Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2016 Volume 13 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2016 Volume 13 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis

Corrigendum in: /10.3892/mmr.2016.5915
  • Authors:
    • Sheng‑Chao Ma
    • Hui‑Ping Zhang
    • Fan‑Qi Kong
    • Hui Zhang
    • Cheng Yang
    • Yang‑Yang He
    • Yan‑Hua Wang
    • An‑Ning Yang
    • Ju Tian
    • Xiao‑Ling Yang
    • Ming‑Hao Zhang
    • Hua Xu
    • Yi‑Deng Jiang
    • Zheng Yu
  • View Affiliations / Copyright

    Affiliations: Department of Physiology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, Sichuan 610041, P.R. China, Department of Prenatal Diagnosis Center, General Hospital of Ningxia Medical University, Yinchuan, Ningxia Hui 750004, P.R. China, Department of Pathophysiology, Basic Medical School, Ningxia Medical University, Yinchuan, Ningxia Hui 750004, P.R. China
  • Pages: 4791-4799
    |
    Published online on: April 13, 2016
       https://doi.org/10.3892/mmr.2016.5120
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to identify an effective method for detecting early‑phase atherosclerosis (AS), as well as to provide useful DNA methylation profiles to serve as biomarkers for the detection of AS. A total of 300 individuals (150 AS patients and 150 healthy subjects) were recruited for peripheral blood DNA methylation analyses at 12 gene promoter loci using nested methylation‑specific polymerase chain reaction in a test set. Based on the test set, the promoter methylation of TIMP metallopeptidase inhibitor 1 (TIMP1), ATP binding cassette subfamily A member 1 (ABCA1), and acetyl-CoA acetyltransferase 1 (ACAT1) were determined to be candidate biomarkers; demonstrating the highest sensitivity (88%) and specificity (90%). The biomarkers that were candidates for early AS detection were validated in an independent validation set (n=100). In the validation set, the combination of TIMP1, ABCA1 and ACAT1 methylation achieved sensitivity, specificity and coincidence rate values of 88, 70 and 79%, respectively. In the current pilot study, the patterns of DNA methylation of AS‑associated genes were observed to be significantly altered in the peripheral blood of AS patients. Thus, the AS-specific methylation of the three‑gene panel (TIMP1, ABCA1, and ACAT1) may serve as a valuable biomarker for the early detection of AS.

Introduction

Atherosclerosis (AS) of the carotid arteries is a major cause of stroke and transient ischemic attack, which remains the leading cause of mortality in China and is currently the most common cause of mortality worldwide (1,2). The symptoms of AS are not always detected by patients until complications arise and the therapeutic methods to treat AS are poor; therefore, it is particularly important to establish an appropriate, rigorous and efficient detection strategy for early-phase AS, in order to limit disease progression before it results in clinical consequences (3). There are two prevalent methods for diagnosing AS: Doppler ultrasound and computed tomographic angiography (CTA), which have become the standard methods for diagnosing AS (4,5). However, neither of these methods identify the early asymptomatic pathological changes of AS and ultrasound only assesses plaque in the carotid artery. Therefore, it is paramount to develop non-invasive methods for diagnosing high-risk, asymptomatic individuals before the onset of clinical events or symptoms (6,7). Furthermore, data supporting the routine use of Doppler ultrasound to screen for carotid stenosis in an asymptomatic population is considered to be weak, as there is a low overall prevalence of treatable AS in the general asymptomatic population (8). It is widely hypothesized that the next generation of screening tests will be based on molecular biomarkers (9).

DNA methylation, a stable epigenetic mark, is a non-traditional, heritable factor involved in gene transcription regulation (10). DNA methylation occurs at position 5′ of CpG dinucleotides; certain regions of DNA are rich in CpG and are termed CpG islands (GCIs), which predominantly locate in the promoter region (11). Changes in patterns of DNA methylation may lead to inappropriate gene expression, and contribute to the development and progression of disease (12). In addition, previous studies have demonstrated aberrant DNA methylation in AS (13). Alterations in DNA methylation have been identified as an early event in AS; Zhao et al (14) found that aberrant methylation may represent an early biomarker for AS, and demonstrated clinical correlations with carotid intima-media thickness (14). Current research primarily focuses on the effect of DNA methylation leading to AS and, to the best of our knowledge, there are few studies that investigate the role of DNA methylation on the early diagnosis of AS. Detection of DNA methylation, at candidate loci in AS, suggests that AS-specific methylation changes could be applied diagnostically. However, DNA methylation affects various factors, including age, living environment, diet and other factors limit the use of methylation changes for diagnosis. Previous studies have shown that simultaneous measure various differentially methylated loci may improve diagnostic use (15). Furthermore, a major limitation towards further developments of DNA methylation in clinical use may be that the majority of studies focus on single genes (16), whereas AS is associated with multiple factors, including genetic and epigenetic alterations (17). Measuring the methylation of individual genes was not as specific or sensitive as using a panel of epigenetic markers for the early detection of breast cancer (18).

In the present study, DNA methylation was profiled in AS and healthy groups of 300 patients using nested methylation-specific polymerase chain reaction (PCR; NT-MSP). Based in previous unpublished data, a biomarker panel capable of differentiating AS patients from healthy individuals, irrespective of AS histology, was identified. The present study provides insight into AS etiology, presents validated tissue-based diagnostic biomarkers, and supplies a framework for the development of DNA methylation-based molecular diagnostics for AS detection in patients.

