Role of Nogo‑A in the regulation of hepatocellular carcinoma SMMC‑7721 cell apoptosis
- Authors:
- Published online on: March 13, 2014 https://doi.org/10.3892/mmr.2014.2050
- Pages: 1743-1748
Abstract
Introduction
Nogo-A, a myelin-associated endoplasmic reticulum protein, is encoded by the reticulon-4 (RTN4) gene located at chromosome 2p13-14 (1). The human RTN4 gene encodes three alternatively spliced variants, Nogo-A, Nogo-B and Nogo-C. Nogo-A is the largest Nogo isoform, which exhibits a unique N-terminal extension and is mainly expressed by oligodendrocytes in the brain. By contrast, Nogo-B demonstrates a ubiquitous pattern of expression and Nogo-C is highly expressed in skeletal muscles (2,3). The three Nogo isoforms share a common C-terminal domain of 188 amino acids, which contains two putative transmembrane domains and an endoplasmic reticulum retention motif (4). In vitro studies have reported that Nogo-A contributes to the axonal growth inhibitory function of central myelin; however, there have been contradictory results regarding this growth inhibitory effect in Nogo-A knockout mice (5,6). Whilst the role of Nogo-A in the nervous system is well established, including activation of growth cone collapse, axonal outgrowth inhibition and synaptic plasticity (7–9), the role of endogenous Nogo-A in non-neural systems is yet to be elucidated.
Hepatocellular carcinoma (HCC) is the most common primary malignant tumor and accounts for ~5.6% of all tumors (10). As a result of the poor prognosis associated with HCC, a high mortality rate is observed among patients with the tumor. Therefore, exploring the molecular mechanisms associated with HCC and developing more effective targeted therapies are of utmost importance. The Arg114Gly mutation in the Nogo-C gene, which affects the dimensional structure of the Nogo-66 domain, was observed to promote apoptosis in a liver cancer cell line (11). The Nogo-66 domain has been identified as a conserved functional group among the three Nogo isoforms; therefore, it is hypothesized that Nogo-A may have a role in HCC.
The present study aimed to explore the role of the neural-associated Nogo-A gene in liver cancer cells. Nogo-A was observed to exhibit high expression in the HCC SMMC-7721 cell line. Furthermore, a novel lentivirus vector that mediated RNA interference (RNAi) targeting of Nogo-A (LV-Nogo-A-siRNA) was employed to study the effect of Nogo-A knockdown on SMMC-7721 cell growth in vitro.
Materials and methods
Cell culture
The human liver cancer cell lines HepG2, Huh-7, BEL-7402 and SMMC-7721 (Shanghai GeneChem Co., Shanghai, China) were maintained in Dulbecco’s modified Eagle medium (DMEM; Gibco-BRL, Grand Island, NY, USA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS; Gibco-BRL) at 37°C with 5% CO2.
Construction of lentiviral vectors, and preparation and transduction of the lentivirus
The complementary DNA sequence of Nogo-A was designed from full-length Nogo-A by Shanghai GeneChem Co., Ltd. The sequence of the small interfering RNA (siRNA) targeting Nogo-A was as follows: ccggGC TATATCTGAGGAGTTGGTTTTCAAGAGAACCAACTC CTCAGATATAGCTTTTTgaatt. Following the testing of knockdown efficiencies, stem-loop oligonucleotides were synthesized and cloned into the lentivirus-based vector, pGCSIL-enhanced green fluorescence protein (eGFP). A non-targeting stem-loop DNA was generated as a negative control. An improved lentivirus system of pGC-LV was developed by Shanghai GeneChem Co, Ltd. This system consisted of the following plasmids: pHELPER1.0, a packaging plasmid in which the accessory genes, vif, vpr, vpu and nef, and a regulatory gene, tat, were deleted; pHELPER2.0, an envelope plasmid for vesicular stomatitis virus G glycoprotein (VSV-G); and pGCSIL-eGFP, a transferring plasmid with a multiple cloning site and the gene encoding eGFP (Fig. 1A).
The recombinant Nogo-A-siRNA lentivirus vector was generated using co-transfection of 293T cells with 20 μg pGCSIL-Nogo-A-siRNA-eGFP, 15 μg pHELPER1.0, 10 μg pHELPER2.0 and Opti-MEM® (Invitrogen Life Technologies, Carlsbad, CA, USA) of the same volume in 15-cm dishes with Lipofectamine® 2000 (Invitrogen Life Technologies). The 293T cells were cultured in DMEM containing 10% FBS. Culture supernatants were collected after two days, filtered through a 0.45-μm pore size filter and concentrated using Centricon® Plus-20 (Millipore Corporation, Hayward, CA, USA). The viral filtrate was collected and stored at −80°C.
