPE suppressed the inflammation-triggered myeloperoxidase activity and production of pro-inflammatory cytokines in colitis (32). These results confirm the effectiveness and safety of CAPE as an anti-inflammatory agent. However, the role of CAPE in other age-related and inflammation-related diseases, such as OA, remains unclear. Elmali et al (33) reported that CAPE could alleviate unilateral anterior cruciate ligament transection-induced cartilage destruction. However, the chondroprotective effects of CAPE and its underlying mechanisms remain elusive. Therefore, the present study investigated the anti-inflammatory effects and the underlying mechanisms of action of CAPE in the treatment of OA.

Materials and methods

Reagents

CAPE was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. IL-1β was purchased from ProteinTech Group, Inc. The Cell Counting Kit-8 (CCK-8) was purchased from Beyotime Institute of Biotechnology. Griess Reagent Nitrite Measurement kit (cat. no. 13547) was purchased from Cell Signaling Technology, Inc. The ELISA kits for human PGE2 (cat. no. SEKH-0414), Toluidine Blue solution and bovine serum albumin (BSA) were purchased from Beijing Solarbio Science & Technology Co., Ltd. Penicillin/streptomycin, fetal bovine serum (FBS) and DMEM were purchased from Gibco (Thermo Fisher Scientific, Inc.).

Primary chondrocyte isolation and culture

Human chondrocytes were isolated from human articular cartilage tissues that were procured from patients with femoral neck fracture. The collection of cartilage tissues from patients was approved by the Ethics Committee of Shenzhen Second People's Hospital (Shenzhen, China). Patients with an average age of 64.8 years (aged 60-68 years, two males and three females) who were subjected to total knee replacement surgery at the Shenzhen Second People's Hospital from January to March, 2021 participated in the study. All patients provided written informed consent. The articular cartilage tissues were washed with PBS and cut into 1 mm3 pieces. The sections were then cultured with collagenase II (2 g/l) for 4 h at 37°C (31). Upon centrifugation at 108 × g for 5 min at 24°C, the cells were cultured in DMEM with 10% (v/v) FBS and 1% (v/v) antibiotics (penicillin/streptomycin) in an atmosphere containing 5% CO2 at 37°C. The culture medium was changed every other day. Only cells from the first three passages were used in the present study. Chondrocyte morphology was examined using toluidine blue staining. In brief, the culture medium was aspirated and washed twice with PBS. Toluidine blue solution for 5 min at room temperature, and the same amount of distilled water was added and mixed evenly. Images were acquired using an Olympus microscope (Olympus Corporation) after standing for 15 min at room temperature.

Animal models

Sprague-Dawley male wild-type rats (n=12; 8 weeks old; weighing 300-350 g) were acquired from Cloud-Clone Corp. The rats were maintained in a clean environment at 27°C under a 12-h light/dark cycle with 50% humidity, and had free access to adequate food and water. The animal protocols and the experimental procedures were in agreement with the Animal Care and Use Committee of Southwest Medical University (approval no. 20211124-043). The model of OA was established by the destabilization of the medial meniscus (DMM) through surgical treatment as previously described (32). Briefly, the rats were anesthetized with 2% (w/v) pentobarbital (40 mg/kg) via intraperitoneal injection. The capsule of the right knee joint was opened though the medial patellar tendon and the medial meniscus tibial ligament was cut using microsurgical scissors. The medial meniscus tibial ligament was not cut in the sham-operated control group. In the present study, the rats were randomly divided into three groups as follows: The sham-operated control group (sham), the OA group (DMM) and the CAPE-treated OA group (DMM + CAPE). Rats in the CAPE treatment group were administered 10 mg/kg/2 days CAPE, for 8 weeks. At the end of the experiment, all animals were sacrificed by cervical dislocation under anesthesia through an intraperitoneal injection of pentobarbital sodium (50 mg/kg), and respiratory arrest was used to confirm animal death. During the course of the experiment, any rats that were unable to eat or drink, had difficulty breathing and had lost 20% of their body weight before the experiment, were regarded as having reached the humane endpoint and were thus immediately euthanized. None of the rats reached the aforementioned end points in this experiment and thus none were euthanized before the end of the experiment.

Cell transfection with NRF2 small-interfering RNA (siRNA)

Negative control (NC) siRNA and NRF2 siRNA were purchased from Shanghai GenePharma Co., Ltd. Chondrocytes were plated and cultured in six-well plates for 24 h, and then transfected with 80 nM NC and NRF2 siRNA for 48 h using Lipofectamine® 2000 siRNA transfection reagent (Thermo Fisher Scientific, Inc.). The sequences of the NRF2 and NC siRNAs were as follows: 1#NRF2 siRNA: sense, 5′-GGG AGG AGC UAU UAU CCA UTT-3′ and antisense, 5′-AUG GAU AAU AGC UCC UCC CTT-3′; and 2#NRF2 siRNA sense, 5′-GCC CAU UGA UGU UUC UGA UTT-3′ and antisense, 5′-AUC AGA AAC AUC AAU GGG CTT-3′; and 3#NRF2 siRNA sense, 5′-GCC UGU AAG UCC UGG UCA UTT-3′ and antisense, 5′-AUG ACC AGG ACU UAC AGG CTT-3′; and NC siRNA sense, 5′-UUC UCC GAA CGU GUC ACG UTT-3′ and antisense, 5′-ACG UGA CAC GUU CGG AGA ATT-3′; NC FAM-siRNA sense, 5′-UUC UCC GAA CGU GUC AC GUT T-3′ and antisense, 5′-ACG UGA CAC GUU CGG AGA ATT-3′.

CCK-8 assay

The cytotoxicity of CAPE on human chondrocytes was evaluated using CCK-8 assay. In brief, chondrocytes were plated into 96-well plates in serum-free medium for 24 h, and then treated with various concentrations of CAPE (0, 1, 3, 5, 10, 20 and 40 µM) for 24 h. The chondrocytes were then washed with PBS, and 100 µl DMEM containing 10 µl CCK-8 solution was added to each well, followed by incubation at 37°C for 3 h. The optical density value of the wells was measured at a wavelength of 450 nm using a microplate reader (Thermo Fisher Scientific, Inc.).

Griess reaction and ELISA

Chondrocytes were plated and cultured in 6-well plates, and pre-treated with CAPE (0, 10 or 20 µM). After 24 h, IL-1β (10 ng/ml) was added, followed by additional 24 h of incubation at 37°C. The content of NO and PGE2 in each well was detected using the Griess reaction and ELISA kits, respectively, according to the manufacturer's protocols.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from the chondrocytes using TRIzol® reagent (Takara Bio, Inc.), and 1 µg total RNA was used to synthesize cDNA using the PrimeScript™ RT reagent kit with gDNA Eraser (Takara Bio, Inc.), and the conditions were as follow: 15 min at 37°C, followed by 5 sec at 85°C. The total volume of q-PCR was 10 µl, including 5 µl 2X SYBR Master Mix (Beyotime Institute of Biotechnology), 0.25 µl each primer and 4.5 µl diluted cDNA. qPCR was conducted in a CFX96Real-Time PCR System, and the thermocycling conditions were as follows: 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. GAPDH was used as the internal control for normalization. The relative mRNA of the target genes was calculated using the 2−ΔΔCq method (36). The primer sequences of the target genes are presented in Table I.

Table I

Primer sequences used in reverse transcription-quantitative PCR.

