Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2018 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains

  • Authors:
    • Rong Liu
    • Xiaoxing Liao
    • Xin Li
    • Hongyan Wei
    • Qing Liang
    • Zuopeng Zhang
    • Meixian Yin
    • Xiaoyun Zeng
    • Zijing Liang
    • Chunlin Hu
  • View Affiliations / Copyright

    Affiliations: Department of Emergency, The First Affiliated Hospital, Guangzhou Medical University, Guangzhou, Guangdong 510120, P.R. China, Department of Emergency, The First Affiliated Hospital, Sun Yat‑sen University, Guangzhou, Guangdong 510080, P.R. China, Department of Emergency, Guangdong Provincial People's Hospital, Guangzhou, Guangdong 510080, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 6413-6424
    |
    Published online on: March 7, 2018
       https://doi.org/10.3892/mmr.2018.8703
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

To investigate long noncoding (lnc)-RNA and mRNA expression profiles in post‑cardiac arrest (CA) brains, an external transthoracic electrical current was applied for 8 min to induce CA (the CA group). A total of 4 rats received sham-operations and served as the blank control (BC) group. Upon return of spontaneous circulation (ROSC), lncRNA and mRNA expression in the rat cerebral cortex was assayed with high‑throughput Agilent lncRNA and mRNA microarrays. In total, 37 lncRNAs were upregulated and 21 lncRNAs were downregulated in the CA group, and 258 mRNA transcripts were differentially expressed with 177 mRNAs upregulated and 81 mRNAs downregulated in the CA group. The differentially expressed lncRNAs in the CA group were co‑expressed with thousands of mRNAs. The differentially expressed lncRNAs could be clustered into >100 signaling pathways and processes according to Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes analyses. The most common predicted functions involved metabolic pathways, protein synthesis, transport and degradation during CA‑ROSC. CA‑ROSC led to significant alterations in cerebral lncRNA and mRNA expression profiles. Thus, lncRNA‑mRNA network interactions have the potential to regulate vital metabolic pathways and processes involved in CA-ROSC.

Introduction

Cardiac arrest (CA) is a very dangerous state of shock and is a common cause of mortality and disability because the whole body suffers from severe ischemia, including the cerebellum, thalamus, hippocampus, and cortex (1,2). Even if CA patients receive timely restoration of spontaneous circulation (ROSC), ischemia still may occur leading to an ischemia/reperfusion (I/R) injury, which includes apoptosis and necrosis of neurons and activation of multiple pathogenic mechanisms (1). The poor outcomes in CA patients due to these distinct pathologies is termed post-CA syndrome (2). The probability that CA patients will recover after ROSC is increasing because of increasing public knowledge of cardiopulmonary resuscitation (CPR), significant improvements in the construction of emergency networks, and rapid progress in rescue technology. Early diagnosis and proper evaluation of the severity of brain damage is necessary for good prognoses in CA patients. However, the exact etiology of I/R injury remains poorly understood in CA, and the cerebral pathology of I/R injury and the molecular mechanisms of I/R after CA-ROSC remains to be elucidated.

Thousands of messenger RNAs (mRNAs) are continuously transcribed and guide the translation of various proteins in the adult mammalian brain during pathological states. The transcriptional and translational machinery is comprised of a variety of molecules, such as DNA methylases, transcription factors, ribosomes, and RNA polymerases. Recently, noncoding RNAs have been shown to potently regulate gene expression at the levels of transcription and translation (3). These noncoding RNAs participate in cellular, developmental, and disease processes by regulating RNA and protein levels, imprinting, enhancer function, and transcription (4–7). Long noncoding RNAs (lncRNAs) are a relatively new class of RNA molecules that are longer than 200 nucleotides and much less well characterized than microRNAs. Cerebral lncRNA profiles have been shown to be markedly altered in many pathological states, to play important roles in the pathophysiology of central nervous system and brain-related diseases and disorders, and to have profound effects on disease outcomes (8–11). Notably, studies have also shown that lncRNAs are associated with I/R brain injury (11,12).

However, cerebral lncRNA profiles after CA-ROSC, including a complete list of lncRNAs expressed in the brain, have yet to be elucidated. In addition, the potential roles and effects of these lncRNAs on mRNA expression during the early stage of reperfusion have yet to be determined. Undoubtedly, understanding lncRNA and mRNA network profiles in post-CA brains could inform the development of therapeutics to prevent secondary neuronal death caused by CA. In this study, we used a rat model to explore lncRNA and mRNA network profiles in cortical pathophysiological processes to further understand the etiology and molecular mechanisms of cerebral pathology during an I/R injury.