Materials and methods

Ethics statement

The present study was reviewed and approved by the Ethics Committee of General Hospital of Ningxia Medical University (Yinchuan, China). Written informed consent was obtained from the participants before the collection of any samples and the specimens were irreversibly de-identified.

Inclusion and exclusion criteria

Patients with AS were diagnosed by Doppler ultrasound examination of the carotid artery. The healthy control group comprised of age- and gender-matched healthy individuals that were not exhibiting AS risk factors. The exclusion criteria were as follows: Individuals with moderate or severe valvular heart disease, chronic renal failure or diabetes; smokers; obese individuals; and those exhibiting disordered lipid metabolism.

NT-MSP analysis of DNA methylation

The following candidate genes formed the panel for early detection of AS: ATP binding cassette subfamily A member 1 (ABCA1), acetyl-CoA acetyltransferase 1 (ACAT1), peroxisome proliferator activated receptor α (PPARA), platelet derived growth factor subunit B (PDGFB), arachidonate 5-lipoxygenase (ALOX5), LDL receptor related protein 1 (LRP1), lecithin-cholesterol acyltransferase (LCAT), TIMP metallopeptidase inhibitor 1 (TIMP1), matrix metallopeptidase 9 (MMP9), intercellular adhesion molecule 1 (ICAM1), vascular endothelial growth factor A (VEGFA) and nuclear factor of κ light polypeptide gene enhancer in B-cells 1 (NFKB1). These genes contained CGIs, were expressed in peripheral blood cells, and were correlated with the occurrence and development of AS (19–24). DNA methylation of these candidate genes was examined in two independent test sets (total of 300 peripheral blood samples) and genomic DNA was isolated from the peripheral blood mononuclear cells using the Wizard Genomic DNA Purification kit (Promega Corporation, Madison, WI, USA). An EZ DNA Methylation-Gold™ kit (Zymo Research Corporation, Irvine, CA, USA) was used to detect the DNA methylation patterns, and integrates the DNA denaturation and bisulfite conversion processes into one step. The DNA was modified by sodium bisulfite (Zymo Research Corporation, Irvine, CA, USA) in which unmethylated cytosine residues were converted to thymine, whereas methylated cytosine residues were retained as cytosine; this difference was then utilized to specifically amplify either methylated or unmethylated DNA. NT-MSP, which consists of a two-step PCR amplification, was then used to detect methylation (25). The first step of NT-MSP uses an outer primer pair, which does not contain any CpGs. The second step of PCR was conducted with conventional PCR primers serving as inner primers. The primers for NT-MSP amplification were designed according to the bioinformatics program, MethPrimer (www.urogene.org/methprimer/index.html) and are presented in Table I. PCR products were gel purified with an agarose gel DNA fragment recovery kit, according to the manufacturer's instructions, and were sequenced by Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). To reduce mispriming and to increase efficiency, touchdown (TD) PCR was used for amplification. Samples were subjected to 30 cycles in a TD program (94°C for 5 min, 94°C for 30 sec; 56°C for 30 sec and 72°C for 1 min, followed by a decrease of 0.5°C in the annealing temperature every second cycle). After completion of the TD program, 20 cycles were subsequently run (94°C for 30 sec, 56°C for 30 sec and 72°C for 60 sec), terminating with a 7-min extension at 72°C. The PCR products were separated by electrophoresis through a 2% agarose gel (Borunlaite Science & Technology, Beijing, China) containing ethidium bromide (Tokyo Chemical Industry Co., Ltd., Shanghai, China) for 30 min at 100 V. The DNA bands were visualized using ultraviolet light. The following formula was used: Methylation %= methylation / (methylation + unmethylation) ×100%.

Table I

Primer sequences for DNA methylation analysis.

Table I

Primer sequences for DNA methylation analysis.