Table I

Primer sequences used in reverse transcription-quantitative PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
iNOS GACGAGACGGATAGGCAGAG′ CACATGCAAGGAAGGGAACT
COX-2 GAGAGATGTATCCTCCCACAGTCA GACCAGGCACCAGACCAAAG
MMP3 TGCGTGGCAGTTTGCTCAGCC GAATGTGAGTGGAGTCACCTC
MMP13 GGCTCCGAGAAATGCAGTCTTTCTTATCAAATGGGTAGAAG TCGCCATGC
Adamts5 GGTCAAGGTCCCATGTGCAAC GAATGCGGCCATCTTGTCATC
Aggrecan AGGATGGCTTCCACCAGTGT GGCATAAAAGACCTCACCCTCC
Collagen II CTGTCCTTCGGTGTCAGGG CGGCTTCCACACATCCTTAT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[i] iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; Adamts5, a disintegrin and metalloproteinase with thrombospondin motif-5.

Western blot analysis

The cells were lysed by radio immunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, Inc.) containing 1 mM PMSF to extract total protein. The protein concentration was detected with a BCA protein assay kit (Beyotime Institute of Biotechnology). Subsequently, 40 µg denatured protein solution were separated by 12% SDS-PAGE (Wuhan Servicebio Technology Co., Ltd.) and transferred to a PVDF membrane (Merck KGaA), which was incubated in methanol for 1 min at room temperature. The methanol was then removed and the membrane was equilibrated in transfer buffer until ready to use. Upon transfer at 100 V for 1 h at 4°C, the membrane was blocked with 5% skimmed milk for 1 h at room temperature and then incubated with primary antibodies against GADPH (1:1,000; cat. no. AP0066; Bioworld Technology, Inc.), MMP3 (1:5,000; cat. no. 66338-1-Ig; ProteinTech Group, Inc.), MMP13 (1:1,000; cat. no. 18165-1-AP; ProteinTech Group, Inc.), a disintegrin and metalloproteinase with thrombospondin motif-5 (Adamts5; 1:500; cat. no. A2836; ABclonal Biotech Co., Ltd.), iNOS (1:500; cat. no. 18985-1-AP; ProteinTech Group, Inc.), cyclooxygenase-2 (COX-2; 1:500; cat. no. 12375-1-AP; ProteinTech Group, Inc.), lamin B1 (1:1,000; cat. no. AF1408; Beyotime Institute of Biotechnology), NRF2 (1:2,000; cat. No. 16396-1-AP; ProteinTech Group, Inc.), HO-1 (1:1,000; cat. no. 10701-1-AP; ProteinTech Group, Inc.), p65 (1:1,000; cat. no. 8242; Cell Signaling Technology Inc.), phosphorylated (p)-p65 (1:1,000; cat. no. 3033; Cell Signaling Technology Inc.), IκBα (1:1,000, cat. no. 4814; Cell Signaling Technology Inc.), p-IκBα (1:1,000, cat. no. 2859; Cell Signaling Technology Inc.) and collagen II (1:500; cat. no. PA5-99159, Thermo Fisher Scientific, Inc.) overnight at 4°C. Subsequently, the membranes were incubated with a HRP-conjugated goat anti-rabbit (1:1,000; cat. no. A0208; Beyotime Institute of Biotechnology Inc.) or goat anti-mouse IgG (1:1,000; cat. no. A0216; Beyotime Institute of Biotechnology Inc.) secondary antibody for 2 h at room temperature. Finally, an ECL reagent (cat. no. 34580; ThermoFisher Scientific, Inc.) was used to detect the blots. The ECL signal was captured using Odyssey FC Imager (Gene Company, Ltd.), and GAPDH and Lamin B1 were used as loading controls for normalization. Quantitative analysis was performed using ImageJ 1.53e software (National Institutes of Health).

Immunofluorescence

Chondrocytes were seeded in a glass plate, cultured for 12 h, pre-treated with or without CAPE (20 µM) for 24 h, and then co-incubated with or without IL-1β (10 ng/ml) for 24 h. Subsequently, the cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. The cells were then treated with 0.1% TritonX-100 for 5 min and blocked with 5% BSA for 1 h at room temperature. The cells were then incubated with primary antibodies against collagen II (1:100; cat. no. PA5-99159, Thermo Fisher Scientific, Inc.), MMP3 (1:100; cat. no. 66338-1-Ig; ProteinTech Group, Inc.), p65 (1:400; cat. no. 8242; Cell Signaling Technology Inc.) and NRF2 (1:500; cat. no. 16396-1-AP; ProteinTech Group, Inc.) overnight at 4°C. The following day, the cells were incubated with Alexa Fluor® 647-conjugated goat anti-rabbit IgG (1:500; cat. no. A0468; Beyotime Institute of Biotechnology) and Alexa Fluor® 647-conjugated goat anti-mouse IgG secondary antibodies (1:500; cat. no. A0473; Beyotime Institute of Biotechnology) for 1 h at room temperature in the dark and exposed to DAPI (Beyotime Institute of Biotechnology) for 5 min at room temperature. Finally, the cells were observed under a confocal microscope (ZEISS GmbH) and analyzed using ImageJ 1.53e software.

Molecular docking of CAPE with the Kelch-like ECH-associated protein 1 (Keap1)-NRF2 complex

The structure data file (SDF) of CAPE (Pubchem ID: 5281787) was downloaded from the PubChem website (https://pubchem.ncbi.nlm.nih.gov/) and converted to PDB format on OpenBabel 3.1.1. The structure of Keap1-NRF2 complex was downloaded from the RCSB Protein Data Bank (https://www.rcsb.org/). AutoDockTools1.5.7 software was used to modify the receptor protein, such as water removal and hydrogenation, and also to modify ligand small molecule, such as hydrogenation. Next, the molecular docking analysis of receptor protein and ligand small molecule was performed using AutoDockTools. Eventually, ligand binding flexibility with the binding pocket residues were drawn using PYMOL 2.5.2.

Histopathological analysis

The knee joint tissue was fixed with 4% paraformaldehyde for 24 h at 4°C and then decalcified with 10% EDTA solution for 2 weeks. The tissue was then dehydrated, cleared, embedded in paraffin blocks and sliced to obtain frontal serial sections at a thickness of 5 µm. The slides were then stained with Safranin O/Fast Green (S/O) (cat. no. G1053; Beijing Solarbio Science & Technology Co., Ltd.). In brief, the slides were strained with Fast Green for 2 min, washed with water, and soaked in 1% hydrochloric acid and alcohol for 10 sec at room temperature. Then strained with Safranin O for 5 sec, rapid dehydrated in absolute ethanol for 5 sec, 2 sec and 10 sec, and sealed with neutral resin (Sinopharm Group Chemical Reagent Co., Ltd.) at room temperature. The extent of cartilage degeneration was assessed using a Nikon E100 microscope (Nikon Corporation) and evaluated using the Osteoarthritis Research Society International (OARSI) scoring system as described previously (37).

