Role of ADAMTS13 in diet-induced liver steatosis
- Authors:
- Published online on: June 7, 2017 https://doi.org/10.3892/mmr.2017.6714
- Pages: 1451-1458
Abstract
Introduction
Non-alcoholic fatty liver disease (NAFLD) is characterized by excessive fat accumulation in the liver of patients without a history of alcohol abuse. NAFLD is classified into simple steatosis and non-alcoholic steatohepatitis (NASH). In patients with NASH, in addition to steatosis, additional intralobular inflammation and hepatocellular ballooning are observed, frequently with progressive fibrosis (1). Over time, NASH may progress to liver cirrhosis and hepatocellular carcinoma (2–4). It is recognized that the increased prevalence of obesity and metabolic syndrome is paralleled by an increase in NAFLD (5,6), as up to 80% of obese subjects suffer from NAFLD (7). Worldwide, approximately 20% of all adults have NAFLD and 2–3% suffer from NASH (8).
ADAMTS13 (a disintegrin and metalloproteinase with thrombospondin type-1 motif, member 13) is a proteinase that specifically cleaves multimeric von Willebrand factor (VWF), thereby preventing accumulation of ultralarge VWF multimers and subsequent platelet clumping and formation of microthrombi that disturb the microcirculation and impair oxygen supply to organs (9). ADAMTS13 is predominantly produced by stellate cells in the liver (10), of which proliferation contributes to steatohepatitis and fibrosis. This is compatible with enhanced ADAMTS13 antigen and activity levels observed in rats suffering from diet-induced steatosis and fibrosis (11). Several previous studies have, however, reported conflicting data on a potential functional role of ADAMTS13 in the pathogenesis of liver diseases [reviewed in (12)]. A beneficial effect of ADAMTS13 activity was observed on liver disease severity, and increased ADAMTS13 activity was associated with an improved prognosis of liver cirrhosis (13), alcoholic hepatitis (14) and hepatic veno-occlusive disease (15). In contrast, a detrimental effect of ADAMTS13 was reported on hepatocellular carcinoma risk in patients suffering from chronic liver disease (16). Thus, it remains unclear whether NASH is associated with increased or decreased levels of ADAMTS13, nor whether ADAMTS13 serves a functional role in its development. In order to resolve these apparent contradictions, we have subjected wild-type and Adamts13 deficient mice to a steatosis-inducing diet.
Materials and methods
Animal model
Male (n=2) and female (n=2) heterozygous Adamts13+/− mice were provided by Professor David Ginsburg (Howard Hughes Medical Institute, University of Michigan, Ann Arbor, MI, USA) and were crossed to generate Adamts13 deficient (Adamts13−/−) and wild-type (WT) littermates (genetic background, C57Bl6/Jx129X1/SvxCASA/RK). Male Adamts13−/− (n=20) and WT (n=10) mice were used and genotyped as previously described (17,18). The mice were kept from the age of 5 weeks in individual micro-isolation cages on a 12 h day/night cycle and fed for 4 weeks with a lipogenic diet devoid of methionine and choline (MCD; #02960034; MP Biomedicals, Illkirch Cedex, France) or the MCD diet supplemented with 3 g/kg DL-methionine and 2 g/kg choline chloride (control diet; MCC; #02960414; MP Biomedicals) (n=10 or 5 for Adamts13−/− or WT mice on each diet, respectively). The starting weight of the mice was 26.4±0.8 g or 27.0±1.0 g for WT mice on MCD or MCC diets, respectively, and 26.0±0.5 g or 25.4±0.7 g for Adamts13−/− mice on MCD or MCC diets, respectively. Water was available ad libitum, room temperature and relative humidity were 23°C and 26%, respectively. Body weight and food intake were measured at weekly intervals. At the end of the diet, following fasting for 6 h, blood was taken from the tail of unanesthetized mice for determination of blood glucose concentrations using the Accu-chek Performa meter and blood glucose test strips (Roche Diagnostics, Basel, Switzerland). At the end of the experiment, the mice were sedated with 60 mg/kg pentobarbital (Nembutal; Ceva Santé Animale, Libourne, France) and blood was taken from the retro-orbital sinus on trisodium citrate (0.01 M), prior to sacrifice by cervical dislocation. Platelets were counted (Cell Dyn 3200R; Abbott Diagnostics, Illinois, USA). Livers, subcutaneous (SC) and gonadal (GN) adipose tissues were removed and weighed. Portions were used for RNA or protein extraction or were fixed in 4% formaldehyde for histological analysis.