GenePrimer sequence (5′-3′)
ForwardReverse
ABCA1
 Outer GAAAGTAGGATTTAGAGGAAGTAAAT AATTCAATCACTCAACAAAAAACAC
 Methylation AATTTTATTGGTGTTTTTGGTTGTC ATATCTTAAAATCCGCGATCTACG
 Unmethylation AATTTTATTGGTGTTTTTGGTTGTT CAAATATCTTAAAATCCACAATCTA
ACAT1
 Outer AGGAAGATTTAGAGATTTAGAAGTAA TCAATAATCACTCAAACACACAA
 Methylation TTAATTAGTTTGGTTTTTGGTCGTT CTTATATACCAAATGCGAACT
 Unmethylation TTAATTATGTGTGTTTGGTTTTTTG TATCCAAATTAACCAAACTCCATA
PDGFB
 Outer TTTTTTTGTTTTGAAATTTTGGTTAA CAAAATCCCAACAAAAATCTCC
 Methylation TTTGGAAATTAATGATAAGTTAGGC AAGCATCATAAAAAAAACGCATC
 Unmethylation TTGGAAATTAATGATAAGTTAGGTGA AAACATCATAAAAAAAACACATCA
ALOX5
 Outer TTATATTTTCGTCGTTTTACGTACG AATATAAAAAAAATTTCGCGCG
 Methylation TATATTTTTGTTGTTTTATGTATGG AAATATAAAAAAAATTACACACT
 Unmethylation AGATGTTATAGGGATTTTGTTGTTT TCTAAAACACAAAAACTCTCAAC
LRP1
 Outer TTTGTTGTTTAGGTTGGAGTGTAGT TAAAAAAATCACTTTTAAAAATTC
 Methylation TGTTTAGGTTGGAGTGTAGTGGTAC AAAAAATCACTTTTCAAAATTCGA
 Unmethylation TGTTTAGGTTGGAGTGTAGTGGTAT AAAAATCACTTTTCAAAATTCAAA
LCAT
 Outer GAGTTTTTTGTTTTGTTTTGGTTTC AATCTTAATCAATCTATCTACCGC
 Methylation GAGTTTTTTGTTTTGTTTTGGTTTT ATCTTAATCAATCCATCTACCACA
 Unmethylation TTTGGTTGTTTTTTTGTATTATTTG TCAATCTTAATCAACTCATCTACC
TIMP1
 Outer TTTTTTTTAATGTTTATTTATTTATT CCAAACACTCACAATTTATCTCAC
 Methylation TTAGGTAGTTTTTGTTTGAATTTCG ATAAATACCGTTCTTATTCCCGTT
 Unmethylation TAGGTAGTTTTTGTTTGAATTTTGG ATAAATACCAATTCTTATTCCCATT
MMP9
 Outer GGTTATATAGTTGGAAATGGTAGAGT ATTCAAACAATTCTCTACCTCAAC
 Methylation TTTTAAATATAGTTTATTGGGTCGG TTTAATAAAAATAAAATTTCACTA
 Unmethylation TTTTTTAAATATAGTTTATTGGGTTGG AATAAAAATAAATTTCACTACATT
ICAM1
 Outer GTAAGAGTTTAGTGGAATTCGTTCG GAATCACTAACCATCCAAAAACG
 Methylation TAAGAGTTTAGTGGAATTTGTTTGA AAATCACTAACCATCCAAAAACAC
 Unmethylation TAAGAGTTTAGTGGAATTTGTTTGA CCTAAAACTTTCCTATTATAAAAC
VEGFA
 Outer TAGTTAGAGTCGGGGTGTGTAGAC GAAAAACCGAACAAAAACGAA
 Methylation TAGTTAGAGTTGGGGTGTGTAGATG AACAAAAAACCAACAAAAACAAA
 Unmethylation GGAGTAAATTTTTTTTATTTTTTTT ATTGTGGTTTTTGGTTTAGTTTTG
PPARA
 Outer AGTATAGTGGTATAGGGTATTGGTAG TAAAACTCTACAAAACAAAAAAAA
 Methylation TAGTGGTAGGTATAGTTGGTAGCGG ACCAATAACGAAAATAAAAAAAC
 Unmethylation TAGTGGTAGGTATAGTTGGTAGTGG CAATAACAAAATAAAAAAACACC
NFKB1
 Outer TATAGATGAGTTTTATTTATTTGGTA AAACTCTAACTCCTAACAAAAC
 Methylation TTGATTGGGTTCGGTAGGC GCACTTCTAAAAAGCTATACGCC
 Unmethylation TTATTGATTGGGTTTGGTAGGT CCCACACTTCTAACACTATACACC
Reverse transcription-quantitative PCR (RT-qPCR) for mRNA

The total RNA was extracted from the peripheral blood mononuclear cells using Invitrogen TRIzol reagent (Thermo Fisher Scientific, Inc.). Primer Premier 5 software was used to design the primers (Table II). The expression levels of candidate genes were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH): Forward, 5′-AGAAGGCTGGGGCTCATTTG-3′, and reverse, 5′-AGGGGCCATCCACAGTCTTC-3′. RNA was reverse transcribed using the PrimeScript Real-Time PCR reagent kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Total RNA then underwent cDNA synthesis and PCR amplification using the PrimeScript Real-Time PCR reagent kit according to the manufacturer's instructions. The qPCR reaction was performed following the manufacturer's instructions, as follows: Denaturation at 94°C for 10 min, 50 cycles at 94°C for 15 sec, annealing at 53°C for 30 sec and extension at 72°C for 30 sec. The RNA level of every gene was acquired from the value of the quantitation cycle (Cq) of the qPCR normalized to that of GAPDH using the following formula: ΔCq = CqGAPDH − Cqgene. The final results were expressed as the N-fold differences in the target gene expression and was relative to the calibrator, termed Ntarget, which was determined as follows: Ntarget =2ΔCq(sample)−ΔCq(calibrator), where ΔCq values of the calibrator and sample were determined by subtracting the Cq value of the target gene from the Cq value of GAPDH.

Table II

Primers used in quantitative polymerase chain reaction for mRNA analysis.

Table II

Primers used in quantitative polymerase chain reaction for mRNA analysis.