Immunohistochemical assay

Immunohistochemical assay was performed as previously described (38). Briefly, the slides were deparaffinized and rehydrated. For antigen repair, the slides were incubated with 0.4% pepsin (Sangon Biotech Co., Ltd.) in 5 mM HCl at 37°C for 20 min, and then blocked with 5% BSA for 30 min. The slides were then incubated with primary antibodies against collagen Ⅱ (1:50; cat. no. PA5-99159, Thermo Fisher Scientific, Inc.), MMP3 (1:500; cat. no. 66338-1-Ig; ProteinTech Group, Inc.), MMP13 (1:500; cat. no. 18165-1-AP; ProteinTech Group, Inc.) and NRF2 (1:500; cat. no. 16396-1-AP; ProteinTech Group, Inc.) overnight at 4°C. Finally, the slides were incubated with HRP-conjugated goat anti-rabbit (1:50; cat. no. A0208; Beyotime Institute of Biotechnology, Inc.) or goat anti-mouse IgG (1:50; cat. no. A0216; Beyotime Institute of Biotechnology, Inc.) secondary antibody for 50 min at room temperature, and images were captured using an Olympus BX51 microscope (Olympus Corporation).

Statistical analysis

Data are expressed as the mean ± SD. All experiments were repeated at least three times. Statistical analyses were performed using GraphPad Prism version 8.0 software (GraphPad Software, Inc.). Comparisons between two groups were performed using an unpaired two-tailed Student's t-test. Comparisons among multiple groups were done using one-way ANOVA test followed by a post-hoc Test (Bonferroni). A value of P<0.05 was considered to indicate a statistically significant difference.

Results

Cytotoxic effects of CAPE on human chondrocytes

The molecular chemical structure of CAPE is illustrated in Fig. 1A, and the morphology of the human chondrocytes are illustrated in Fig. 1B and C, respectively. To measure the cytotoxic effect of CAPE on human chondrocytes, the chondrocytes were treated with various concentrations of CAPE (0, 1, 3, 5, 10, 20 and 40 µmol/l) for 24 h. CAPE cytotoxicity was detected using CCK-8 assay. The results revealed that there was no obvious cytotoxic effect of CAPE on human chondrocytes when the cells were incubated with 1, 3, 5, 10 or 20 µM CAPE (Fig. 1D). However, the viability of the chondrocytes was significantly inhibited following treatment with 40 µM CAPE (Fig. 1D). Therefore, CAPE was used at 10 and 20 µM in the subsequent experiments.

Figure 1

Cytotoxic effects of CAPE on human chondrocytes. (A) Chemical structure of CAPE. (B) Cell morphology of human primary chondrocytes under light microscopy. Scale bar, 200 µm. (C) Toluidine blue staining in human primary chondrocytes. Scale bar, 100 µm. (D) The cytotoxic effects of CAPE on human chondrocytes were determined using Cell Counting Kit-8 assay. **P<0.01, vs. control. CAPE, caffeic acid phenethyl ester.

CAPE blocks the levels of IL-1β-induced inflammatory mediators in human chondrocytes

To examine the effects of CAPE on the IL-1β-induced inflammation of chondrocytes, the expression and production levels of COX-2, iNOS, NO and PGE2 were measured using RT-qPCR, western blot analysis and ELISA. The results revealed that CAPE at the concentrations of 10 and 20 µM inhibited the expression of COX-2 and iNOS stimulated by IL-1β at the protein and mRNA level (Fig. 2A-C). In addition, the results of Griess reaction and ELISA revealed that CAPE at concentrations of 10 and 20 µM suppressed the production of NO and PGE2 stimulated by IL-1β (Fig. 2D and E). Therefore, these results indicated that CAPE inhibited the expression and production of IL-1β-induced inflammatory mediators in human chondrocytes, particularly at the concentrations of 10 and 20 µM.

Figure 2

CAPE blocks the levels of IL-1β-induced inflammatory mediators in human chondrocytes. (A) The mRNA expression of COX-2 and iNOS was detected using reverse transcription-quantitative PCR. The protein expression of COX2 and iNOS was (B) detected using western blotting and (C) quantified. (D) The production of nitric oxide was detected via the Griess reaction. (E) The production of prostaglandin E2 was detected using ELISA. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CAPE, caffeic acid phenethyl ester; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase.

CAPE attenuates the IL-1β-induced degradation of the ECM in human chondrocytes

To determine the effects of CAPE on IL-1β-induced ECM synthesis and degradation in chondrocytes, the effects of CAPE on the expression of collagen II, aggrecan, MMP3, MMP13 and Adamts5 were examined using RT-qPCR, western blot analysis and immunofluorescence. The results revealed that the mRNA expression levels of collagen II and aggrecan were increased by CAPE at 10 and 20 µM under IL-1β stimulation, while the mRNA expression levels of MMP3, MMP13 and Adamts5 were inhibited (Fig. 3A). In addition, the protein level of collagen II was increased by CAPE at 10 and 20 µM following IL-1β stimulation, while the protein levels of MMP3, MMP13 and Adamts5 were inhibited (Fig. 3B). The immunofluorescence staining of collagen II and MMP3 revealed that CAPE activated collagen II expression and inhibited MMP3 expression following IL-1β stimulation (Fig. 3C and D). Therefore, these data indicated that CAPE attenuated the IL-1β-induced ECM degradation in human chondrocytes by preventing the degradation of collagen II and the production of ECM degradative enzymes.

Figure 3

CAPE attenuates the IL-1β-induced extracellular matrix degradation in human chondrocytes. (A) The mRNA expression of collagen II, aggrecan, MMP3, MMP13 and Adamts5 was detected using reverse transcription-quantitative PCR. (B) The protein expression of collagen II, MMP3, MMP13 and Adamts5 was detected using western blot analysis and quantified. (C) Collagen II and (D) MMP3 expression was detected by immunofluorescence. Scale bar, 50 µm. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CAPE, caffeic acid phenethyl ester; Adamts5, a disintegrin and metalloproteinase with thrombospondin motif-5.

CAPE prevents IL-1β-induced NF-κB activation in human chondrocytes

To explore the anti-inflammatory mechanisms of CAPE in IL-1β-stimulated chondrocytes, the expression of p65, p-p65, IκBα and p-IκBα was detected using western blot analysis and immunofluorescence. The results revealed that the phosphorylation of p65 was significantly increased by IL-1β stimulation, while it was significantly inhibited by pre-treatment with CAPE (Fig. 4A and B). Additionally, pre-treatment with CAPE inhibited the protein level of IkBα and the phosphorylation level of IkBα in IL-1β-stimulated chondrocytes (Fig. 4A and B). The immunofluorescence staining of p65 revealed that pre-treatment with CAPE decreased the expression of p65 in the nucleus of IL-1β-stimulated chondrocytes (Fig. 4C). Therefore, these data suggested that CAPE prevented the IL-1β-induced NF-κB activation by inhibiting the translocation of p65 and the degradation of IκBα in human chondrocytes.

Figure 4

CAPE prevents IL-1β-induced NF-κB activation in human chondrocytes. The protein expression of p65, p-p65, IκBα and p-IκBα was (A) detected using western blot analysis and (B) quantified. (C) The nuclear translocation of p65 was observed using immunofluorescence. Scale bar, 20 µm. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CAPE, caffeic acid phenethyl ester; p, phosphorylated.

CAPE upregulates the NRF2/HO-1 signaling pathway in IL-1β-stimulated human chondrocytes

To investigate the role of the NRF2/HO-1 signaling pathway in the anti-inflammatory effects of CAPE, the expression of NRF2 and HO-1 in IL-1β-stimulated human chondrocytes was detected using western blot analysis and immunofluorescence. The results revealed that CAPE increased the expression of NRF2 in a concentration-dependent manner (Fig. S1). Additionally, the results revealed that the protein levels of NRF2 and HO-1 were increased by 10 and 20 µM CAPE under IL-1β stimulation (Fig. 5A and B). The immunofluorescence staining of NRF2 revealed that pre-treatment with CAPE increased the expression of NRF2 in the nuclei of IL-1β-stimulated chondrocytes (Fig. 5C). Therefore, these data suggested that CAPE exerted anti-inflammatory effects in IL-1β-stimulated chondrocytes through the activation of the NRF2/HO-1signaling pathway.