All animal experiments were approved by the University of Leuven Ethical Committee (P158-2011) and performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (19) and the EU Directive 2010/63/EU for animal experiments.
Metabolic and inflammatory parameters
Total, high density lipoprotein (HDL) and low density lipoprotein (LDL) cholesterol, triglycerides, alkaline phosphatases, alanine aminotransferase (ALT) and aspartate aminotransaminase (AST) levels in plasma were evaluated using routine clinical assays. Insulin levels in plasma were determined by ELISA (Ultrasensitive Mouse Insulin ELISA 10-1249-01; Mercodia AB, Uppsala, Sweden). The homeostasis model assessment of insulin resistance (HOMA-IR) was determined using the formula: [Fasting plasma insulin (ng/ml)x fasting blood glucose (mg/dl)]/405. Liver tissue extracts were prepared by adding alcoholic KOH (30%) to a sample of 30 mg. Samples were incubated overnight at 55°C to digest the tissue, and 1 M MgCl2 was added to the digested sample (1:1 vol/vol), mixed well, incubated on ice for 10 min and centrifuged for 30 min at 13,523 × g and room temperature. The supernatant was analyzed using the Triglycerides FS* kit (DiaSys Diagnostic Systems GmbH, Holzheim, Germany).
Histological and microscopic analysis
Liver samples were fixed in 4% buffered formaldehyde and embedded in paraffin. Sections (4 µm) were stained with hematoxylin-eosin (H&E) or Picrosirius Red to assess steatosis or fibrosis, respectively. All liver biopsies were analyzed by an expert liver pathologist, blinded to the genotype and diet. Steatosis and fibrosis were diagnosed and semiquantitatively scored according to the NASH-Clinical Research Network criteria (20,21). Hepatocyte ballooning was classified as 0 (none), 1 (few) or 2 (numerous cells/prominent ballooning). Foci of lobular inflammation were scored as 0 (no foci), 1 (<2 foci per ×200 field), 2 (2–4 foci per ×200 field) and 3 (>4 foci per ×200 field). Fibrosis was scored as stage F0 (no fibrosis), stage F1a (mild, zone 3, perisinusoidal fibrosis), stage F1b (moderate, zone 3, perisinusoidal fibrosis), stage F1c (portal/periportal fibrosis), stage F2 (perisinusoidal and portal/periportal fibrosis), stage F3 (bridging fibrosis) and stage F4 (cirrhosis). Severity of the disease was assessed using the NAFLD activity score (NAS) as the unweighted sum of scores of steatosis, hepatocyte ballooning and lobular inflammation (22). Percentage of fibrosis was quantitated by morphometry from digitalized Picrosirius Red stained sections (23).