Materials and methods

Animals

Male Wistar rats (15–16 months old and 305.5–400.3 g) were obtained from the Experimental Animal Center, Sun Yat-Sen University, Guangdong Province (Guangzhou, China). Animals were housed in a pathogen-free laboratory at 20–22°C with a 10 h light and 14 h dark cycle. The animal studies were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University and the procedures used were in accordance with the Animal Research Reporting for in vivo Experiments Guidelines on animal research (13).

Induction of ventricular fibrillation (VF)

After fasting overnight (with access to water), 14 healthy male Wistar rats were anesthetized by intraperitoneal pentobarbital injection (30 mg/kg; Sigma, Natick, MA, USA). VF was induced as described previously (14,15). VF was successfully induced by alternating current (50 Hz, 6 V) for 10 sec with external transthoracic needles. After successful induction of VF, the ventilator was disconnected. Eight min after VF, manual chest compressions were performed on the rats along with mechanical ventilation. Rats were maintained for 24 h after successful ROSC (CA, n=14). Seven sham-operated rats served as the blank control (BC, n=7). 5 rats in model group and 4 in sham group were anesthetized by intraperitoneal pentobarbital injection (40 mg/kg; Sigma), and were sacrificed by decapitation at ROSC 2 h, the cerebral cortex tissue were harvested for RNA analysis. The rest rats were survival to 24 h after ROSC and their neurological deficits scores (NDS) were assessed from 0 (no observed neurological deficit) to 500 (death or brain death) (14,15) by 2 investigators who were blinded to the treatment. All of the other animals were sacrificed at 24 h after ROSC; the brains were removed and were fixed using paraffin for Nissl and TdT-mediated dUTP-biotin nick end labeling (TUNEL) staining, the apoptotic cells were counted randomly 6 fields in sequence slice in each group. All rats were anesthetized by intraperitoneal pentobarbital injection (40 mg/kg) and were sacrificed by decapitation.

Tissue harvest and RNA extraction

The rat brains were harvested and the cerebral cortices were dissected quickly on ice. Samples of cerebral cortex tissue were quick-frozen in liquid nitrogen and stored at −80°C for future use. Total RNAs were extracted with TRIzol reagent, quantified (NanoDrop ND-2000; Thermo Fisher Scientific, Inc., Pittsburgh, PA, USA), and analyzed for integrity (Agilent Bioanalyzer 2100; Agilent Technologies, Inc., Santa Clara, CA, USA). RNA labeling and microarray hybridization were performed according to standard protocols provided by the manufacturer.

LncRNA and mRNA microarray expression profiling

Total RNAs (100 ng) were labeled with the mRNA Complete Labeling and Hyb kit and hybridized on OE Biotech Rat lncRNA Microarray v2.0 8×60K (both Agilent Technologies, Inc.). This microarray contained 40,367 probes for 30,367 rat mRNAs and 10,000 rat lncRNAs derived from authoritative databases, including Ensembl, RefSeq, Ultra-conserved region encoding LncRNA (UCR), and lncRNAdb.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

To validate the differentially expressed lncRNAs, quantitative RT-PCR was performed using a two-step reaction, which included RT and PCR, according to the manufacturer's instructions. Each RT reaction consisted of 0.5 µg of RNA, 2 µl of PrimerScript Buffer, 0.5 µl of oligo dT, 0.5 µl of random 6-mers, and 0.5 µl of PrimerScript RT Enzyme Mix I (Takara Bio, Inc., Otsu, Japan) in a total volume of 10 µl. RT reactions were performed in a GeneAmp® PCR System 9700 (Applied Biosystems; Thermo Fisher Scientific, Inc.) for 15 min at 37°C followed by heat inactivation for 5 sec at 85°C. The 10 µl RT reaction mix was then diluted 10-fold in nuclease-free water and stored at −20°C. RT-qPCR was performed with 10 µl of a PCR reaction mixture that contained 1 µl of cDNA, 5 µl of 2X LightCycler® 480 SYBR-Green I Master Mix, 0.2 µl of forward primer, 0.2 µl of reverse primer, and 3.6 µl of nuclease-free water in a LightCycler® 480 II Real-time PCR Instrument (both Roche Applied Science, Rotkreuz, Switzerland). Reactions were incubated in a 384-well optical plate (Roche) at 95°C for 10 min followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Each sample was run in triplicate and a melting curve analysis was performed at the end of each PCR cycle to specifically validate generation of the expected PCR product. The expression levels of lncRNAs were normalized to glyceraldehyde-3-phosphate dehydrogenase expression and were calculated using the 2−ΔΔCq method. Primers were synthesized by Generay Biotech (Generay, Shanghai, China) based on mRNA sequences in the NCBI database and the sequences are given in Table I.

Table I.