Figure 5

CAPE upregulates the NRF2/HO-1 signaling pathway in IL-1β-induced human chondrocytes. The protein expression of NRF2 and HO-1 was (A) detected using western blot analysis and (B) quantified. (C) The nuclear translocation of NRF2 was observed using immunofluorescence. Scale bar, 50 µm. **P<0.01, ***P<0.001 and ****P<0.0001. CAPE, caffeic acid phenethyl ester; NRF2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1.

To further confirm that the anti-inflammatory effects of CAPE are mediated via the NRF2/HO-1 signaling pathway in IL-1β-stimulated chondrocytes, NRF2 siRNA was transfected into chondrocytes to silence the expression of NRF2 (Fig. S2). The results revealed that the silencing of NRF2 inhibited the protein levels of NRF2 and HO-1 which had been increased by pre-treatment with CAPE in the IL-1β-stimulated chondrocytes, which suggested that the CAPE-induced activation of the NRF2/HO-1 signaling activation was inhibited by the silencing of NRF2 (Fig. 6A and B). The silencing of NRF2 increased the phosphorylation levels of p65 in the nuclei of IL-1β-stimulated chondrocytes which had been decreased by pre-treatment with CAPE; this suggested that the CAPE-mediated suppression of NF-κB signaling was abolished by the silencing of NRF2 (Fig. 6A and B). Furthermore, downregulation of NRF2 could inhibit the protein levels of iNOS and COX-2 by pre-treatment with CAPE in IL-1β-induced chondrocytes, which suggested that the CAPE-mediated suppression of inflammation was abolished by downregulation of NRF2 (Fig 6A and B). In addition, the silencing of NRF2 in IL-1β-stimulated chondrocytes increased the protein levels of MMP3, MMP13 and Adamts5, whereas it decreased the protein levels of collagen II upon pre-treatment with CAPE (Fig. 6C and D). Therefore, these data indicated that CAPE regulated NF-κB signaling and the inflammatory response though the NRF2/HO-1 signaling pathway in IL-1β-stimulated chondrocytes.

Figure 6

Downregulation of NRF2 inhibits the anti-inflammatory effects of CAPE on human chondrocytes. The protein expression of NRF2, HO-1, p-p65, iNOS and COX-2 was (A) detected using western blot analysis and (B) quantified. (C) The protein expression of collagen II, MMP3, MMP13 and Adamts5 was (C) detected using western blotting and (D) quantified. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CAPE, caffeic acid phenethyl ester; NRF2, nuclear factor erythroid 2-related factor 2; HO-1, heme oxygenase-1; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase 2.

Molecular docking between CAPE and the Keap1-NRF2 complex

In order to evaluate whether there is any affinity between CAPE and Keap1-NRF2 complex, computational molecular docking analysis was performed. The structures of CAPE and the Keap1-NRF2 complex (PDB ID: 2FLU) were obtained and analyzed (Fig. 7A and B). It was found that CAPE interacted with and docked at the Keap1-NRF2 complex binding site. High-affinity (-7.39 kcal/mol) hydrogen binding events were observed between the residues of Arg415, Val465 and Val512 in CAPE and Keap1-NRF2 complex (Fig. 7C). Therefore, these results indicated that CAPE probably inhibited the development of OA by interacting with the Keap1-NRF2 complex, inhibiting ubiquitination and promoting nuclear translocation of NRF2.

Figure 7

Caffeic acid phenethyl ester interacts with Keap1-NRF2 complex in a docking study. (A) Modular structure of CAPE. (B) The ribbon modular structure of Keap1-NRF2 complex. (C) The high interaction energy (-7.39 kcal/mol) interaction between CAPE and Keap1-NRF2 complex. NRF2, nuclear factor erythroid 2-related factor 2.

CAPE attenuates OA progression in a rat model of DMM

To examine the effects of CAPE on OA progression in vivo, a model of OA was established using rats, followed by an intra-peritoneal injection of 10 mg/kg CAPE. S/O staining revealed that the articular cartilage exhibited a normal, red-dyed area and a smooth surface in the sham control group, whereas the thickness of the articular cartilage was significantly reduced in the DMM group (Fig. 8A). Compared with that in the DMM group, the red-dyed area was thicker and the surface of articular cartilage was smoother in the CAPE-treated group (Fig. 8A), which suggested that CAPE played a role in attenuating the degradation of cartilage matrix. The immunohistochemistry of MMP3, MMP13, collagen Ⅱ and NRF2 was also performed in the OA model. In the DMM group, the expression of MMP3 and MMP13 was markedly increased compared with that in the sham group, while the DMM + CAPE group exhibited a decreased expression of MMP3 and MMP13 (Fig. 8B). In the DMM group, the expression of collagen Ⅱ was markedly decreased compared with that in the sham group, while the DMM + CAPE group exhibited a high expression (Fig. 8B). In the DMM group, the expression of NRF2 was not markedly different from that in the sham group, while the DMM + CAPE group showed increased expression in the cell nuclei (Fig. 8B).

Figure 8

CAPE alleviates OA progression in a DMM rat model. (A) Degeneration of articular cartilage was observed using the Safranin O/Fast Green staining. Upper panel scale bar, 200 µm; lower panel scale bar, 100 µm. The images on the bottom panel are a larger image of the boxed areas in the respective top panels. (B) Immunohistochemistry of MMP3, MMP13, collagen II and NRF2 was employed to assess the effect of CAPE on cartilage in the DMM models. Scale bar, 100 µm. (C) Schematic illustration of the potential protective effects and the underlying mechanism of CAPE in OA development. *P<0.05 and ***P<0.001. CAPE, caffeic acid phenethyl ester; OA, osteoarthritis; DMM, destabilization of the medial meniscus; NRF2, nuclear factor erythroid 2-related factor 2.

Discussion

OA is a common degenerative disease affecting the joints; however, there are currently no effective therapeutic drugs for the clinical treatment of OA (39). Currently, OA is considered to be a chronic and low-grade inflammatory disease. A better understanding of the inflammatory pathophysiology of OA may lead to the identification of novel potential therapeutic drugs (40). Natural products have already exhibited potential for use in the treatment of OA by inhibiting inflammatory processes (41). CAPE, a natural polyphenolic product, is extracted from the bark of conifer trees and propolis (22). It has been reported that CAPE has antioxidant, antimicrobial, anti-inflammatory, anti-cancer and immunomodulatory functions (42-44). Numerous studies have recommended the use of CAPE for the treatment of heart, kidney, liver and neurological diseases, as well as for diabetes and cancer (42-44). A previous study demonstrated that intra-articular injections of CAPE significantly decreased cartilage destruction in vivo, which indicated that CAPE was potentially useful as a therapeutic drug (33). However, the mechanisms through which how CAPE protects cartilage and attenuates OA are currently unknown. To the best of our knowledge, the present study identified for the first time, the effects of CAPE on IL-1β-induced human chondrocytes in vitro and explored the potential molecular mechanisms involved in the prevention of OA.