RNA extraction and expression analysis
RNA extraction from livers was performed using the RNeasy Mini kit (Qiagen, Basel, Switzerland) according to the manufacturer's protocol. A total of 10 ng/µl RNA was reverse transcribed into cDNA using the Multiscribe™ Reverse Transcriptase kit (Life Technologies; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's protocol. Reverse transcription-quantitative polymerase chain reaction was completed in the ABI 7500 Fast Sequence detector (Life Technologies; Thermo Fisher Scientific, Inc.) to detect the markers listed in Table I. Thermocycling conditions were as follows: Fast mode run of 40 cycles of 20 sec at 95°C, 3 sec at 95°C and 30 sec at 60°C. The reaction mixture contained 5 µl TaqMan Fast Universal PCR Master Mix (2X; Life Technologies; Thermo Fisher Scientific, Inc.), 0.5 µl TaqMan Gene Expression assay (see Table I; Life Technologies; Thermo Fisher Scientific, Inc.) and 2 µl cDNA diluted with RNase-free water to a total volume of 10 µl. For ADAMTS13 expression, probe (0.2 µl; 1:10 diluted probe; Life Technologies; Thermo Fisher Scientific, Inc.), and forward and reverse primers (0.3 µl; 1:10 diluted primer; Life Technologies; Thermo Fisher Scientific, Inc.) were used instead of TaqMan Gene Expression assays. The sequences of the probe, and forward and reverse primers for ADAMTS13 expression were as follows: Forward primer, GGAGCCCAAGGATGTGTGTCTT; reverse primer, TCTCTGGAGGTGAGAGGGAGGAT; and probe, 6FAM (reporter dye) CTTGGCCACCATGCT MGBNFQ (non-fluorescent quencher with maximum sensitivity). Analyses were performed using the ∆∆Cq method (24) using the 7500 System SDS software (Life Technologies; Thermo Fisher Scientific, Inc.). Normalization was conducted to correct for fluctuations caused by sample differences. Fold changes for MCD diet fed mice were calculated as 2−∆∆Cq relative to the MCC diet. β-actin was used as the housekeeping gene.
Table I.Markers detected by reverse transcription-quantitative polymerase chain reaction using TaqMan gene expression assays. |
VWF and ADAMTS13 antigen levels
Murine VWF and ADAMTS13 antigen levels in the plasma were measured using ELISA assays made in the Laboratory for Thrombosis Research (Department of Chemistry, University of Leuven Kulak Campus, Kortrijk, Belgium), as previously described (25,26).
Statistical analysis
Data are presented as the means ± standard error of. Statistical significance between groups was analyzed with the non-parametric Mann-Whitney U test. Analysis of the data was performed using Prism, version 6 (GraphPad Software, Inc., San Diego, CA, USA). P<0.05 was considered to indicate a statistically significant difference.
Results
The effects of the MCD diet were determined on body weight and liver function in WT and Adamts13−/− mice (Fig. 1). Feeding WT and Adamts13−/− mice with the MCD diet for 4 weeks, as compared with the control MCC diet, resulted in rapid and progressive weight loss for the two genotypes (Fig. 1A). Food intake was comparable for WT and Adamts13−/− mice kept on MCC (3.3 vs. 3.0 g/mouse/day) or on MCD diet (2.4 vs. 2.2 g/mouse/day). At the end of the diets, total body weight was comparable for WT and Adamts13−/− mice on the MCC (30.0±1.4 vs. 27.4±0.6 g) and MCD diets (17.2±0.4 vs. 17±0.4 g). As predicted, the SC and GN fat mass levels were significantly reduced for in each genotype comparing the MCD and MCC diets (Fig. 1B and C).
For WT mice, plasma ADAMTS13 antigen levels were not significantly different between the MCC and MCD diets (183±12 vs. 205±17% of pooled plasma), and relative expression of Adamts13 mRNA in the liver was also comparable on the two diets (0.91±0.07 vs. 1.0±0.05). VWF antigen levels were comparable for the genotypes on either diet (Table II). However, platelet counts were significantly lower for Adamts13−/− fed the MCD when compared with MCC, however this was not observed in WT mice (Table II). Analysis of plasma metabolic parameters (Table II) identified for MCD vs. MCC diets for the two genotypes: i) Lower glucose levels; ii) lower total and HDL cholesterol levels; iii) higher LDL cholesterol levels (P<0.05 for Adamts13−/− mice only); and iv) comparable triglyceride levels. Insulin levels were markedly lower in MCD vs. MCC diet (significant for the Adamts13−/− mice due to small sample sizes for WT mice), and were reduced for Adamts13−/− vs. WT mice on MCC. Thus, HOMA-IR identified higher insulin sensitivity for Adamts13−/− mice on the MCC diet (Table II).
Table II.Plasma levels of metabolic parameters, liver enzymes, endogenous VWF and platelet count of WT and Adamts13−/− mice kept on MCC or MCD diets for 4 weeks. |
Total liver weight was reduced upon MCD feeding, however was not affected by the genotype (Fig. 1D). The liver enzymes AST and ALT were markedly higher in MCD fed as compared with MCC fed mice, however were not different between genotypes (Table II). Liver triglyceride levels were additionally enhanced upon MCD feeding, however were not affected by the genotype (Fig. 1E).