Cells were incubated with the lentivirus in a small volume of serum-free DMEM at 37°C for 4 h. Medium was then replaced with DMEM containing 10% FBS, and cells were cultured further as indicated for the following experiments. eGFP revealed that the infection efficiency in SMMC-7721 cells was ~90% and at a multiplicity of infection (MOI) of 30. No viral toxicity was observed at this concentration in the SMMC-7721 cells; therefore, the following experiments were performed using viruses at such MOIs, unless indicated. The lentivirus package with eGFP was used for the cell proliferation assay, and that without eGFP was used for the cell apoptosis assay.
Western blot analysis of exogenous flag-Nogo-A expression
To assess the gene knockdown efficiency of Nogo-A-siRNA, an exogenous 3flag-Nogo-A fusion protein was constructed into a GV143 vector (Shanghai GeneChem Co.). The constructed 3flag-Nogo-A vector was co-transfected with pGCSIL-Nogo-A-siRNA-eGFP or pGCSIL-scr-siRNA-eGFP, respectively, into 293T cells. The transfection ratio was estimated using fluorescence microscopy. Total proteins were extracted 48 h following transfection and the protein was quantified using the Coomassie brilliant blue assay. Subsequently, 20 μg protein was boiled in loading buffer, separated on 10% SDS-polyacrylamide gels, electro-transferred to polyvinylidene fluoride (PVDF) membranes and probed with mouse anti-flag (Sigma Aldrich, St. Louis, MO, USA) and mouse anti-GAPDH (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) antibodies overnight at dilutions of 1:3,000 and 1:5,000 respectively. Membranes were then incubated with a goat anti-mouse immunoglobulin G (IgG) peroxidase-conjugated secondary antibody (Santa-Cruz Biotechnology, Inc., 1:5,000), prior to development using the Amersham enhanced chemiluminescence (ECL) plus western blotting detection system (Amersham Pharmacia Biotech, Piscataway, NJ, USA).
RNA isolation and quantitative polymerase chain reaction (qPCR) analysis
Total RNA was extracted using TRIzol® reagent (Invitrogen Life Technologies) in accordance with the manufacturer’s instructions. A total of 2 μg RNA was subjected to reverse transcription. The PCR primer sequences were as follows: GAPDH, 5′-TGACTTCAACAGCGACAC CCA-3′ (forward) and 5′-CACCCTGTTGCTGTAGCCAAA-3′ (reverse); Nogo-A, 5′-AGGAGCAGCCAGGTAACAC-3′ (forward) and 5′-GAGACAGAGAAGGAAGAGAAGC-3′ (reverse), as described previously (11). PCR products were separated on a 1% agarose gel, and visualized and photographed under ultraviolet light for semi-quantitation.
Cell growth assay
The cell growth rate was determined using the Cellomics® ArrayScan® VTI machine (Thermo Fisher Scientific, San Jose, CA, USA). Cells were transduced with lentivirus vectors for 72 h, prior to being seeded into flat-bottom 96-well plates at 2,000 cells per well. Cells were observed at one, two, three, four and five days using the Cellomics ArrayScan VTI machine. In the Cellomics ArrayScan VTI system (Thermo Fisher Scientific), an automated inverted epifluorescence microscope was used to record images from multiple fields in each individual well. Fluorescence images were acquired using a high-resolution charge-coupled device (CCD) camera. Cells were identified based on the presence of valid nuclei and cell body measurements, determined by analyzing size, shape and eGFP fluorescence intensity. Images were then analyzed using the Cellomics software and cells were counted (12). Cell growth curves were generated following three experimental repeats.
Colony formation assay
The Cellomics ArrayScan VTI system was used to perform colony formation assays to assess the anchorage-independent growth ability of cells as a characteristic of in vitro tumorigenicity. SMMC-7721 cells were infected with the virus for 24 h, then detached using Trypsin (Chemreagent, Shanghai, China) and plated in 96-well plates at 500 cells/well. The number of foci (>100 μm) was counted after 14 days. Each experiment was performed in triplicate.