Chondrocytes are the only cell type in cartilage. Multiple pro-inflammatory cytokines, including IL-1β, TNF-α and IL-6 can influence the functions of chondrocytes and may thus be implicated in the pathogenesis process of OA (45). It is well-accepted that IL-1β can be used to mimic OA by inducing an inflammatory response in chondrocytes (7-9). In the present study, IL-1β was used to induce OA in chondrocytes, and it was found that IL-1β significantly increased the inflammatory responses of chondrocytes.

CAPE has been reported to possess an anti-inflammatory function (44). CAPE has been found to attenuate amyloid-β oligomer-induced neurodegeneration, neuroinflammation and memory impairment in mice by inhibiting oxidative stress through the NRF2/HO-1 signaling pathway (31). A previous study also demonstrated that CAPE exerted protective effects against Helicobacter pylori-induced gastritis in Mongolian gerbils, which was attributed to its ability to suppress inflammatory mediators, including TNF-α, IL-2, IL-6, IL-8 and iNOS through the inhibition of NF-κB activation (46). In addition, CAPE has been shown to prevent colitis-associated cancer by post-transcriptionally inhibiting the NOD-, LRR- and pyrin domain-containing protein 3 inflammasome (47). The present study found that CAPE inhibited the levels of IL-1β-induced inflammatory mediators, including NO, PGE2, iNOS and COX-2 in human chondrocytes. Therefore, the results of the present study suggested that CAPE exerted its anti-inflammatory effects by suppressing the levels of inflammatory mediators in IL-1β-stimulated chondrocytes.

The ECM degradation of articular cartilage is one of the main features in the process of OA development (48). During the development of OA, chondrocytes produce and secrete ECM degradative enzymes, including family members of MMPs and Adamts, in response to inflammatory factors, which can promote the degradation of the ECM (49-51), while the generation of collagen II and aggrecan is decreased (51). The present study found that the levels of ECM degradative enzymes, including MMP3, MMP13 and Adamts5, were increased in IL-1β-stimulated chondrocytes, while the level of collagen II was decreased under IL-1β stimulation. Pre-treatment with CAPE inhibited the generation of ECM degradative enzymes and promoted the generation of collagen II in IL-1β-induced chondrocytes, which indicated that CAPE could prevent the ECM degradation of articular cartilage. In addition, in the model of DMM OA, CAPE mitigated the progression of OA, which was consistent with the results of the in vitro experiments, suggesting that CAPE may be an effective drug for the treatment of OA.

Previous studies have indicated that the NF-κB transcription factor plays a central role in the pathogenesis of OA (52,53). Notably, NF-κB is activated by pro-inflammatory factors, excessive mechanical stresses associated factors and ECM degradation products during the development of OA. NF-κB then promotes the transcription of catabolic genes, including the MMPs and Adamts families, and triggers the expression of pivotal inflammatory factors of OA, including iNOS, COX-2 and PGE2 (16,54). Therefore, the inhibition of NF-κB provides an effective strategy with which to protect cartilage from damage in OA. The results of the present study demonstrated that pre-treatment with CAPE inhibited the translocation of p65 from the cytoplasm to the nucleus in IL-1β-stimulated chondrocytes, indicating that CAPE exerted an anti-inflammatory effect by inhibiting the activation of the NF-κB signaling pathway to protect cartilage from destruction.

NRF2 is a crucial transcription factor that mediates the response to ROS and inflammation (55). The activation of NRF2 has been reported to repress the activity of NF-κB, leading to a decrease in the production of inflammatory factors (56,57). Increasing evidence has indicated that the NRF2/HO-1 signaling pathway plays a pivotal role in the protection of joint cartilage during OA pathogenesis (58). The activation of the NRF2/HO-1 signaling pathway inhibits the production of MMPs and inflammatory factors to reduce the degradation of ECM in OA chondrocytes (19,59,60). A previous study reported that CAPE exerted its anti-inflammatory effects by inducing the activation of the NRF2/HO-1 signaling pathway; CAPE attenuated 2,4,6-trinitrobenzene sulfonic acid-induced colitis via the activation of the NRF2 signaling pathway in the rat inflamed colon (61). CAPE has also been shown to protect the periodontal status, which is attributed to its ability to suppress inflammation through activation of the NRF2/HO-1 signaling pathway and the inhibition of the NF-κB signaling pathway (62). Additionally, CAPE has been found to prevent liver fibrosis via the upregulation of NRF2 (63). In the present study, CAPE reduced the inflammatory response and attenuated the degradation of ECM via the upregulation of NRF2, the activation of the NRF2/HO-1 signaling pathway and the inhibition of the NF-κB signaling pathway. In the physiological state, NRF2 was ubiquitinated by binding with Keap1 in the cytoplasm. Under stimulation, NRF2 dissociates from Keap1 and enters the nucleus to form a coactivator complex, which can improve the driving function (64). Therefore, in the present study, the interaction between CAPE and Keap1/NRF2 complex was analyzed by computational molecular docking. The results of the present study indicated that CAPE interacting with Keap1 led to the release of NRF2 from the Keap1/NRF2 complex, which is essential for NRF2 activation.

Although the effects of CAPE on OA have been analyzed, there are relatively few studies available on its mechanisms of action. In the study by Elmali et al (33), it was reported that CAPE attenuated unilateral anterior cruciate ligament transection-induced cartilage destruction in vivo. In the study by Pichler et al (65), it was found that CAPE reduced the mRNA levels of IL-1β and MMP-13 under treatment with the galectin mixture, Gal-1/-3/-8. As CAPE has been previously described as an effective inhibitor of the NF-κB-dependent expression of Gal-7 in breast cancer cells, Pichler et al (65) hypothesized that the function of CAPE in galectin-induced chondrocytes occurred via the NF-κB signal pathway. However, this was not confirmed experimentally. In the study by Wang et al (66), the role of CAPE in the apoptosis of TNF-α induced chondrocytes and in the expression of MMP-2 and MMP-9 in vitro was investigated. However, they did not fully elucidate the role and related mechanisms of CAPE in OA. Therefore, these studies only simply described the role of CAPE in OA, but did not discuss the mechanisms. The present study investigated the anti-inflammatory effects of CAPE and the anti-degradation of the ECM in IL-1β-stimulated chondrocytes in vitro and in vivo for the first time (to the best of our knowledge), and confirmed experimentally that CAPE participated in OA regulation as an NF-κB inhibitor by regulating the NRF2/HO-1 signaling pathway. Therefore, the findings of the present study are in agreement with those from previous studies (33,65,66), and is comprehensive and novel to a certain extent. However, there are several limitations to the present study. Firstly, the binding between CAPE and the Keap1/NRF2 complex needs to be confirmed by co-immunoprecipitation. In addition, in terms of morphology, the present study only observed the morphology of normal chondrocytes and did not use OA chondrocytes as a positive control. Furthermore, the effects of CAPE need to be tested in NRF2-knockout mice. Therefore, further studies are required to confirm and further elaborate on the present findings.

In conclusion, the present study provided novel insight into the potential protective effects of CAPE in OA. CAPE attenuate IL-1β-induced inflammation and ECM degradation through activation of the NRF2/HO-1 signaling pathway and the inhibition of the NF-κB signaling pathway (Fig. 8C). In addition, the intraperitoneal injection of CAPE ameliorated the degradation of cartilage matrix in vivo. Therefore, CAPE may have potential for use in the treatment of OA.