The effects of the MCD diet were determined on steatohepatitis in WT and Adamts13−/− mice (Fig. 2). H&E staining of liver sections identified more pronounced steatosis in MCD as compared with MCC fed mice of both genotypes (Fig. 2A), as confirmed by quantitative analysis (Fig. 1F). Further histological analysis of liver sections identified that following 4 weeks of MCC diet, WT (3/5 with score 1) and Adamts13−/− (3/10 with score 1) mice exhibited only mild steatosis, whereas they all scored 0 for hepatocyte ballooning, lobular inflammation and fibrosis (Fig. 2A and Table III). However, following MCD feeding, WT and Adamts13−/− mice presented with histological abnormalities with markedly enhanced scores for steatosis, ballooning, lobular inflammation and NAS without, however, significant differences between genotypes (Fig. 2C). In addition, fibrosis stage and score were deteriorated in MCD vs. MCC fed mice, however no clear effect of genotype was observed (Fig. 2B and Table III).
Relative expression of markers of triglyceride metabolism, fibrosis and inflammation were not markedly affected by genotype on either diet (data not shown). Histological observations on steatosis and fibrosis were compatible with markedly enhanced gene expression of the steatosis maker CD36 and the fibrosis marker TIMP-1 for MCD vs. MCC fed mice of the two genotypes (Fig. 3A and B). Analysis of hepatic inflammatory markers identified enhanced expression of TNF-α for WT mice on MCD as compared with MCC feeding (Fig. 3C).
Discussion
Deficiency of ADAMTS13, the VWF cleaving proteinase, results in thrombotic thrombocytopenic purpura (TTP), a rare however severe thrombotic disease (27). A functional role of ADAMTS13 has also been suggested in liver diseases, however the available data remain controversial (12). It has been previously demonstrated that ADAMTS13 antigen and activity levels are enhanced in obese mice, whereas ADAMTS13 deficiency does not affect development of NASH in obese mice (28,29). In the present study, it was observed that a steatosis-inducing diet, independent of obesity, induces NASH to a comparable extent in Adamts13 deficient and WT mice.
In patients, visceral obesity is frequently associated with NAFLD and NASH. These conditions may be associated with reduced ADAMTS13 activity, as reported in an obese patient with recurrent TTP; defective ADAMTS13 synthesis was suggested as a possible consequence of NASH (30). Furthermore, an apparent paradox with respect to the potential role of ADAMTS13 in development of acute liver failure has been recognized (12). ADAMTS13 activity has been identified to be inversely associated with disease severity and outcome, whereas by contrast, no ultralarge VWF multimers were identified in the systemic circulation, and high molecular weight VWF levels and VWF function were reduced in patients with acute liver failure as compared with healthy controls (31).
Due to the fact that NASH is difficult to study in humans due to slow progression of the disease and ethical considerations, animal models of NASH are crucial to improve the understanding of the pathogenesis of the disease. The model of feeding rodents with an MCD used in the present study is one of the most commonly used in NASH research (32–35). It is characterized by macrovesicular steatosis, hepatocellular death, inflammation, oxidative stress and fibrosis. Due to this diet, the mice lose weight and the metabolic profile is opposite to that of typical human NASH, e.g. the mice do not develop hyperlipidemia or hypertriglyceridemia and do not present with insulin resistance. However, liver injury and steatohepatitis are histologically similar to that of human patients (36–38). The severity of NASH induced in rodents by the MCD diet depends on the administration scheme, however is also affected by species, gender and the animal strain (39,40). Using the administration scheme used in the present study (4 weeks of MCD/MCC), a protective effect of the ADAMTS5 deficiency (C57Bl/6J background) on development of NASH was identified (41). A similar administration scheme was used by Rinella et al (35). Although a time course was not performed, different effects of ADAMTS13 deficiency at earlier time points (e.g. two weeks) cannot be excluded.