GenePrimerSequence (5′-3′)Product size (bp)
ACAT1Left ACGCTGCTGTAGAACCTATTGA116
Right GGCTTCATTTACTTCCCACATT
ABCA1Left ATCAAGGGCATCGTGTATGAG227
Right AGGATTGTCACCACAGCAAAC
PPARALeft ATCACGGAACACGCTTTCAC100
Right CGATGTTCAATGCTCCACTG
TIMP1Left ATACTTCCACAGGTCCCACAAC194
Right GGATGGATAAACAGGGAAACAC
ALOX5Left AGTTCCAGCAAGGGAACATT204
Right CATCCGAAGGGAGGAAAATAG
Statistical analysis

The patient characteristics were compared with those of the control subjects using the χ2 test and the independent-samples t-test was used to detect significantly different methylation levels between the AS patients and matched controls. Receiver-operating-characteristics (ROC) curves were calculated to evaluate the diagnostic performance of different marker combinations. Furthermore, sensitivity and specificity analyses were performed to assess different marker combinations for AS detection. P<0.05 was considered to indicate a statistically significant difference.

Results

Doppler ultrasound of carotid artery samples

All participants in the test and validation sets were verified by Doppler ultrasound. Images of carotid arteries of the healthy control subjects are presented in Fig. 1A, the samples demonstrate intima-media with no plaques and normal blood flow. Conversely, Doppler flow imaging of the patients with AS demonstrated anterior wall filling defects in the carotid artery, as shown in Fig. 1B and C. Furthermore, the plaque area was 0.23×2.23 cm in Fig. 1B and 0.47×3.59 cm in Fig. 1C.

Figure 1

Carotid artery plaques detected by Doppler ultrasound. (A) Carotid artery in the healthy control group. (B) Carotid atherosclerosis plaque sonograms from patients with (B) minor (plague area, 0.23×2.23 cm) and (C) severe (plague area, 0.47×3.59 cm) lesions. Sonograms were performed on the right side of the carotid artery to atherosclerosis plaques. Plaques are demonstrated by the red arrows.

Subject recruitment and collection of blood samples

A total of 300 peripheral blood samples were assessed in this case-control study, which included samples from AS patients and healthy control subjects. Between June 2011 and March 2012 150 patients and 150 healthy subjects (who had undergone Doppler ultrasound) were enrolled from the General Hospital of Ningxia Medical University for the test study. All participants were human immunodeficiency virus-, hepatitis B virus-, and hepatitis B virus-negative and did not exhibit inflammation or liver and kidney diseases. Furthermore, they did not have any previous history of cancer and were not pregnant. AS is often accompanied by lipid abnormalities; in the present study, AS patients demonstrated higher levels of the following factors: Total cholesterol (TC; P=0.0082), total triglycerides (TG; P=0.0091), high-density lipoprotein (HDL; P=0.0063), apolipoprotein A (P=0.0895) and apolipoprotein B (P=0.0739) compared with the matched control subjects, however, the low-density lipoprotein (LDL) is decreased. The two groups were matched according to gender, age, smoking habit and alcohol consumption; Table III presents the clinical profiles of the patients.

Table III

Demographic characteristics of study subjects.

Table III

Demographic characteristics of study subjects.

CharacteristicGroups
P-value
Matched control (%)AS (%)
Gender ratio (male/female)70/8060/900.1359
Age (years)
 30–406318
 41–4955500.3791
 51–603287
Alcohol25450.2852
Smoking48550.5721
Total triglyceride6 (4)66 (44)0.0091
Total cholesterol12 (8)39 (26)0.0082
High-density lipoprotein6 (4)88 (72)0.0063
Low-density lipoprotein45 (30)25 (41)0.0489
Apolipoprotein A81 (54)99 (66)0.0894
Apolipoprotein B24 (36)75 (51)0.0739

[i] P<0.05 was considered to indicate a statistically significant difference. AS vs. controls (n=150). AS, atherosclerosis.

Blood lipid levels

The 300 samples were evaluated using an automatic biochemical analyzer and the blood lipids levels are presented in Fig. 2. Compared with the healthy control group, the concentrations of TG and TC increased by 2.4- and 1.2-fold, respectively in the AS patients (P<0.01 and P<0.05), while, the HDL level was reduced by 43.8% in the AS group (P<0.05).

Figure 2

Blood lipid concentrations. *P<0.05, **P<0.01 vs. control group. TG, triglyceride; TC, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein.

Methylation frequencies of target genes in the AS and matched control subjects in the test set

DNA methylation of ABCA1, ACAT1, PPARA, PDGFB, ALOX5, LRP1, LCAT, TIMP1, MMP9, ICAM1, VEGFA and NFKB1 were initially assessed by NT-MSP (Fig. 3; Table IV). The figure demonstrates the patterns of hyper- and hypomethylated genes in the AS patients and matched control subjects. Methylation frequencies of ACAT1 (P<0.01), ALOX5 (P<0.05) and PPARA (P<0.05) were decreased whereas TIMP1 (P<0.01) and ABCA1 (P<0.01) were significantly increased in AS compared the matched controls. However, no statistically significant differences were identified between the remaining genes (PDGFB, LRP1, LCAT, MMP9, ICAM1, VEGFA and NFKB1) in the AS patients and matched control subjects, thus, these genes were excluded. The methylation of TIMP1, ACAT1 (P<0.01), ABCA1, ALOX5 and PPARA were significantly different in AS; thus, these genes may be used as a clinical tool for the early diagnosis of AS.

Figure 3

Methylation of AS-associated genes. Nested touchdown methylation-specific polymerase chain reaction was performed following bisulfite modification of DNA from samples of peripheral blood from the healthy and AS groups. Lane M, methylation; lane U, unmethylation; lane A, healthy group; lane B, AS group. AS, atherosclerosis.