Supplementary Data

Availability of data and materials

The analyzed data sets generated during the present study are available from the corresponding author on reasonable request.

Authors' contributions

QY and WeiS conceived and designed the experiments. YC, DH, LJ and QH performed the experiments. WeiS, JY and WX conducted the literature search and the processing of the figures. JY, WX, JX, QY and WeichaoS analyzed the data and wrote the manuscript. QY and WeichaoS confirm the authenticity of all the raw data. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

All individuals provided informed consent for the use of human specimens in clinical experiments. The present study was approved by the Ethics Committees of Shenzhen Second People's Hospital (approval no. ethic NO.:20211215005-FS01). The animal protocols and experimental procedures were in agreement with and were approved by the Animal Care and Use Committee of Southwest Medical University (approval no. 20211124-043).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

Funding

The present study was supported by funds from the National Natural Sciences Foundation of China (grant no. 82003126), the Scientific Research Foundation of Southwest Medical University (grant no. 2021ZKMS009), Luzhou Science and Technology Program (grant no. 2021-JYJ-71), the Shenzhen Science and Technology Projects (grant nos. JSGG20191129094218565, JCYJ20190807102601647 and JCYJ20210324103604013), and the Sichuan Science and Technology Program (grant no. 2022NSFSC1368).

References

1 

Martel-Pelletier J, Barr AJ, Cicuttini FM, Conaghan PG, Cooper C, Goldring MB, Goldring SR, Jones G, Teichtahl AJ and Pelletier JP: Osteoarthritis. Nat Rev Dis Primers. 2:160722016. View Article : Google Scholar : PubMed/NCBI

2 

Loeser RF, Goldring SR, Scanzello CR and Goldring MB: Osteoarthritis: A disease of the joint as an organ. Arthritis Rheum. 64:1697–1707. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Bijlsma JW, Berenbaum F and Lafeber FP: Osteoarthritis: An update with relevance for clinical practice. Lancet. 377:2115–2126. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Glyn-Jones S, Palmer AJR, Agricola R, Price AJ, Vincent TL, Weinans H and Carr AJ: Osteoarthritis. Lancet. 386:376–387. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Kapoor M, Martel-Pelletier J, Lajeunesse D, Pelletier JP and Fahmi H: Role of proinflammatory cytokines in the pathophysiology of osteoarthritis. Nat Rev Rheumatol. 7:33–42. 2011. View Article : Google Scholar

6 

Chow YY and Chin KY: The role of inflammation in the pathogenesis of osteoarthritis. Mediators Inflamm. 2020:82939212020. View Article : Google Scholar : PubMed/NCBI

7 

Yang B, Kang X, Xing Y, Dou C, Kang F, Li J, Quan Y and Dong S: Effect of microRNA-145 on IL-1beta-induced cartilage degradation in human chondrocytes. FEBS Lett. 588:2344–2352. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Eymard F, Pigenet A, Citadelle D, Flouzat-Lachaniette CH, Poignard A, Benelli C, Berenbaum F, Chevalier X and Houard X: Induction of an inflammatory and prodegradative phenotype in autologous fibroblast-like synoviocytes by the infrapatellar fat pad from patients with knee osteoarthritis. Arthritis Rheumatol. 66:2165–2174. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Tu C, Huang X, Xiao Y, Song M, Ma Y, Yan J, You H and Wu H: Schisandrin A inhibits the IL-1β-induced inflammation and cartilage degradation via suppression of MAPK and NF-κB signal pathways in rat chondrocytes. Front Pharmacol. 10:412019. View Article : Google Scholar

10 

Chabane N, Zayed N, Afif H, Mfuna-Endam L, Benderdour M, Boileau C, Martel-Pelletier J, Pelletier JP, Duval N and Fahmi H: Histone deacetylase inhibitors suppress interleukin-1beta-induced nitric oxide and prostaglandin E2 production in human chondrocytes. Osteoarthritis Cartilage. 16:1267–1274. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Khan NM, Haseeb A, Ansari MY, Devarapalli P, Haynie S and Haqqi TM: Wogonin, a plant derived small molecule, exerts potent anti-inflammatory and chondroprotective effects through the activation of ROS/ERK/Nrf2 signaling pathways in human Osteoarthritis chondrocytes. Free Radic Biol Med. 106:288–301. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Shuai C, Liu G, Yang Y, Qi F, Peng S, Yang W, He C, Wang G and Qian G: A strawberry-like Ag-decorated barium titanate enhances piezoelectric and antibacterial activities of polymer scaffold. Nano Energy. 74:1048252020. View Article : Google Scholar

13 

Shuai C, Xu Y, Feng P, Wang G, Xiong S and Peng S: Antibacterial polymer scaffold based on mesoporous bioactive glass loaded with in situ grown silver. Chemical Engineering J. 374:304–315. 2019. View Article : Google Scholar

14 

Wu H, Zhang M, Li W, Zhu S and Zhang D: Stachydrine attenuates IL-1beta-induced inflammatory response in osteoarthritis chondrocytes through the NF-κB signaling pathway. Chem Biol Interact. 326:1091362020. View Article : Google Scholar

15 

Hu X, Li R, Sun M, Kong Y, Zhu H, Wang F and Wan Q: Isovitexin depresses osteoarthritis progression via the Nrf2/NF-kappaB pathway: An in vitro study. J Inflamm Res. 14:1403–1414. 2021. View Article : Google Scholar :

16 

Rigoglou S and Papavassiliou AG: The NF-κB signalling pathway in osteoarthritis. Int J Biochem Cell Biol. 45:2580–2584. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Zeng J, Chen Y, Ding R, Feng L, Fu Z, Yang S, Deng X, Xie Z and Zheng S: Isoliquiritigenin alleviates early brain injury after experimental intracerebral hemorrhage via suppressing ROS- and/or NF-κB-mediated NLRP3 inflammasome activation by promoting Nrf2 antioxidant pathway. J Neuroinflammation. 14:1192017. View Article : Google Scholar

18 

Saha S, Buttari B, Panieri E, Profumo E and Saso L: An overview of Nrf2 signaling pathway and its role in inflammation. Molecules. 25:54742020. View Article : Google Scholar :

19 

Khan NM, Ahmad I and Haqqi TM: Nrf2/ARE pathway attenuates oxidative and apoptotic response in human osteoarthritis chondrocytes by activating ERK1/2/ELK1-P70S6K-P90RSK signaling axis. Free Radic Biol Med. 116:159–171. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Shao Z, Pan Z, Lin J, Zhao Q, Wang Y, Ni L, Feng S, Tian N, Wu Y, Sun L, et al: S-allyl cysteine reduces osteoarthritis pathology in the tert-butyl hydroperoxide-treated chondrocytes and the destabilization of the medial meniscus model mice via the Nrf2 signaling pathway. Aging (Albany NY). 12:19254–19272. 2020. View Article : Google Scholar

21 

Cai D, Yin S, Yang J, Jiang Q and Cao W: Histone deacetylase inhibition activates Nrf2 and protects against osteoarthritis. Arthritis Res Ther. 17:2692015. View Article : Google Scholar : PubMed/NCBI