Flow cytometric analysis
Flow cytometric analysis was performed to determine the distribution of cells throughout the cell cycle and those undergoing apoptosis, and was performed as described previously (13). SMMC-7721 cells were seeded and transduced with lentivirus vectors and then cultured for 96 h in complete medium. Following one wash with Hanks’ balanced salt solution (Sigma Aldrich) adherent cells were detached using trypsin, and cells were washed once with ice cooled phosphate-buffered saline (PBS). Prior to analysis, the transduction efficiency and cell death rate were estimated using a fluorescence microscope. Cells with >90% transduction efficiency and <1% death rate were used for the subsequent fluorescence-activated cell sorting (FACS) analysis.
For analysis of apoptosis, cells were washed with 1X binding buffer before 1×106–1×107 cells were pelleted and resuspended in 1 ml 1X staining buffer. A total of 100 μl of the cell suspension was added to 5 μl Annexin V-allophycocyanin (APC) and incubated in the dark at room temperature for 10–15 min. Data from ≥10,000 cells were collected and analyzed using CellQuest software (Becton Dickinson, San Diego, CA, USA). The apoptosis ratio was calculated as the number of apoptotic cells/total number of cells.
For cell cycle analysis, cells were fixed using 0.5 ml 70% iced alcohol and incubated at 4°C for 1 h, prior to being washed once with ice cooled PBS. The cell pellet was resuspended with staining buffer at 4°C for 30 min [40× 2 mg/ml propidium iodide (PI): 100× 10 mg/ml RNase: 1X PBS=25:10:1,000]. The suspension was filtered through a 50-μm nylon mesh, and flow cytometry was used to analyze the DNA content of the stained nuclei with a BD FACSCalibur machine (Becton Dickinson). Cell cycle distribution was assessed using Multicycle cell cycle analysis software (Phoenix Flow Systems, San Diego, CA, USA).
Statistical analysis
Each experiment was repeated at least three times. Bands from western blot analysis or qPCR were quantified using Quantity One® software (Bio-Rad Laboratories Inc., Berkley, CA, USA). Relative protein or mRNA levels were calculated using GAPDH as a normalization control. T-test analysis was performed to determine the significance of the differences between means. All statistical analyses were performed using Excel 2003 software (Microsoft, Redmond, WA, USA). A value of P<0.05 was considered to indicate a statistically significant difference.
Results
Expression of Nogo-A in liver cancer cell lines
To determine the expression of Nogo-A in different liver cancer cell lines, qPCR analysis was performed. As shown in Fig. 2, Nogo-A expression was observed in four different liver cancer cell lines.
Effect of RNAi targeting Nogo-A on Nogo-A expression using the LV-Nogo-A-siRNA lentivirus vector
To examine the interrelation between Nogo-A and liver cancer cells, a lentivirus-delivered Nogo-A-specific siRNA vector (LV-Nogo-A-siRNA) and a negative control scramble-siRNA vector (LV-scr-siRNA) were constructed. The two vectors were then respectively transduced into SMMC-7721 cells for three days. qPCR and western blot analyses demonstrated that the level of Nogo-A expression was lower in SMMC-7721/Nogo-A-siRNA cells than in SMMC-7721/scr-siRNA cells (P<0.001). Furthermore, Nogo-A-siRNA was also observed to knockdown expression of exogenous 3flag-Nogo-A (Fig. 3). These data show that the constructed recombinant lentiviral vector of Nogo-A-siRNA is capable of efficiently downregulating endogenous and exogenous Nogo-A expression in SMMC-7721 cells.
Depletion of Nogo-A inhibits cell growth
The present study further investigated the effect of Nogo-A siRNA treatment on SMMC-7721 cell viability. As shown in Fig. 4, the growth of SMMC-7721 cells treated with Nogo-A siRNA was significantly inhibited compared with those treated with scr-siRNA (Fig. 4A and B). This growth inhibitory effect was also confirmed by colony formation assay, which demonstrated that LV-Nogo-A-siRNA transfection significantly decreased the number and size of SMMC-7721 cell colonies (Fig. 4C and D). These data indicate that knockdown of Nogo-A is capable of inhibiting proliferation in the HCC SMMC-7721 cell line. Furthermore, the effect of Nogo-A depletion was assessed in three other cancer cell lines: H1299, RKO and SKOV3. Compared with the scr-siRNA, Nogo-A siRNA was not observed to significantly inhibit growth in these cancer cell lines (data not shown). These results suggested that the growth inhibitory effect of Nogo-A siRNA may be liver cancer-specific.