Primers for validation of differentially expressed long noncoding RNAs.

Table I.

Primers for validation of differentially expressed long noncoding RNAs.

Gene symbolForward primer (5′-3′)Reverse primer (5′-3′)
TCONS_00097275 GCCACCAGGACTGATAAT TGTGTGTGTGTGTGTACG
TCONS_00077647 ATGGTGATTCGCACTTGT TCCTTTAGCTCAGACTGGC
TCONS_00132873 GTTCAGGCAAGCTCCAAA ATCCGTGTCTGGAACATT
TCONS_00066427 CAGGTCTTCTTTACCACCGA GAGAGCAGGCAGAAGTGA
NR_002597.1 GCTGTGAGATGCAGGACAA AAGGTGGCTGCTGTATATT
TCONS_00079198 GAAGGAGTGTGGAACTCAAC CCTCTGCCATTAGACTTTGT
GAPDH GCGAGATCCCGCTAACATCA CTCGTGGTTCACACCCATCA
Analyses of microarray results and predictions of lncRNA functions

After differentially expressed mRNA and lncRNA data from microarrays were acquired, raw signals were log2 transformed. Differentially expressed mRNAs and lncRNAs were screened for absolute values of fold change (FC) >2 and P-values <0.05 (Student's t-test). The differentially expressed mRNAs were submitted to the DAVID database (http://david.abcc.ncifcrf.gov) and were classified into different annotation groups by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. Distinguishable gene expression patterns were displayed by hierarchical clustering.

Statistical analysis

All statistical analyses were performed using the SPSS software 13.0 (SPSS, Inc., Chicago, IL, USΑ). Data were presented as mean ± SD or proportions as appropriate. Unpaired student t-test were performed to compare the differences of NDS, apoptotic cells, and validating lncRNA expressions between two groups, and correlations were calculated using Spearman's correlation coefficient, which is the Pearson's correlation coefficient of the indexed ranks of the two data sets. P<0.05 by two-tailed t-test was considered to indicate a statistically significant difference.

Results

The severity of brain damage of rats after ROSC 24 h

The induction of VF caused serious injury to the brain in rats after ROSC 24 h in CPR group, 3 rats were dead within 24 h, and the other 6 rats were survival to 24 h. All rats in Sham group were alive to the end of the experiment. The NDS score in CPR group were 394±95, significantly higher than 0±0 in Sham group (P<0.001). The TUNEL staining showed that the induction of VF significantly increased the amount of apoptotic cells in the cortex, compared with that in Sham group (Fig. 1).

Figure 1.

Severity of brain damage post cardiac arrest. (A) The NDS were 394±95 and 0±0 in the CPR and Sham groups, respectively. (B) TUNEL staining revealed that the induction of VF induced severe injury to the brain. TUNEL positive cells are yellow and are indicated by white arrows (scale bars, 50 µm). (C) The number of apoptotic cells in the cortex were significantly increased compared with the Sham group (48±6 vs. 7±2/field). Data are presented as the mean ± standard deviation. ***P<0.001 vs. Sham. NDS, neurological deficits scores; TUNEL, TdT-mediated dUTP-biotin nick end labeling; CPR, cardiopulmonary resuscitation; VF, ventricular fibrillation.

Changes in lncRNA and mRNA expressions in the CA and BC groups

From the lncRNA microarray, we found 58 lncRNA transcripts that were differentially expressed. Thirty-seven of the lncRNA transcripts were upregulated and 21 of the lncRNA transcripts were downregulated in the CA group when compared with the BC group (Table II). The TCONS_00045076 (probe CUST_12461 _PI429484123) and TCONS_00087195 (probe CUST_12461_PI429484123) lncRNAs were the most upregulated and downregulated transcripts in the CA group, respectively. According to absolute FC values (abs), the differentially expressed lncRNA transcripts were divided into two groups: five transcripts with FC values between 5 and 10 (highly dysregulated lncRNAs) and 53 transcripts with FC values between 2 and 5 (less dysregulated lncRNAs).

Table II.

Differentially expressed long noncoding RNAs in cardiac arrest-return of spontaneous circulation.

Table II.

Differentially expressed long noncoding RNAs in cardiac arrest-return of spontaneous circulation.