It was reported that steatosis in mice kept on the MCD diet develops within 2–4 weeks and there is progression to fibrosis by 8–10 weeks (42–44). The mice in the current study developed steatosis on the 4-week diet, which was not restricted to centrolobular or periportal liver portions, however was diffusely spread throughout the liver tissue. More pronounced steatosis and higher liver triglyceride levels were identified upon MCD feeding of the two genotypes, however no differences between the genotypes were observed. No mice developed severe fibrosis, although mRNA expression of the fibrosis markers TIMP-1 and TGF-β in the liver tissue were enhanced following the short-term MCD diet. These results were supported by similar hepatic expression profiles of steatosis and fibrosis markers for the two genotypes. The liver enzymes alkaline phosphatases, AST and ALT were enhanced on the MCD diet, indicating liver damage, however without marked differences between genotypes. Platelet counts appeared lower following MCD diet feeding, which was most pronounced in Adamts13−/− mice. To the best of our knowledge, this has not been reported previously and remains to be fully elucidated.
In the present study, it was observed that the WT and the Adamts13 deficient mice fed with the MCD diet lose weight and present with low fasting blood glucose, however do not develop insulin resistance, which is in agreement with previous studies (32,33,38). Improved insulin sensitivity upon MCD feeding of the two genotypes was observed, whereas HOMA-IR was lower for Adamts13−/− vs. WT mice on either diet. By contrast, it has been previously observed that in mice with high fat induced obesity, glucose and insulin sensitivity did not differ between WT and Adamts13−/− mice (28).
Taken together, the results of the present study and previous data from the literature (28) do not support a functional role for ADAMTS13 in the development of steatohepatitis in mouse models of diet-induced steatosis. This is in agreement with a recent study in patients with NASH, demonstrating that plasma ADAMTS13 levels were not different from that of the controls (45).
Acknowledgements
The authors would like to thank Mrs. Liesbeth Frederix, Ms. Inge Vorsters and Ms. Christine Vranckx for technical support. The Center for Molecular and Vascular Biology and the Laboratory of Thrombosis Research are supported by the ‘Programma financiering KU Leuven’ (PF10/014). The current study was additionally supported by the ‘Fonds voor Wetenschappelijk Onderzoek Vlaanderen’ of the Flemish government (FWO grant G.0D13.15 N and KU Leuven grant OT/14/071 to Professor Karen Vanhoorelbeke).
References
Cassiman D and Jaeken J: NASH may be trash. Gut. 57:141–144. 2008. View Article : Google Scholar : PubMed/NCBI | |
Powell EE, Cooksley WG, Hanson R, Searle J, Halliday JW and Powell LW: The natural history of nonalcoholic steatohepatitis: A follow-up study of forty-two patients for up to 21 years. Hepatology. 11:74–80. 1990. View Article : Google Scholar : PubMed/NCBI | |
Harrison SA, Torgerson S and Hayashi PH: The natural history of nonalcoholic fatty liver disease: A clinical histopathological study. Am J Gastroenterol. 98:2042–2047. 2003. View Article : Google Scholar : PubMed/NCBI | |
Cohen JC, Horton JD and Hobbs HH: Human fatty liver disease: Old questions and new insights. Science. 332:1519–1523. 2011. View Article : Google Scholar : PubMed/NCBI | |