Cell cycle arrest in G2/M phase by LV-Nogo-A siRNA in SMMC-7721 cells
Experiments were also performed to assess the role of the cell cycle in mediating the anti-proliferative effects of Nogo-A inhibition in SMMC-7721 cells. Cell cycle distribution was analyzed at 96 h following siRNA transduction, using flow cytometry. Cell cycle analysis revealed that inhibition of Nogo-A expression using siRNA caused a significant increase in the proportion of the cell population in G2/M phase compared with that of the control population transduced with scr-siRNA (Fig. 5A; P=0.0014). These data indicate that knockdown of Nogo-A expression is capable of inducing G2/M arrest in SMMC-7721 cells.
Induction of apoptosis by LV-Nogo-A siRNA in SMMC-7721 cells
To determine whether Nogo-A depletion is capable of inducing apoptosis in SMMC-7721 cells, flow cytometric analysis was performed 96 h following siRNA transduction (Fig. 5B). Apoptosis was observed in 24.7% of the SMMC-7721 cells transduced with Nogo-A-siRNA compared with 7.6% of the control cells transduced with scr-siRNA (P=0.004). Since the transduction efficiency was >90%, these data suggest that knockdown of Nogo-A expression promotes an increase in apoptosis in the HCC SMMC-7721 cell line.
Discussion
Liver cancer is associated with the highest mortality rate among all types of cancer. However, even when diagnosed early, few patients represent candidates for surgery, due the high likelihood of HCC cell relapse and metastasis following surgery. Therefore, the development of novel therapies for the treatment of liver cancer is of great importance. It has been previously reported that Nogo-A has a significant role in the development of myelin and other central nervous tissues (4,9). Numerous studies have suggested that the Nogo-A, Nogo-B and Nogo-C isoforms have a role in apoptosis, particularly in cancer cells (14–16). This study has presented the Nogo-A expression profile in four liver cancer cell lines, and has investigated the inhibitory effect of endogenous Nogo-A on HCC SMMC-7721 cells using an improved lentivirus packaging system.
Lentivirus vectors, which integrate their complementary DNA (cDNA) into dividing and non-dividing cells, are capable of permanently integrating into their target cells (17). In comparison with the small hairpin RNA (shRNA) expression vector systems, whose transduction efficiency and transient shRNA expression are low (18), lentivirus-delivered siRNAs are capable of specific, highly stable and functional silencing of gene expression in a variety of human cells (19). This study employed an improved lentivirus vector with a deletion of the U3 region, including the TATA box, of the 3′ long terminal repeat (LTR), which deactivated the LTR promoter and significantly enhanced the safety level of transgene expression. Using this lentivirus system, a lentivirus vector that mediated RNAi targeting of Nogo-A (LV-Nogo-A-siRNA) was constructed, and was observed to effectively and specifically downregulate Nogo-A expression in SMMC-7721 cells by ≤90%.
The proliferation of SMMC-7721 cells was observed to be markedly reduced following infection with LV-Nogo-A-siRNA for 72 h. Furthermore, the growth inhibitory effect associated with LV-Nogo-A-siRNA infection was identified as being SMMC-7721 cell-specific. Moreover, the present study revealed that Nogo-A depletion may achieve such growth inhibition by arresting the SMMC-7721 cells in the G2/M phase of the cell cycle and consequently promoting apoptosis. These results are in accordance with the findings of Sutendra et al (20), who suggested that the absence of Nogo-B may increase the susceptibility of pulmonary arterial smooth muscle cells to apoptosis.
Contrary to the findings of the present study, Chen et al (14) observed that the overexpression of mutant Nogo-C was capable of inducing apoptosis in HCC SMMC-7721 cells. Among the three Nogo isoforms, Nogo-C is the shortest, while Nogo-A is the longest. These conflicting findings suggest that the exogenous mutant Nogo-C may be capable of antagonizing endogenous Nogo-A, thereby reducing the activity of Nogo-A and increasing apoptosis. Further evidence is required to verify this hypothesis.
In conclusion, the present study found that Nogo-A depletion was capable of inhibiting HCC SMMC-7721 cell proliferation by promoting G2/M cell cycle arrest and apoptosis. To the best of our knowledge, this is the first investigation into the effect of endogenous Nogo-A in a liver cancer cell line. The present findings suggest that Nogo-A may represent an effective molecular target for the therapeutic treatment of liver cancer, in addition to its significant roles in neural systems.
Acknowledgements
The authors would like to thank Professor Krzysztof Trzciński and Dr. Bing-Jun Qian for their generous assistance and editing skills. This study was supported by the 973 Program (no. 2012CB910100) to CLW, the National Nature Science Foundation of China (no. 31101015) and the Scientific Research Foundation for the Returned Overseas Chinese Scholars to LC, State Education Ministry (no. 12Z102050009).