No.lncRNAFC (abs)RegulationBCCAChromosome no.
  1TCONS_000450768.07Up 2.60±2.54 5.61±0.9414
  2TCONS_000972758.00Up 2.31±1.87 5.31±0.784
  3TCONS_000976946.75Up 2.59±2.36 5.34±1.054
  4TCONS_000587316.27Up 2.67±1.53 5.32±0.3617
  5 ENSRNOT000000311005.38Up 4.59±1.48 7.02±0.5915
  6TCONS_000450774.47Up 4.13±1.60 6.29±0.94Un_random
  7XR_146410.14.09Up 4.78±1.13 6.81±0.96Un
  8TCONS_000647194.06Up 4.55±1.23 6.57±0.89Un_random
  9XR_146719.13.70Up 4.27±1.27 6.15±0.68Un
10 ENSRNOT000000589573.69Up 7.88±0.38 9.76±0.58X
11 ENSRNOT000000308383.36Up 8.37±0.22 10.12±0.533
12XR_146012.13.34Up 7.34±0.83 9.08±0.595
13XR_146595.13.08Up 3.62±0.76 5.24±0.4714
14TCONS_000406873.08Up 4.27±0.71 5.90±0.5913
15XR_147150.13.03Up 5.74±0.80 7.34±0.73Un
16XR_146408.12.85Up 5.48±0.89 6.99±0.61Un
17TCONS_000627122.84Up 3.29±1.11 4.80±0.2718
18TCONS_001131072.76Up 4.69±0.55 6.16±0.456
19TCONS_001224102.74Up 3.52±0.40 4.98±0.997
20TCONS_000462882.68Up 3.01±0.26 4.44±0.5815
21TCONS_000090082.59Up 3.97±0.60 5.34±0.611
22TCONS_000087342.48Up 3.22±0.99 4.53±0.481
23TCONS_000664272.30Up 9.68±0.75 10.88±0.592
24TCONS_000413992.28Up 2.92±0.60 4.11±0.5314
25 ENSRNOT000000657942.25Up 3.81±0.64 4.98±0.478
26TCONS_000621922.24Up 3.52±0.32 4.69±0.2818
27TCONS_000517272.20Up 3.46±0.86 4.60±0.2716
28TCONS_000480462.20Up 4.43±0.70 5.57±0.4915
29FR1447202.16Up 3.39±0.51 4.50±0.591
30 ENSRNOT000000740212.14Up 5.38±0.50 6.48±0.612
31TCONS_001328732.11Up 8.84±0.69 9.91±0.6312
32TCONS_000658412.10Up 3.61±0.79 4.68±0.4719
33TCONS_000547762.08Up 4.69±0.39 5.75±0.3516
34TCONS_000547772.08Up 3.50±0.77 4.56±0.2416
35uc.280+2.07Up 6.95±0.69 8.01±0.393
36 ENSRNOT000000406952.04Up 6.57±0.09 7.60±0.32X_random
37uc.129+2.02Up 6.72±0.44 7.73±0.552
38TCONS_000871953.74Down 5.15±0.49 3.25±0.553
39TCONS_001297243.49Down 4.77±0.85 2.96±0.578
40TCONS_000776473.27Down 7.78±1.02 6.07±0.6820
41TCONS_000721643.16Down 4.96±0.34 3.30±1.312
42NR_002597.12.92Down 8.97±1.07 7.42±0.4820
43TCONS_000791982.73Down 6.78±0.85 5.33±0.5920
44TCONS_000461102.69Down 6.54±0.62 5.11±0.9915
45TCONS_000166402.64Down 5.00±0.28 3.60±0.451
46TCONS_001068642.38Down 5.60±0.27 4.35±0.815
47TCONS_000980872.37Down 4.94±0.43 3.69±0.084
48TCONS_001385072.36Down 5.87±0.45 4.63±0.95X
49NR_037614.12.35Down 5.90±0.22 4.66±0.948
50XR_145894.12.34Down 5.56±0.72 4.34±0.383
51TCONS_001321902.23Down 7.32±0.84 6.17±0.589
52TCONS_000401992.22Down 5.07±0.58 3.92±0.6813
53TCONS_000405142.16Down 4.91±0.52 3.80±0.7613
54XR_145922.12.14Down 8.05±0.69 6.95±0.434
55TCONS_000627652.10Down 5.11±0.73 4.04±0.5318
56TCONS_000210352.05Down 5.72±0.19 4.69±0.5310
57TCONS_000664382.04Down 4.18±0.21 3.15±0.68n/a
58TCONS_001223162.00Down 3.84±0.39 2.83±0.717

[i] BC and CA data are presented as the mean ± standard deviation. FC (abs), absolute fold change; BC, blank control; CA, cardiac arrest; n/a, not available.

Using the same criteria that we used for the lncRNAs, we found 258 differentially expressed mRNA transcripts. 177 of the transcripts in the CA group were upregulated and 81 of the transcripts in the CA group were downregulated when compared with the BC group. The NM_001106299 (A_43_P16887) and NM_001033691 (A_44_P1039994) mRNAs were the most upregulated and downregulated transcripts in the CA group, respectively. Some of the differentially expressed mRNAs (FC>4) are listed in Table III; the un-named mRNAs are listed by their probe names, such as A_44_P809486.