22 

Wu J, Omene C, Karkoszka J, Bosland M, Eckard J, Klein CB and Frenkel K: Caffeic acid phenethyl ester (CAPE), derived from a honeybee product propolis, exhibits a diversity of anti-tumor effects in pre-clinical models of human breast cancer. Cancer Lett. 308:43–53. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Murtaza G, Karim S, Akram MR, Khan SA, Azhar S, Mumtaz A and Asad MHH: Caffeic acid phenethyl ester and therapeutic potentials. Biomed Res Int. 2014:1453422014. View Article : Google Scholar : PubMed/NCBI

24 

Tolba MF, Omar HA, Azab SS, Khalifa AE, Abdel-Naim AB and Abdel-Rahman SZ: Caffeic acid phenethyl ester: A review of its antioxidant activity, protective effects against ischemiareperfusion injury and drug adverse reactions. Crit Rev Food Sci Nutr. 56:2183–2190. 2016. View Article : Google Scholar

25 

Hao R, Song X, Li F, Tan X, Sun-Waterhouse D and Li D: Caffeic acid phenethyl ester reversed cadmium-induced cell death in hippocampus and cortex and subsequent cognitive disorders in mice: Involvements of AMPK/SIRT1 pathway and amyloid-tau-neuroinflammation axis. Food Chem Toxicol. 144:1116362020. View Article : Google Scholar : PubMed/NCBI

26 

Liu M, Li F, Huang Y, Zhou T, Chen S, Li G, Shi J, Dong N and Xu K: Caffeic acid phenethyl ester ameliorates calcification by inhibiting activation of the AKT/NF-kappaB/NLRP3 inflammasome pathway in human aortic valve interstitial cells. Front Pharmacol. 11:8262020. View Article : Google Scholar

27 

Lee HE, Yang G, Kim ND, Jeong S, Jung Y, Choi JY, Park HH and Lee JY: Targeting ASC in NLRP3 inflammasome by caffeic acid phenethyl ester: A novel strategy to treat acute gout. Sci Rep. 6:386222016. View Article : Google Scholar : PubMed/NCBI

28 

Natarajan K, Singh S, Burke TR Jr, Grunberger D and Aggarwal BB: Caffeic acid phenethyl ester is a potent and specific inhibitor of activation of nuclear transcription factor NF-kappa B. Proc Natl Acad Sci USA. 93:9090–9095. 1996. View Article : Google Scholar : PubMed/NCBI

29 

Liang Y, Feng G, Wu L, Zhong S, Gao X, Tong Y, Cui W, Qin Y, Xu W, Xiao X, et al: Caffeic acid phenethyl ester suppressed growth and metastasis of nasopharyngeal carcinoma cells by inactivating the NF-κB pathway. Drug Des Devel Ther. 13:1335–1345. 2019. View Article : Google Scholar :

30 

Lim KM, Bae S, Koo JE, Kim ES, Bae ON and Lee JY: Suppression of skin inflammation in keratinocytes and acute/chronic disease models by caffeic acid phenethyl ester. Arch Dermatol Res. 307:219–227. 2015. View Article : Google Scholar

31 

Morroni F, Sita G, Graziosi A, Turrini E, Fimognari C, Tarozzi A and Hrelia P: Neuroprotective effect of caffeic acid phenethyl ester in A mouse model of Alzheimer's disease involves Nrf2/HO-1 pathway. Aging Dis. 9:605–622. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Khan MN, Lane ME, McCarron PA and Tambuwala MM: Caffeic acid phenethyl ester is protective in experimental ulcerative colitis via reduction in levels of pro-inflammatory mediators and enhancement of epithelial barrier function. Inflammopharmacology. 26:561–569. 2018. View Article : Google Scholar :

33 

Elmali N, Ayan I, Türköz Y, Mizrak B, Germen B and Bora A: Effect of caffeic acid phenethyl ester on cartilage in experimental osteoarthritis. Rheumatol Int. 22:222–226. 2002. View Article : Google Scholar : PubMed/NCBI

34 

Lu H, Fu C, Kong S, Wang X, Sun L, Lin Z, Luo P and Jin H: Maltol prevents the progression of osteoarthritis by targeting PI3K/Akt/NF-κB pathway: In vitro and in vivo studies. J Cell Mol Med. 25:499–509. 2021. View Article : Google Scholar

35 

Glasson SS, Blanchet TJ and Morris EA: The surgical destabilization of the medial meniscus (DMM) model of osteoarthritis in the 129/SvEv mouse. Osteoarthritis Cartilage. 15:1061–1069. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

37 

Glasson SS, Chambers MG, Van Den Berg WB and Little CB: The OARSI histopathology initiative-recommendations for histological assessments of osteoarthritis in the mouse. Osteoarthritis Cartilage. 18(Suppl 3): pp. S17–S23. 2010, View Article : Google Scholar

38 

Gu M, Jin J, Ren C, Chen X, Gao W, Wang X, Wu Y, Tian N, Pan Z, Wu A, et al: Akebia Saponin D suppresses inflammation in chondrocytes via the NRF2/HO-1/NF-κB axis and ameliorates osteoarthritis in mice. Food Funct. 11:10852–10863. 2020. View Article : Google Scholar : PubMed/NCBI

39 

da Costa BR, Reichenbach S, Keller N, Nartey L, Wandel S, Jüni P and Trelle S: Effectiveness of non-steroidal anti-inflammatory drugs for the treatment of pain in knee and hip osteoarthritis: A network meta-analysis. Lancet. 390:e21–e33. 2017. View Article : Google Scholar : PubMed/NCBI

40 

Berenbaum F: Osteoarthritis as an inflammatory disease (osteoarthritis is not osteoarthrosis!). Osteoarthritis Cartilage. 21:16–21. 2013. View Article : Google Scholar

41 

Deligiannidou GE, Papadopoulos RE, Kontogiorgis C, Detsi A, Bezirtzoglou E and Constantinides T: Unraveling natural products' role in osteoarthritis management-an overview. Antioxidants (Basel). 9:3482020. View Article : Google Scholar

42 

Balaha M, Filippis BD, Cataldi A and di Giacomo V: CAPE and neuroprotection: A review. Biomolecules. 11:1762021. View Article : Google Scholar : PubMed/NCBI

43 

Menezes da Silveira CCS, Luz DA, da Silva CCS, Prediger RDS, Martins MD, Martins MAT, Fontes-Júnior EA and Maia CSF: Propolis: A useful agent on psychiatric and neurological disorders? A focus on CAPE and pinocembrin components. Med Res Rev. 41:1195–1215. 2021. View Article : Google Scholar

44 

Murtaza G, Sajjad A, Mehmood Z, Shah SH and Siddiqi AR: Possible molecular targets for therapeutic applications of caffeic acid phenethyl ester in inflammation and cancer. J Food Drug Anal. 23:11–18. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Liu-Bryan R and Terkeltaub R: Emerging regulators of the inflammatory process in osteoarthritis. Nat Rev Rheumatol. 11:35–44. 2015. View Article : Google Scholar :

46 

Toyoda T, Tsukamoto T, Takasu S, Shi L, Hirano N, Ban H, Kumagai T and Tatematsu M: Anti-inflammatory effects of caffeic acid phenethyl ester (CAPE), a nuclear factor-kappaB inhibitor, on Helicobacter pylori-induced gastritis in Mongolian gerbils. Int J Cancer. 125:1786–1795. 2009. View Article : Google Scholar : PubMed/NCBI

47 

Dai G, Jiang Z, Sun B, Liu C, Meng Q, Ding K, Jing W and Ju W: Caffeic acid phenethyl ester prevents colitis-associated cancer by inhibiting NLRP3 inflammasome. Front Oncol. 10:7212020. View Article : Google Scholar : PubMed/NCBI