Bedogni G, Miglioli L, Masutti F, Tiribelli C, Marchesini G and Bellentani S: Prevalence of and risk factors for nonalcoholic fatty liver disease: The Dionysos nutrition and liver study. Hepatology. 42:44–52. 2005. View Article : Google Scholar : PubMed/NCBI | |
Blachier M, Leleu H, Peck-Radosavljevic M, Valla DC and Roudot-Thoraval F: The burden of liver disease in Europe: A review of available epidemiological data. J Hepatol. 58:593–608. 2013. View Article : Google Scholar : PubMed/NCBI | |
Sanyal AJ; American Gastroenterological Association, : AGA technical review on nonalcoholic fatty liver disease. Gastroenterology. 123:1705–1725. 2002. View Article : Google Scholar : PubMed/NCBI | |
Neuschwander-Tetri BA: Nonalcoholic steatohepatitis and the metabolic syndrome. Am J Med Sci. 330:326–335. 2005. View Article : Google Scholar : PubMed/NCBI | |
Le Goff C and Cormier-Daire V: The ADAMTS(L) family and human genetic disorders. Hum Mol Genet. 20:R163–R167. 2011. View Article : Google Scholar : PubMed/NCBI | |
Uemura M, Tatsumi K, Matsumoto M, Fujimoto M, Matsuyama T, Ishikawa M, Iwamoto TA, Mori T, Wanaka A, Fukui H and Fujimura Y: Localization of ADAMTS13 to the stellate cells of human liver. Blood. 106:922–924. 2005. View Article : Google Scholar : PubMed/NCBI | |
Watanabe N, Ikeda H, Kume Y, Satoh Y, Kaneko M, Takai D, Tejima K, Nagamine M, Mashima H, Tomiya T, et al: Increased production of ADAMTS13 in hepatic stellate cells contributes to enhanced plasma ADAMTS13 activity in rat models of cholestasis and steatohepatitis. Thromb Haemost. 102:389–396. 2009.PubMed/NCBI | |
Uemura M, Fujimura Y, Ko S, Matsumoto M, Nakajima Y and Fukui H: Pivotal role of ADAMTS13 function in liver diseases. Int J Hematol. 91:20–29. 2010. View Article : Google Scholar : PubMed/NCBI | |
Takaya H, Uemura M, Fujimura Y, Matsumoto M, Matsuyama T, Kato S, Morioka C, Ishizashi H, Hori Y, Fujimoto M, et al: ADAMTS13 activity may predict the cumulative survival of patients with liver cirrhosis in comparison with the Child-Turcotte-Pugh score and the model for end-stage liver disease score. Hepatol Res. 42:459–472. 2012. View Article : Google Scholar : PubMed/NCBI | |
Uemura M, Matsuyama T, Ishikawa M, Fujimoto M, Kojima H, Sakurai S, Ishii S, Toyohara M, Yamazaki M, Yoshiji H, et al: Decreased activity of plasma ADAMTS13 may contribute to the development of liver disturbance and multiorgan failure in patients with alcoholic hepatitis. Alcohol Clin Exp Res. 29 12 Suppl:264S–271S. 2005. View Article : Google Scholar : PubMed/NCBI | |
Matsumoto M, Kawa K, Uemura M, Kato S, Ishizashi H, Isonishi A, Yagi H, Park YD, Takeshima Y, Kosaka Y, et al: Prophylactic fresh frozen plasma may prevent development of hepatic VOD after stem cell transplantation via ADAMTS13-mediated restoration of von Willebrand factor plasma levels. Bone Marrow Transplant. 40:251–259. 2007. View Article : Google Scholar : PubMed/NCBI | |
Ikeda H, Tateishi R, Enooku K, Yoshida H, Nakagawa H, Masuzaki R, Kondo Y, Goto T, Shiina S, Kume Y, et al: Prediction of hepatocellular carcinoma development by plasma ADAMTS13 in chronic hepatitis B and C. Cancer Epidemiol Biomarkers Prev. 20:2204–2211. 2011. View Article : Google Scholar : PubMed/NCBI | |
Motto DG, Chauhan AK, Zhu G, Homeister J, Lamb CB, Desch KC, Zhang W, Tsai HM, Wagner DD and Ginsburg D: Shigatoxin triggers thrombotic thrombocytopenic purpura in genetically susceptible ADAMTS13-deficient mice. J Clin Invest. 115:2752–2761. 2005. View Article : Google Scholar : PubMed/NCBI | |