Table IV

Methylation levels of AS-associated genes in the two groups.

Table IV

Methylation levels of AS-associated genes in the two groups.

GeneHealthy groupAS groupP-value
ACAT10.6103±0.010820.4357±0.025620.0024a
ICAM10.2812±0.021190.2530±0.023350.3722
ALOX50.3091±0.015890.2770±0.005730.0325b
LRP10.6977±0.011040.6893±0.012610.6213
MMP90.6246±0.027440.5585±0.027540.0944
TIMP10.5103±0.002760.5924±0.007820.0031a
VEGFA0.5607±0.008410.5565±0.013860.8073
PDGDB0.5493±0.010080.5217±0.011750.0812
ABCA1 0.4855±0.0065170.6708±0.016090.0011a
LCAT0.7087±0.015020.6827±0.016820.2544
PPARA0.9944±0.002150.9786±0.001470.0266b
NFKB10.5709±0.01952 0.5631±0.0070490.7090

a P<0.01

b P<0.05 vs. healthy group. Values are presented as the mean + standard deviation. AS, atherosclerosis.

Aberrant methylation profiles in AS

Among the 12 genes, the methylation frequencies of five genes, TIMP1, ACAT1, ABCA1, ALOX5 and PPARA, were significantly different between the AS patients and the matched control subjects. ROC curves were constructed for each of the five genes to classify AS patients and the matched control subjects. The area under the curve (AUC) of the ROC curve for TIMP1 was 0.891 (P<0.0001), which was the largest among the five genes. The sensitivity and specificity of TIMP1 were 78 and 84%, respectively, in the diagnosis of AS (Table V). When used separately to diagnose AS, the sensitivity of each gene ranged from 44 to 78% and the specificity ranged from 60 to 84%, the AUC of the ROC curves for the other four genes (ACAT1, ABCA1, ALOX5 and PPARA) ranged from 0.547 to 0.830.

Table V

Diagnostic performance of five genes in AS group versus the matched controls in the test set.

Table V

Diagnostic performance of five genes in AS group versus the matched controls in the test set.

GeneAS group
Matched control group
AUCPPVNPVP-value
Sensitivity (%)Pos./totalSpecificity (%)Pos./total
TIMP178117/1508424/1500.8910.830.79<0.0001
ACAT168102/1508424/1500.8300.810.72<0.0001
ABCA16290/1507833/1500.7110.740.67<0.0001
ALOX54872/1506060/1500.5470.550.54   0.0325
PPARA4466/1507242/1500.5350.610.56   0.0380

[i] AS, atherosclerosis; AUC, area under the curve; Pos., presented positive; PPV, positive predictive value; NPV, negative predictive value. n=150.

Combining various markers is a common strategy to improve diagnostic sensitivity when investigating clinical biomarkers. Based on the ROC curve for each gene, the most sensitive for the diagnosis of AS was TIMP1, which was found to be methylated in 117 of the 150 cases of AS patients, displaying a sensitivity of 78%; TIMP1 was also identified in 126 of the 150 cases of matched controls, displaying a specificity of 84% (Table V). The more frequently methylated gene was ACAT1 (68%; 102/150), followed by ABCA1 (62%; 93/150), ALOX5 (48%; 72/150) and PPARA (44%; 66/150). The AUC of ALOX5 (0.547) and PPARA (0.535) was the smallest among the five genes, and the methylation frequencies of ALOX5 and PPARA demonstrated no significant difference between the AS and matched control groups, ranging from 44 to 48% and from 60 to 72% in the in AS and matched control groups, respectively. Three genes, TIMP1, ACAT1 and ABCA1, were highly specifically methylated in AS; therefore, these constituted the first combination (P<0.01), which was the highest among the five genes for the diagnosis of AS. According to this analysis, combinations of different markers were examined to maximize specificity and sensitivity (Table VI). The combination of TIMP1, ACAT1 improved the sensitivity to 84%, which is higher than TIMP1 or ACAT1 alone, while the specificity dropped to 78%. Using this method, a total of three panels of genes were analyzed. The sensitivity and specificity of the three-gene panel (TIMP1, ACAT1 and ABCA1) was 88 and 90%, respectively and thus was identified to be the optimal combination of markers in the present study.

Table VI

Diagnostic performance of different panels in the AS and matched groups.

Table VI

Diagnostic performance of different panels in the AS and matched groups.

GenesAS group
Matched control group
PPVNPV
Sensitivity (%)Pos./totalSpecificity (%)Pos./total
ACAT1, TIMP184126/1507833/1500.790.81
ABCA1, TIMP176114/15094   9/1500.930.80
ACAT1, ABCA176114/1507439/1500.750.76
ACAT1, ABCA1, TIMP188132/1509015/1500.900.88

[i] AS, atherosclerosis; Pos., presented positive; PPV, positive predictive value; NPV, negative predictive value. n=150.

Expression levels of TIMP1, ACAT1, ABCA1, ALOX5 and PPARA in the AS and matched control groups

DNA methylation is often correlated with changes in the accessibility of DNA to transcriptional activators, which is crucial in the regulation of gene expression (26). RT-qPCR analysis of these five genes (TIMP1, ACAT1, ABCA1, ALOX5 and PPARA) was performed in the AS and matched control groups on samples of peripheral blood for which total RNA was available. Compared with the healthy group, the expression levels of PPARA, ALOX5 and ACAT1 were increased by 3.94-, 3.38- and 1.54-fold in the AS group, respectively (Table VII). These data suggest that these AS-associated genes were markedly altered in AS patents.