References
Yang J, Yu L, Bi AD and Zhao SY: Assignment of the human reticulon 4 gene (RTN4) to chromosome 2p14-->2p13 by radiation hybrid mapping. Cytogenet Cell Genet. 88:101–102. 2000. View Article : Google Scholar : PubMed/NCBI | |
GrandPré T, Nakamura F, Vartanian T and Strittmatter SM: Identification of the Nogo inhibitor of axon regeneration as a Reticulon protein. Nature. 403:439–444. 2000.PubMed/NCBI | |
Woolf CJ: No Nogo: now where to go? Neuron. 38:153–156. 2003. View Article : Google Scholar : PubMed/NCBI | |
Chen MS, Huber AB, van der Haar ME, et al: Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1. Nature. 403:434–439. 2000. View Article : Google Scholar : PubMed/NCBI | |
Zheng B, Ho C, Li S, Keirstead H, Steward O and Tessier-Lavigne M: Lack of enhanced spinal regeneration in Nogo-deficient mice. Neuron. 38:213–224. 2003. View Article : Google Scholar : PubMed/NCBI | |
Kim JE, Li S, GrandPré T, Qiu D and Strittmatter SM: Axon regeneration in young adult mice lacking Nogo-A/B. Neuron. 38:187–199. 2003. View Article : Google Scholar : PubMed/NCBI | |
Fournier AE, GrandPré T and Strittmatter SM: Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration. Nature. 409:341–346. 2001. View Article : Google Scholar : PubMed/NCBI | |
Xie F and Zheng B: White matter inhibitors in CNS axon regeneration failure. Exp Neurol. 209:302–312. 2008. View Article : Google Scholar : PubMed/NCBI | |
McGee AW, Yang Y, Fischer QS, Daw NW and Strittmatter SM: Experience-driven plasticity of visual cortex limited by myelin and Nogo receptor. Science. 309:2222–2226. 2005. View Article : Google Scholar : PubMed/NCBI | |
Sherman M: Hepatocellular carcinoma: epidemiology, surveillance, and diagnosis. Semin Liver Dis. 30:3–16. 2010. View Article : Google Scholar | |
Novak G and Tallerico T: Nogo A, B and C expression in schizophrenia, depression and bipolar frontal cortex, and correlation of Nogo expression with CAA/TATC polymorphism in 3′-UTR. Brain Res. 1120:161–171. 2006.PubMed/NCBI | |
Lie M, Grover M and Whitlon DS: Accelerated neurite growth from spiral ganglion neurons exposed to the Rho kinase inhibitor H-1152. Neuroscience. 169:855–862. 2010. View Article : Google Scholar : PubMed/NCBI | |
Liu L, Zhang N, Liu J, et al: Lentivirus-mediated siRNA interference targeting SGO-1 inhibits human NSCLC cell growth. Tumour Biol. 33:515–521. 2012. View Article : Google Scholar : PubMed/NCBI | |
Chen YC, Lu DD, Cao XR and Zhang XR: RTN4-C gene expression in hepatocellular carcinoma and its influence on SMMC7721 cell growth and apoptosis. Yi Chuan Xue Bao. 32:891–897. 2005.PubMed/NCBI | |
Kuang E, Wan Q, Li X, Xu H, Zou T and Qi Y: ER stress triggers apoptosis induced by Nogo-B/ASY overexpression. Exp Cell Res. 312:1983–1988. 2006. View Article : Google Scholar : PubMed/NCBI | |
Zheng H, Xue S, Lian F and Wang YY: A novel promising therapy for vein graft restenosis: overexpressed Nogo-B induces vascular smooth muscle cell apoptosis by activation of the JNK/p38 MAPK signaling pathway. Med Hypotheses. 77:278–281. 2011. View Article : Google Scholar : PubMed/NCBI | |
Naldini L, Blömer U, Gallay P, et al: In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272:263–267. 1996. View Article : Google Scholar : PubMed/NCBI | |
Brummelkamp TR, Bernards R and Agami R: A system for stable expression of short interfering RNAs in mammalian cells. Science. 296:550–553. 2002. View Article : Google Scholar : PubMed/NCBI | |
Rubinson DA, Dillon CP, Kwiatkowski AV, et al: A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet. 33:401–406. 2003. View Article : Google Scholar : PubMed/NCBI | |
Sutendra G, Dromparis P, Wright P, et al: The role of Nogo and the mitochondria-endoplasmic reticulum unit in pulmonary hypertension. Sci Transl Med. 3:88ra552011.PubMed/NCBI |