Table III.

Differentially expressed mRNAs in cardiac arrest-return of spontaneous circulation.

Table III.

Differentially expressed mRNAs in cardiac arrest-return of spontaneous circulation.

No.mRNAFC (abs)RegulationBCCAChromosome no.
  1Ahsp38.62Up 1.98±3.43 7.25±2.12  1
  2Ptges18.56Up 3.27±3.51 7.48±0.88  3
  3Egr413.98Up 2.45±2.89 6.25±1.23  4
  4Six311.17Up 2.93±3.11 6.41±0.95  6
  5Apold110.84Up 4.44±2.56 7.87±0.94  4
  6Gch110.10Up 3.21±2.34 6.55±1.1715
  7Msantd1   9.23Up 2.40±2.07 5.60±0.7514
  8A_64_P010891   7.52Up 2.83±1.98 5.74±1.5117
  9Trh   7.39Up 2.30±1.37 5.19±0.71  4
10Nr4a1   6.64Up 8.15±1.55 10.88±0.58  7
11Gdf15   5.72Up 3.55±1.63 6.06±0.4416
12Ptgs2   5.33Up 5.71±1.31 8.13±0.9313
13LOC688972   5.31Up 3.60±0.45 6.01±1.6919
14A_64_P058988   4.83Up 3.79±0.86 6.07±1.2819
15Grin3b   4.72Up 3.47±1.69 5.71±0.65  7
16A_44_P386579   4.69Up 3.68±1.83 5.90±0.6618
17Gadd45g   4.66Up 7.14±1.76 9.36±0.6017
18A_64_P065301   4.65Up 4.64±1.82 6.86±0.89Un
19A_64_P134263   4.63Up 3.99±1.67 6.20±0.79Un
20Tacr1   4.44Up 2.80±1.62 4.95±0.51  4
21Kcnv2   4.43Up 4.63±1.57 6.78±0.35  1
22Cenpf   4.40Up 2.55±1.61 4.68±0.9913
23Mt1a   4.29Up 9.24±0.57 11.34±0.5519
24LOC287167   4.29Up 5.25±1.57 7.35±0.8610
25Tmem252   4.26Up 5.34±1.72 7.43±0.26  1
26LOC100362110   4.17Up 5.25±1.39 7.31±0.2513
27LOC685488   4.12Up 4.87±1.36 6.91±0.7919
28Nr4a2   4.07Up 7.36±0.95 9.39±1.07  3
29Irf712.31Down 8.27±1.66 4.65±2.63  1
30RT1-A2   9.38Down 10.74±1.30 7.51±2.0720
31RT1-M6-1   7.73Down 5.98±0.29 3.03±2.3020
32A_44_P884971   6.99Down 5.53±0.39 2.72±2.23  9
33Olr59   6.30Down 5.11±0.49 2.46±2.07  1
34A_64_P033885   5.90Down 5.63±1.04 3.07±1.9218
35Enthd1   5.80Down 4.83±0.71 2.30±1.98  7
36L2hgdh   5.20Down 6.05±0.50 3.67±1.22  6
37Osr1   4.95Down 7.59±0.36 5.28±1.68  6
38Lrrc17   4.93Down 5.20±0.79 2.90±1.67  4
39Tnfsf10   4.83Down 6.66±1.00 4.39±0.69  2
40Adam33   4.46Down 5.04±0.37 2.88±1.00  3
41Ltbp2   4.19Down 5.32±0.87 3.25±0.74  6
42RGD1563091   4.03Down 5.68±0.80 3.66±0.93  4

[i] FC, fold change; BC, blank control; CA, cardiac arrest.

The microarray data were uploaded to the GEO database (GEO no. GSE108342; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE108342).

Validation of lncRNA microarray

To validate the lncRNA microarray results, three upregulated and two downregulated lncRNAs were randomly selected from the 58 differentially expressed lncRNAs and their expressions were analyzed in five CA tissues and in four BC tissues using RT-qPCR. The RT-qPCR results were consistent with the microarray results, and RT-qPCR demonstrated that the TCONS_00079198 lncRNA transcript was differentially expressed (P<0.05 using the 2-ΔΔCt method; Fig. 2). RT-qPCR analysis of the other lncRNAs transcripts demonstrated that the differential expressions were consistent with the microarray data, but were not significant (P>0.05).

Figure 2.

Validation of long noncoding RNA microarray. *P<0.05 vs. blank control (BC group).

Hierarchical clustering analysis

Differentially expressed lncRNA data were used to generate a heat map analysis of unsupervised hierarchical clustering. The differentially expressed lncRNAs clearly segregated into BC and CA clusters (Fig. 3) indicating that there was a significant difference in the lncRNA expression profiles between the CA and BC groups.