Table VII

AS-associated gene mRNA expression in the two groups.

Table VII

AS-associated gene mRNA expression in the two groups.

GeneHealthy groupAS groupP-value
ACAT10.1027±0.023260.1585±0.033780.0348a
ABCA10.4492±0.123600.1046±0.020100.0156a
ALOX5 0.07529±0.011710.2545±0.057150.0040b
TIMP10.1477±0.01251 0.05062±0.005020.0001b
PPARA0.0861±0.02322 0.33960±0.068390.0025b

a P<0.05

b P<0.01 vs. healthy group. Values are presented as the mean + standard deviation. AS, atherosclerosis.

Analysis of sensitivity and specificity of methylation profiles

The novel panel, consisting of the genes TIMP1, ACAT1 and ABCA1, initially exhibited a combined sensitivity of 88% for the AS group and specificity of 90% for the matched control group, the performance of the novel panel was higher when compared with that of the individual genes for the detection of AS. The novel epigenetic (epi)-panel was compared with the previously used Doppler ultrasound method to identify AS in the validation data analysis. The validation set consisted of 100 samples that were also obtained from the General Hospital of Ningxia Medical University, including 50 patients and 50 healthy individuals, who had been excluded from the AS group via Doppler ultrasound diagnosis.

To study the correlation between methylation levels obtained by NT-MSP and Doppler ultrasound (which is a diagnostic criteria for AS) samples of the validation set were reexamined by qualitative NT-MSP. In order to increase the analytical sensitivity and to yield a higher reproducibility, primer binding sites in the test set and the validation set were located in the same genomic promoter region. By contrasting Doppler ultrasound with TIMP1, ACAT1 and ABCA1 promoter methylation, a significant, positive correlation was identified. The combination of TIMP1, ACAT1 and ABCA1 methylation revealed a sensitivity of 88% for the detection of AS and a specificity of 70% in healthy subjects, respectively. The novel panel also revealed a coincidence rate of 79%, which refers to consistency between the results of the novel panel and the Doppler ultrasound.

Discussion

The incidence of AS is increasing and represents a significant health issue, thus, there is a clear requirement for the development of prognostic markers in AS to provide risk-adjusted treatment and surveillance management. DNA methylation biomarkers have obvious applications in diagnostics (27). In the present study, the performance of a blood-based PCR assay for methylated DNA of 12 potential biomarkers was determined in two independent test sets with a total of 300 samples. The data confirmed the high performance of certain previously identified DNA methylation markers. Furthermore, the methylation frequencies of ACAT1, ABCA1, PPARA, TIMP1 and ALOX5 of AS peripheral blood were identified to be significantly changed when compared with that of the matched controls, the novel epi-panel consisting of TIMP1, ACAT1 and ABCA1 exhibited a higher sensitivity and specificity than any of the individual biomarkers.

These genes have previously been reported to be significantly involved in preventing or promoting AS. Aberrant methylation of ABCA1 and ACAT1 has been identified in the progression of AS (28). In addition, TIMP1 expression has been associated with a negative prognosis in AS (29). To the best of our knowledge the present study is the first to demonstrate TIMP1 methylation in AS, and that methylation of ACAT1 and ABCA1 has never previously been reported in AS.

Methylation changes in AS are often heterogeneous and, as yet, to the best of our knowledge, no single gene has been identified to be methylated in every AS patient specimen. Furthermore, in the majority of studies investigating methylation levels of only single genes the sensitivity was low. Therefore, it is considered to be advantageous to use a panel of genes for disease screening procedures. As a result of the comparative analysis, a biomarker panel with the best values for AS specificity was defined first in a test set. TIMP1, ACAT1 and ABCA1 proved to be candidate genes, showing a significant specificity of the methylation pattern in the matched control and AS groups. Furthermore, TIMP1, ACAT1 and ABCA1 methylation achieved 88% sensitivity, with a high specificity of 90% in the test set, this indicated that the panel had the potential to perform as effectively, potentially more effectively, than the single markers, indicating that the methylation of three genes may be useful when screening high risk individuals.

In an independent validation set, promoter methylation of the TIMP1, ACAT1 and ABCA1 combination enabled significant discrimination of AS from various control conditions. ROC analysis of three-gene panel methylation revealed a sensitivity of 88% with a specificity of 70%. Combining these with other detection methods may provide a robust epi-panel with a high sensitivity for AS detection. Compared with ultrasound, a reliable biomarker panel for the early detection of AS, revealed that the coincidence rate was 79%; thus, TIMP1, ACAT1 and ABCA1 methylation analyses may be used as a supplement to mammography, which has a low sensitivity in the early detection of AS.

In conclusion, methods for AS screening should be easy to perform, non-invasive and provide a benefit to patients. Blood-based biomarkers fulfill these three requirements. Quantifying promoter methylation of AS-associated genes in peripheral blood is a rapidly growing research topic for early AS detection. In the current study, 12 potential biomarkers were evaluated in two independent test sets, and promoter methylation of the TIMP1, ACAT1 and ABCA1 gene combination exhibited a high sensitivity and specificity in peripheral blood DNA from patients with AS. It is proposed that such a blood-based screening method would be convenient for the patient and reduce costs for health care providers.