48 

Guilak F, Nims RJ, Dicks A, Wu CL and Meulenbelt I: Osteoarthritis as a disease of the cartilage pericellular matrix. Matrix Biol. 71-72:40–50. 2018. View Article : Google Scholar : PubMed/NCBI

49 

Lu G, Li L, Wang B and Kuang L: LINC00623/miR-101/HRAS axis modulates IL-1β-mediated ECM degradation, apoptosis and senescence of osteoarthritis chondrocytes. Aging (Albany NY). 12:3218–3237. 2020. View Article : Google Scholar

50 

Boehme KA and Rolauffs B: Onset and progression of human osteoarthritis-can growth factors, inflammatory cytokines, or differential mirna expression concomitantly induce proliferation, ECM degradation, and inflammation in articular cartilage? Int J Mol Sci. 19:22822018. View Article : Google Scholar

51 

Rahmati M, Nalesso G, Mobasheri A and Mozafari M: Aging and osteoarthritis: Central role of the extracellular matrix. Ageing Res Rev. 40:20–30. 2017. View Article : Google Scholar : PubMed/NCBI

52 

Choi MC, Jo J, Park J, Kang HK and Park Y: NF-κB signaling pathways in osteoarthritic cartilage destruction. Cells. 8:7342019. View Article : Google Scholar

53 

Lepetsos P, Papavassiliou KA and Papavassiliou AG: Redox and NF-κB signaling in osteoarthritis. Free Radic Biol Med. 132:90–100. 2019. View Article : Google Scholar

54 

Saito T and Tanaka S: Molecular mechanisms underlying osteoarthritis development: Notch and NF-κB. Arthritis Res Ther. 19:942017. View Article : Google Scholar

55 

Tonelli C, Chio IIC and Tuveson DA: Transcriptional regulation by Nrf2. Antioxid Redox Signal. 29:1727–1745. 2018. View Article : Google Scholar :

56 

Sivandzade F, Prasad S, Bhalerao A and Cucullo L: NRF2 and NF-B interplay in cerebrovascular and neurodegenerative disorders: Molecular mechanisms and possible therapeutic approaches. Redox Biol. 21:1010592019. View Article : Google Scholar

57 

Lee Y, Shin DH, Kim JH, Hong S, Choi D, Kim YJ, Kwak MK and Jung Y: Caffeic acid phenethyl ester-mediated Nrf2 activation and IkappaB kinase inhibition are involved in NFkappaB inhibitory effect: Structural analysis for NFkappaB inhibition. Eur J Pharmacol. 643:21–28. 2010. View Article : Google Scholar : PubMed/NCBI

58 

Alcaraz MJ and Ferrandiz ML: Relevance of Nrf2 and heme oxygenase-1 in articular diseases. Free Radic Biol Med. 157:83–93. 2020. View Article : Google Scholar

59 

Chen X, Huang C, Sun H, Hong H, Jin J, Bei C, Lu Z and Zhang X: Puerarin suppresses inflammation and ECM degradation through Nrf2/HO-1 axis in chondrocytes and alleviates pain symptom in osteoarthritic mice. Food Funct. 12:2075–2089. 2021. View Article : Google Scholar : PubMed/NCBI

60 

Li JW, Wang RL, Xu J, Sun KY, Jiang HM, Sun ZY, Lv ZY, Xu XQ, Wu R, Guo H, et al: Methylene blue prevents osteoarthritis progression and relieves pain in rats via upregulation of Nrf2/PRDX1. Acta Pharmacol Sin. 43:417–428. 2022. View Article : Google Scholar :

61 

Kim H, Kim W, Yum S, Hong S, Oh JE, Lee JW, Kwak MK, Park EJ, Na DH and Jung Y: Caffeic acid phenethyl ester activation of Nrf2 pathway is enhanced under oxidative state: Structural analysis and potential as a pathologically targeted therapeutic agent in treatment of colonic inflammation. Free Radic Biol Med. 65:552–562. 2013. View Article : Google Scholar : PubMed/NCBI

62 

Stahli A, Maheen CU, Strauss FJ, Eick S, Sculean A and Gruber R: Caffeic acid phenethyl ester protects against oxidative stress and dampens inflammation via heme oxygenase 1. Int J Oral Sci. 11:62019. View Article : Google Scholar : PubMed/NCBI

63 

Li M, Wang XF, Shi JJ, Li YP, Yang N, Zhai S and Dang SS: Caffeic acid phenethyl ester inhibits liver fibrosis in rats. World J Gastroenterol. 21:3893–3903. 2015. View Article : Google Scholar : PubMed/NCBI

64 

Bellezza I, Giambanco I, Minelli A and Donato R: Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim Biophys Acta Mol Cell Res. 1865:721–733. 2018. View Article : Google Scholar : PubMed/NCBI

65 

Pichler KM, Weinmann D, Schmidt S, Kubista B, Lass R, Martelanz L, Alphonsus J, Windhager R, Gabius HJ and Toegel S: The dysregulated galectin network activates nf-kappaB to induce disease markers and matrix degeneration in 3D pellet cultures of osteoarthritic chondrocytes. Calcif Tissue Int. 108:377–390. 2021. View Article : Google Scholar

66 

Wang Y, Li DL, Zhang XB, Duan YH, Wu ZH, Hao DS, Chen BS and Qiu GX: Increase of TNFalpha-stimulated osteoarthritic chondrocytes apoptosis and decrease of matrix metalloproteinases 9 by NF-κB inhibition. Biomed Environ Sci. 26:277–283. 2013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sun W, Xie W, Huang D, Cui Y, Yue J, He Q, Jiang L, Xiong J, Sun W, Yi Q, Yi Q, et al: Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway. Int J Mol Med 50: 134, 2022.
APA
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q. ... Yi, Q. (2022). Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway. International Journal of Molecular Medicine, 50, 134. https://doi.org/10.3892/ijmm.2022.5190
MLA
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q., Jiang, L., Xiong, J., Sun, W., Yi, Q."Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway". International Journal of Molecular Medicine 50.5 (2022): 134.
Chicago
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q., Jiang, L., Xiong, J., Sun, W., Yi, Q."Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway". International Journal of Molecular Medicine 50, no. 5 (2022): 134. https://doi.org/10.3892/ijmm.2022.5190
Copy and paste a formatted citation
x
Spandidos Publications style
Sun W, Xie W, Huang D, Cui Y, Yue J, He Q, Jiang L, Xiong J, Sun W, Yi Q, Yi Q, et al: Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway. Int J Mol Med 50: 134, 2022.
APA
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q. ... Yi, Q. (2022). Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway. International Journal of Molecular Medicine, 50, 134. https://doi.org/10.3892/ijmm.2022.5190
MLA
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q., Jiang, L., Xiong, J., Sun, W., Yi, Q."Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway". International Journal of Molecular Medicine 50.5 (2022): 134.
Chicago
Sun, W., Xie, W., Huang, D., Cui, Y., Yue, J., He, Q., Jiang, L., Xiong, J., Sun, W., Yi, Q."Caffeic acid phenethyl ester attenuates osteoarthritis progression by activating NRF2/HO‑1 and inhibiting the NF‑κB signaling pathway". International Journal of Molecular Medicine 50, no. 5 (2022): 134. https://doi.org/10.3892/ijmm.2022.5190
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team