Figure 3.

Heat map comparing differentially expressed lncRNAs in BC brain samples and in CA brain samples. The differentially expressed lncRNAs segregated into BC and CA clusters. Each row represents one lncRNA, and each column represents one tissue sample. The relative lncRNA expression is depicted according to the color scale. Red and green indicates upregulation and downregulation, respectively. The values of 2.0, 0 and −2.0 are the fold changes depicted in the color spectrum. lncRNA, long noncoding RNA; BC, blank control; CA, cardiac arrest.

LncRNA and mRNA coexpression profiles

To compare lncRNA profiles with their corresponding mRNA network profiles, we calculated the Pearson correlation for the expression value of each lncRNA with the expression value of each mRNA for paired CA and BC samples (Fig. 4). Differentially expressed lncRNAs were coexpressed with thousands of mRNAs. For instance, TCONS_00087195 was coexpressed with 1,402 mRNA transcripts, and TCONS_00045076 was coexpressed with 1,293 mRNA transcripts. The top five mRNAs that correlated with TCONS_00087195 were Tcp11l1, Ppp1r15a, Asgr2, Htra4, and LOC691666, and the top five mRNAs that correlated with TCONS_00045076 were Lypd1, Fign, LOC100913068, Kcnv2, and Pcdh17. Of the 58 lncRNAs, 40 are predicted to regulate Btg1, 36 are predicted to regulate Acot12, 36 are predicted to regulate Fam65b, 41 are predicted to regulate Gm8430, 38 are predicted to regulate Hnrph1, 40 are predicted to regulate Pou6f1, 40 are predicted to regulate Sap30l, 36 are predicted to regulate Vrk1, and 38 are predicted to regulate Zfp454 (Fig. 4). These data indicate that differentially expressed lncRNAs potentially regulate mRNA expression and form a complex lncRNA-mRNA interaction network during CA.

Figure 4.

The majority of the mRNAs were predicted to be regulated by the differentially expressed lncRNAs. The top lncRNA-mRNA pairs are the most credible. Solid green circles represent mRNAs and solid red arrowheads represent lncRNAs. The edges between the circles and the arrowheads indicate potential regulation of the mRNAs by the lncRNAs. lncRNA, long noncoding RNA; mRNA, messenger RNA.

Predictions of lncRNA functions during CA pathology

We found that each differentially expressed lncRNA associated with numerous differentially expressed mRNAs involved in multiple processes, and our data indicated that these lncRNA-mRNA networks play potentially important roles in pathological processes during CA. Thus, we made functional predictions based on GO and KEGG pathway annotations of differentially expressed lncRNAs and data on the corresponding coexpressed mRNAs. The differentially expressed lncRNAs could be grouped into numerous signaling pathways and processes (Figs. 5 and 6). The relationships between differentially expressed lncRNAs and their functional annotations were predicted by the top 200 and top 500 GO pathway annotations sorted by q-value, frequency counting, and statistical function annotation according to component, function, and pathway process, respectively. For example, in the top 200 GO pathway enrichments (Fig. 5A), the most frequent predictions were cytosol, voltage-gated potassium channel complex, neuron projection, cytoplasm, and nucleolus with regards to the pathways annotated by components. With regards to the pathways annotated by function, the most frequent predictions were sequence-specific DNA binding, dopachrome isomerase activity, protein serine/threonine kinase activity, N-terminal myristoylation domain binding, protein phosphatase activator activity, and transcription regulatory region DNA binding. With regards to the pathways annotated by process, the most frequent predictions were positive regulation of apoptotic process, membrane depolarization, potassium ion transmembrane transport, apoptotic process, homophilic cell adhesion, substrate-dependent cell migration, growth plate cartilage development, and response to cold. In the top 500 GO pathway enrichments, (Fig. 5B), the most frequent component predictions were dendrite, cytosol, voltage-gated potassium channel complex, cytoplasm, nucleus, nucleolus, synapse, neuronal cell body, hemoglobin complex, neuron projection, perinuclear region of cytoplasm, AIM2 inflammasome complex, NLRP3 inflammasome complex, and perikaryon. The most frequent function predictions were sequence-specific DNA binding, dopachrome isomerase activity, protein serine/threonine kinase activity, protein phosphatase activator activity, and voltage-gated potassium channel activity. The most frequent process predictions were potassium ion transmembrane transport, regulation of ion transmembrane transport, response to light stimulus, membrane depolarization, positive regulation of apoptotic process, homophilic cell adhesion, regulation of cell proliferation, protein autophosphorylation, apoptotic process, positive regulation of ryanodine-sensitive calcium-release channel activity, aging, response to mechanical stimulus, substrate-dependent cell migration, transcription, DNA-templated, and response to cold.