Acknowledgments

The present study was supported by grants from the National Natural Science Foundation of China (grant nos. 81160044, 81260105, 81360073, 81200118 and 81260063).

References

1 

Liapis CD, Bell PR, Mikhailidis D, Sivenius J, Nicolaides A, Fernandes e Fernandes J, Biasi G and Norgren L: ESVS Guidelines Collaborators: ESVS guidelines. Invasive treatment for carotid stenosis: Indications, techniques. Eur J Vasc Endovasc Surg. 37(4 Suppl): S1–S19. 2009. View Article : Google Scholar

2 

Du J, Wasserman BA, Tong W, Chen S, Lai S, Malhotra S and Lai H: Cholesterol is associated with the presence of a lipid core in carotid plaque of asymptomatic, young-to-middle-aged African Americans with and without HIV infection and cocaine use residing in inner-city Baltimore, Md., USA. Cerebrovasc Dis. 33:295–301. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Almekkaway MK, Shehata IA and Ebbini ES: Anatomical-based model for simulation of HIFU-induced lesions in atherosclerotic plaques. Int J Hyperthermia. 31:433–442. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Libby P: Managing the risk of atherosclerosis: The role of high-density lipoprotein. Am J Cardiol. 88:3N–8N. 2001.

5 

Hollingworth W, Nathens AB, Kanne JP, Crandall ML, Crummy TA, Hallam DK, Wang MC and Jarvik JG: The diagnostic accuracy of computed tomography angiography for traumatic or atherosclerotic lesions of the carotid and vertebral arteries: A systematic review. Eur J Radiol. 48:88–102. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Wong KS, Li H, Chan YL, Ahuja A, Lam WW, Wong A and Kay R: Use of transcranial doppler ultrasound to predict outcome in patients with intracranial large-artery occlusive disease. Stroke. 31:2641–2647. 2000. View Article : Google Scholar : PubMed/NCBI

7 

Dong C, Yoon W and Goldschmidt-Clermont PJ: DNA methylation and atherosclerosis. J Nutr. 132(8 Suppl): 2406S–2409S. 2002.PubMed/NCBI

8 

Grützmann R, Molnar B, Pilarsky C, Habermann JK, Schlag PM, Saeger HD, Miehlke S, Stolz T, Model F, Roblick UJ, et al: Sensitive detection of colorectal cancer in peripheral blood by septin 9 DNA methylation assay. PloS One. 11:e37592008. View Article : Google Scholar

9 

Majid MM, Mughal MK, DeMarco JK, Majid A, Shamoun F and Abela GS: Symptomatic and asymptomatic carotid artery plaque. Expert Rev Cardiovasc Ther. 9:1315–1330. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Mendelsohn AR and Larrick JW: The DNA methylome as a biomarker for epigenetic instability and human aging. Rejuvenation Res. 16:74–77. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Guay SP, Brisson D, Lamarche B, Marceau P, Vohl MC, Gaudet D and Bouchard L: DNA methylation variations at CETP and LPL gene promoter loci: New molecular biomarkers associated with blood lipid profile variability. Atherosclerosis. 228:413–420. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Zhang Y, Zhao M, Sawalha AH, Richardson B and Lu Q: Impaired DNA methylation and its mechanism s in CD4(+)T cells of systemic lupus erythematosus. J Autoimmun. 41:92–99. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Robertson KD and Jones PA: DNA methylation: Past, present and future directions. Carcinogenesis. 21:461–467. 2000. View Article : Google Scholar : PubMed/NCBI

14 

Zhao J, Forsberg CW, Goldberg J, Smith NL and Vaccarino V: MAOA promoter methylation and susceptibility to carotid atherosclerosis: Role of familial factors in a monozygotic twin sample. BMC Med Genet. 13:1002012. View Article : Google Scholar : PubMed/NCBI

15 

Lasseigne BN, Burwell TC, Patil MA, Absher DM, Brooks JD and Myers RM: DNA methylation profiling reveals novel diagnostic biomarkers in renal cell carcinoma. BMC Med. 12:2352014. View Article : Google Scholar : PubMed/NCBI

16 

Yu X, Ling W and Mi M: Relationship of impairment induced by intracellular S-adenosylhomocysteine accumulation with DNA methylation in human umbilical vein endothelial cells treated with 3-deazaadenosine. Int J Exp Pathol. 90:638–648. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Dong C, Yoon W and Goldschmidt-Clermont PJ: DNA methylation and atherosclerosis. J Nutr. 132(8 Suppl): 2406S–2409S. 2002.PubMed/NCBI

18 

Van De Voorde V, Speeckaert R, Van Gestel D, Bracke M, De Neve W, Delanghe J and Speeckaert M: DNA methylation-based biomarkers in serum of patients with breast cancer. Mutat Res. 751:304–325. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Ridker PM, Stampfer MJ and Rifai N: Novel risk factors for systemic atherosclerosis: A comparison of C-reactive protein, fibrinogen, homocysteine, lipoprotein(a) and standard cholesterol screening as predictors of peripheral arterial disease. JAMA. 285:2481–2485. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Attie AD, Kastelein JP and Hayden MR: Pivotal role of ABCA1 in reverse cholesterol transport influencing HDL levels and susceptibility to atherosclerosis. J Lipid Res. 42:1717–1726. 2001.PubMed/NCBI