de Maeyer B, de Meyer SF, Feys HB, Pareyn I, Vandeputte N, Deckmyn H and Vanhoorelbeke K: The distal carboxyterminal domains of murine ADAMTS13 influence proteolysis of platelet-decorated VWF strings in vivo. J Thromb Haemost. 8:2305–2312. 2010. View Article : Google Scholar : PubMed/NCBI | |
Council NR: Guide for the Care and Use Laboratoy Animals. 7th. Washington, DC: National Academy Press; 1996 | |
Kleiner DE, Brunt EM, van Natta M, Behling C, Contos MJ, Cummings OW, Ferrell LD, Liu YC, Torbenson MS, Unalp-Arida A, et al: Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology. 41:1313–1321. 2005. View Article : Google Scholar : PubMed/NCBI | |
Verbeek J, Lannoo M, Pirinen E, Ryu D, Spincemaille P, Elst I Vander, Windmolders P, Thevissen K, Cammue BP, van Pelt J, et al: Roux-en-y gastric bypass attenuates hepatic mitochondrial dysfunction in mice with non-alcoholic steatohepatitis. Gut. 64:673–683. 2015. View Article : Google Scholar : PubMed/NCBI | |
Bedossa P, Poitou C, Veyrie N, Bouillot JL, Basdevant A, Paradis V, Tordjman J and Clement K: Histopathological algorithm and scoring system for evaluation of liver lesions in morbidly obese patients. Hepatology. 56:1751–1759. 2012. View Article : Google Scholar : PubMed/NCBI | |
Bedossa P, Dargère D and Paradis V: Sampling variability of liver fibrosis in chronic hepatitis C. Hepatology. 38:1449–1457. 2003. View Article : Google Scholar : PubMed/NCBI | |
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2 (−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
Verhenne S, Denorme F, Libbrecht S, Vandenbulcke A, Pareyn I, Deckmyn H, Lambrecht A, Nieswandt B, Kleinschnitz C, Vanhoorelbeke K and De Meyer SF: Platelet-derived VWF is not essential for normal thrombosis and hemostasis but fosters ischemic stroke injury in mice. Blood. 126:1715–1722. 2015. View Article : Google Scholar : PubMed/NCBI | |
Deforche L, Tersteeg C, Roose E, Vandenbulcke A, Vandeputte N, Pareyn I, de Cock E, Rottensteiner H, Deckmyn H, De Meyer SF and Vanhoorelbeke K: Generation of anti-murine ADAMTS13 antibodies and their application in a mouse model for acquired thrombotic thrombocytopenic purpura. PLoS One. 11:e01603882016. View Article : Google Scholar : PubMed/NCBI | |
Murrin RJ and Murray JA: Thrombotic thrombocytopenic purpura: Aetiology, pathophysiology and treatment. Blood Rev. 20:51–60. 2006. View Article : Google Scholar : PubMed/NCBI | |
Geys L, Scroyen I, Roose E, Vanhoorelbeke K and Lijnen HR: ADAMTS13 deficiency in mice does not affect adipose tissue development. Biochim Biophys Acta. 1850:1368–1374. 2015. View Article : Google Scholar : PubMed/NCBI | |
Geys L, Bauters D, Roose E, Tersteeg C, Vanhoorelbeke K, Hoylaerts MF, Lijnen RH and Scroyen I: ADAMTS13 deficiency promotes microthrombosis in a murine model of diet-induced liver steatosis. Thromb Haemost. 117:19–26. 2017. View Article : Google Scholar : PubMed/NCBI | |
Lombardi AM, Fabris R, de Marinis G Berti, Marson P, Navaglia F, Plebani M, Vettor R and Fabris F: Defective ADAMTS13 synthesis as a possible consequence of NASH in an obese patient with recurrent thrombotic thrombocytopenic purpura. Eur J Haematol. 92:497–501. 2014. View Article : Google Scholar : PubMed/NCBI | |
Hugenholtz GC, Adelmeijer J, Meijers JC, Porte RJ, Stravitz RT and Lisman T: An unbalance between von Willebrand factor and ADAMTS13 in acute liver failure: Implications for hemostasis and clinical outcome. Hepatology. 58:752–761. 2013. View Article : Google Scholar : PubMed/NCBI | |