Figure 5.

GO analysis. (A-C) The top 200 pathways enriched in GO and (D-F) the top 500 pathways enriched in GO. GO, gene ontology.

Figure 6.

KEGG analysis. (A) The top 200 pathways enriched in KEGG and (B) the top 500 pathways enriched in KEGG. KEGG, Kyoto Encyclopedia of Genes and Genomes.

KEGG pathway annotations of differentially expressed lncRNAs and their corresponding coexpressed mRNAs were performed to predict lncRNA functions during CA pathology (Fig. 6). In the top 200 KEGG pathway enrichments (Fig. 6A), the most frequent predictions were the MAPK signaling pathway, amphetamine addiction, adrenergic signaling in cardiomyocytes, the GnRH signaling pathway, insulin secretion, dopaminergic synapse, glutamatergic synapse, the cAMP signaling pathway, the estrogen signaling pathway, antigen processing and presentation, gastric acid secretion, the TNF signaling pathway, gap junction, and the calcium signaling pathway. In the top 500 KEGG pathway enrichments (Fig. 6B), the most frequent predictions were the MAPK signaling pathway, amphetamine addiction, adrenergic signaling in cardiomyocytes, the GnRH signaling pathway, insulin secretion, gap junction, dopaminergic synapse, the oxytocin signaling pathway, and the glutamatergic synapse. In summary, the most common KEGG pathways and GO pathways involved in CA were signaling pathways, apoptotic processes, inflammation, and synaptic processes. For example, in the KEGG enrichment, for the most downregulated lncRNA TCONS_00087195, the most frequently predicted functions involved the Ras signaling pathway, amphetamine addiction, and dopaminergic synapse. For the second-most downregulated lncRNA TCONS_00129724, the most frequently predicted functions involved the TNF signaling pathway, the NF-κ B signaling pathway, and the Jak-STAT signaling pathway. For the third-most downregulated lncRNA TCONS_00077647, the most frequently predicted functions involved the RIG-I-like receptor signaling pathway, the MAPK signaling pathway, and cytosolic DNA sensing. However, for the most upregulated lncRNA TCONS_00045076, the most frequently predicted function was protein processing in the dopaminergic and glutamatergic synapse. For the second-most upregulated lncRNA TCONS_00097275, the most frequently predicted functions involved protein processing in the dopaminergic synapse, the estrogen signaling pathway, and TNF signaling. For the third-most upregulated lncRNA TCONS_00097694, the most predicted functions involved the glutamatergic synapse, the dopaminergic synapse, and cAMP signaling. As expected, one lncRNA can participate in multiple KEGG pathways and both upregulated and downregulated lncRNAs could be involved in some of the same processes, such as the TNF signaling pathway and the dopaminergic synapse, indicating that lncRNAs play complex roles in CA pathology.

Discussion

In the present study, we investigated lncRNA and mRNA profiles in a CA-ROSC rat model during an early stage of reperfusion using high-throughput lncRNA and mRNA microarrays. The lncRNA microarray showed that 58 lncRNAs were differentially expressed in the CA brain; 37 of the lncRNAs were upregulated and 21 of the lncRNAs were downregulated when compared with the control samples. The mRNA microarray showed that 258 mRNA transcripts were differentially expressed in the CA brain; 177 of the mRNAs were upregulated and 81 of the mRNAs were downregulated. We investigated the relationships between these lncRNAs and mRNAs and found that each differentially expressed lncRNA was coexpressed with thousands of mRNAs. Furthermore, we predicted the functions of these differentially expressed lncRNAs with their corresponding coexpressed mRNAs and found that hundreds of pathway annotations were enriched in both GO and KEGG analyses. The predicted functions of lncRNAs were primarily related to protein voltage-gated potassium channel complexes, serine/threonine kinase activity, protein phosphatase activator activity, the MAPK signaling pathway, and apoptotic processes.

Previous studies have shown that ischemia leads to extensive changes in cerebral lncRNA expression in rodents (12,16), but the cerebral lncRNA expression profile and the potential roles of lncRNAs during the early stages of reperfusion remain unknown. The present study is the first that synchronously examined genome-wide lncRNA and mRNA expression patterns and their network profiles in a CA-ROSC model and that discovered extensive alterations in expression of lncRNAs and their corresponding mRNAs as a result of CA-ROSC.