21 

Nissen SE, Tuzcu EM, Brewer HB, Sipahi I, Nicholls SJ, Ganz P, Schoenhagen P, Waters DD, Pepine CJ, Crowe TD, et al: Effect of ACAT inhibition on the progression of coronary atherosclerosis. N Engl J Med. 354:1253–1263. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Shan W, Palkar PS, Murray IA, McDevitt E, Kennett MJ, Kang BH, Isom HC, Perdew GH, Gonzalez FJ and Peters JM: Ligand activation of peroxisome proliferator-activated receptor beta/delta (PPARbeta/delta) attenuates carbon tetrachloride hepatotoxicity by downregulating proinflammatory gene expression. Toxicol Sci. 105:418–428. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Khovidhunkit W, Kim MS, Memon RA, Shigenaga JK, Moser AH, Feingold KR and Grunfeld C: Effects of infection and inflammation on lipid and lipoprotein metabolism mechanisms and consequences to the host. J Lipid Res. 45:1169–1196. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Liang Y, Yang X, Ma L, Cai X, Wang L, Yang C, Li G, Zhang M, Sun W and Jiang Y: Homocysteine-mediated cholesterol efflux via ABCA1 and ACAT1 DNA methylationin THP-1 monocyte-derived foam cells. Acta Biochim Biophys Sin (Shanghai). 45:220–228. 2013. View Article : Google Scholar

25 

Ma S, Zhang H, Sun W, Gong H, Wang Y, Ma C, Wang J, Cao C, Yang X, Tian J, et al: Hyperhomocysteinemia induces cardiac injury by up-regulation of p53-dependent Noxa and Bax expression through the p53 DNA methylation in ApoE (−/−) mice. Acta Biochim Biophys Sin (Shanghai). 45:391–400. 2013. View Article : Google Scholar

26 

Frangogiannis NG, Smith CW and Entman ML: The inflammatory response in myocardial infarction. Cardiovasc Res. 53:31–47. 2002. View Article : Google Scholar

27 

Glöckner SC, Dhir M, Yi JM, McGarvey KE, Van Neste L, Louwagie J, Chan TA, Kleeberger W, de Bruïne AP, Smits KM, et al: Methylation of TFPI2 in stool DNA: A potential novel biomarker for the detection of colorectal cancer. Cancer Res. 69:4691–4693. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Melotte V, Lentjes MH, van den Bosch SM, Hellebrekers DM, de Hoon JP, Wouters KA, Daenen KL, Partouns-Hendriks IE, Stessels F, Louwagie J, et al: N-Myc downstream-regulated gene 4 (NDRG4): A candidate tumor suppressor gene and potential biomarker for colorectal cancer. J Natl Cancer Inst. 101:916–927. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Hoseini SM, Kalantari A, Afarideh M, Noshad S, Behdadnia A, Nakhjavani M and Esteghamati A: Evaluation of plasma MMP-8, MMP-9 and TIMP-1 identifies candidate cardiometabolic risk marker in metabolic syndrome: Results from double-blinded nested case-control study. Metabolism. 64:527–538. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma SC, Zhang HP, Kong FQ, Zhang H, Yang C, He YY, Wang YH, Yang AN, Tian J, Yang XL, Yang XL, et al: Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915. Mol Med Rep 13: 4791-4799, 2016.
APA
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y. ... Yu, Z. (2016). Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915. Molecular Medicine Reports, 13, 4791-4799. https://doi.org/10.3892/mmr.2016.5120
MLA
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y., Wang, Y., Yang, A., Tian, J., Yang, X., Zhang, M., Xu, H., Jiang, Y., Yu, Z."Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915". Molecular Medicine Reports 13.6 (2016): 4791-4799.
Chicago
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y., Wang, Y., Yang, A., Tian, J., Yang, X., Zhang, M., Xu, H., Jiang, Y., Yu, Z."Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915". Molecular Medicine Reports 13, no. 6 (2016): 4791-4799. https://doi.org/10.3892/mmr.2016.5120
Copy and paste a formatted citation
x
Spandidos Publications style
Ma SC, Zhang HP, Kong FQ, Zhang H, Yang C, He YY, Wang YH, Yang AN, Tian J, Yang XL, Yang XL, et al: Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915. Mol Med Rep 13: 4791-4799, 2016.
APA
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y. ... Yu, Z. (2016). Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915. Molecular Medicine Reports, 13, 4791-4799. https://doi.org/10.3892/mmr.2016.5120
MLA
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y., Wang, Y., Yang, A., Tian, J., Yang, X., Zhang, M., Xu, H., Jiang, Y., Yu, Z."Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915". Molecular Medicine Reports 13.6 (2016): 4791-4799.
Chicago
Ma, S., Zhang, H., Kong, F., Zhang, H., Yang, C., He, Y., Wang, Y., Yang, A., Tian, J., Yang, X., Zhang, M., Xu, H., Jiang, Y., Yu, Z."Integration of gene expression and DNA methylation profiles provides a molecular subtype for risk assessment in atherosclerosis Corrigendum in /10.3892/mmr.2016.5915". Molecular Medicine Reports 13, no. 6 (2016): 4791-4799. https://doi.org/10.3892/mmr.2016.5120
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team