Takahashi Y, Soejima Y and Fukusato T: Animal models of nonalcoholic fatty liver disease/nonalcoholic steatohepatitis. World J Gastroenterol. 18:2300–2308. 2012. View Article : Google Scholar : PubMed/NCBI | |
Machado MV, Michelotti GA, Xie G, Pereira T Almeida, Boursier J, Bohnic B, Guy CD and Diehl AM: Mouse models of diet-induced nonalcoholic steatohepatitis reproduce the heterogeneity of the human disease. PLoS One. 10:e01279912015. View Article : Google Scholar : PubMed/NCBI | |
Caballero F, Fernández A, Matías N, Martínez L, Fucho R, Elena M, Caballeria J, Morales A, Fernández-Checa JC and García-Ruiz C: Specific contribution of methionine and choline in nutritional nonalcoholic steatohepatitis: Impact on mitochondrial S-adenosyl-L-methionine and glutathione. J Biol Chem. 285:18528–18536. 2010. View Article : Google Scholar : PubMed/NCBI | |
Rinella ME, Elias MS, Smolak RR, Fu T, Borensztajn J and Green RM: Mechanisms of hepatic steatosis in mice fed a lipogenic methionine choline-deficient diet. J Lipid Res. 49:1068–1076. 2008. View Article : Google Scholar : PubMed/NCBI | |
Weltman MD, Farrell GC and Liddle C: Increased hepatocyte CYP2E1 expression in a rat nutritional model of hepatic steatosis with inflammation. Gastroenterology. 111:1645–1653. 1996. View Article : Google Scholar : PubMed/NCBI | |
Weltman MD, Farrell GC, Hall P, Ingelman-Sundberg M and Liddle C: Hepatic cytochrome P450 2E1 is increased in patients with nonalcoholic steatohepatitis. Hepatology. 27:128–133. 1998. View Article : Google Scholar : PubMed/NCBI | |
Rinella ME and Green RM: The methionine-choline deficient dietary model of steatohepatitis does not exhibit insulin resistance. J Hepatol. 40:47–51. 2004. View Article : Google Scholar : PubMed/NCBI | |
Fan JG and Qiao L: Commonly used animal models of non-alcoholic steatohepatitis. Hepatobiliary Pancreat Dis Int. 8:233–240. 2009.PubMed/NCBI | |
Kirsch R, Clarkson V, Shephard EG, Marais DA, Jaffer MA, Woodburne VE, Kirsch RE and Pde L Hall: Rodent nutritional model of non-alcoholic steatohepatitis: Species, strain and sex difference studies. J Gastroenterol Hepatol. 18:1272–1282. 2003. View Article : Google Scholar : PubMed/NCBI | |
Bauters D, Spincemaille P, Geys L, Cassiman D, Vermeersch P, Bedossa P, Scroyen I and Lijnen RH: ADAMTS5 deficiency protects against non-alcoholic steatohepatitis (NASH) in obesity. Liver Int. 36:1848–1859. 2016. View Article : Google Scholar : PubMed/NCBI | |
Pena A Dela, Leclercq I, Field J, George J, Jones B and Farrell G: NF-kappaB activation, rather than TNF, mediates hepatic inflammation in a murine dietary model of steatohepatitis. Gastroenterology. 129:1663–1674. 2005. View Article : Google Scholar : PubMed/NCBI | |
Leclercq IA, Farrell GC, Field J, Bell DR, Gonzalez FJ and Robertson GR: CYP2E1 and CYP4A as microsomal catalysts of lipid peroxides in murine nonalcoholic steatohepatitis. J Clin Invest. 105:1067–1075. 2000. View Article : Google Scholar : PubMed/NCBI | |
Ip E, Farrell G, Hall P, Robertson G and Leclercq I: Administration of the potent PPARalpha agonist, Wy-14,643, reverses nutritional fibrosis and steatohepatitis in mice. Hepatology. 39:1286–1296. 2004. View Article : Google Scholar : PubMed/NCBI | |
Potze W, Siddiqui MS, Boyett SL, Adelmeijer J, Daita K, Sanyal AJ and Lisman T: Preserved hemostatic status in patients with non-alcoholic fatty liver disease. J Hepatol. 65:980–987. 2016. View Article : Google Scholar : PubMed/NCBI |