In the present study, we found that CA-ROSC markedly altered expression of mRNAs involved in vital metabolic pathways, such as inflammatory and apoptotic pathways. In addition, we found that lncRNAs coregulate expression of the differentially expressed mRNAs. Some of the differentially mRNAs identified in our study have also been identified in other ischemia studies (Table IV). To gain insight into the potential roles of the differentially expressed lncRNAs and mRNAs, we performed GO and KEGG pathway analyses to predict their biological functions during CA-ROSC. We found that the differentially expressed lncRNAs may be involved in protein voltage-gated potassium channel complexes, serine/threonine kinase activity, protein phosphatase activator activity, the MAPK signaling pathway, and apoptotic processes. These proteins and kinases are key enzymes in metabolic, inflammatory, and apoptotic pathways, which have been shown to be involved in I/R injuries (17–20). These results indicated that lncRNAs in the cerebral region may participate in pathological processes after CA-ROSC by promoting post-ischemic pathologies, including ionic imbalance, receptor dysfunction, and the inflammatory response during the early stages of reperfusion.

Table IV.

A brief summary of the literature on differentially expressed mRNAs in cardiac arrest-return of spontaneous circulation and ischemia.

Table IV.

A brief summary of the literature on differentially expressed mRNAs in cardiac arrest-return of spontaneous circulation and ischemia.

Author, yearmRNAAnimalLiterature title(Refs.)
Norman et al, 2011Tumor necrosis factorAdult male C57BL/6 miceCardiopulmonary arrest and resuscitation disrupts cholinergic anti-inflammatory processes: A role for cholinergic α7 nicotinic receptors.(35)
Hu et al, 2013 Male Wistar rats (15–16 months)Ulinastatin attenuates oxidation, inflammation and neural apoptosis in the cerebral cortex of adult rats with ventricular fibrillation after cardiopulmonary resuscitation.(36)
Kaneko and Kibayashi, 2012 ddY mice and Swiss-Webster miceMild hypothermia facilitates the expression of cold-inducible RNA-binding protein and heat shock protein 70.1 in mouse brain.(37)
Anju et al, 2011Glutamate decarboxylase mRNAWistar neonatal rats (4-days)Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation.(38)
Tyree et al, 2006Early Growth Response mRNANewborn pigletsImpact of room air resuscitation on early growth response gene-1 in a neonatal piglet model of cerebral hypoxic ischemia.(39)
Vincze et al, 2010Transforming growth factors-β1, −2 and −3RatDistribution of mRNAs encoding transforming growth factors-β1, −2, and −3 in the intact rat brain and after experimentally induced focal ischemia.(40)
Zhu et al, 2001Transforming growth factor-β1Ratβ2-adrenoceptor stimulation enhances latent transforming growth factor-β-binding protein-1 and transforming growth factor-β1 expression in rat hippocampus after transient forebrain ischemia.(41)

For the downregulated lncRNAs, the most frequent predicted functions enriched in the KEGG analysis involved the Ras signaling pathway, amphetamine addiction, the NF-κ B signaling pathway, the Jak-STAT signaling pathway, the RIG-I-like receptor signaling pathway, the MAPK signaling pathway, and the cytosolic DNA sensing pathway. Previous studies have shown that some of these pathways, such as the Ras signaling pathway (21), the NF-κ B signaling pathway (22,23), the Jak-STAT signaling pathway (24), the RIG-I-like receptor signaling pathway (25), the cytosolic DNA sensing pathway (25), and the MAPK signaling pathway (26,27) are involved in CA-ROSC and I/R injury. In addition, the cocaine- and amphetamine-regulated transcript (CART), which codes for a neuropeptide involved in amphetamine addiction has also been shown to play a neuroprotective role in cerebral ischemia and reperfusion (I/R) injury (28,29).

The most frequent predicted functions of the upregulated lncRNAs involve protein processing during glutamatergic synapsis (30), the estrogen signaling pathway (26), and the cAMP signaling pathway (31,32), which play vital roles in cerebral ischemia and reperfusion injury. In summary, our data indicated that the lncRNA-mRNA network interactions have potentially complex roles in cerebral I/R injury. Both upregulated and downregulated lncRNAs were predicted to participate in pathological processes during cerebral I/R injury, such as dopaminergic synapsis and the TNF signaling pathway (33,34), indicating that lncRNAs work synergistically during I/R injury.

There were several limitations in our study. First, we only investigated differentially expressed lncRNAs and mRNAs in cerebral cortex tissue. Second, the time for CA sample collection lasted only eight min. However, the aberrant expressions of lncRNAs and mRNAs after CA-ROSC may have spatial and temporal patterns that we did not evaluate in this study. The samples used in this study were limited (five samples in the CA group and four samples in the BC group). More samples and future studies are required to verify these results.

In this study, we found that CA-ROSC led to extensive alterations in lncRNA and mRNA expression patterns, and these alterations may affect the mRNA transcription and protein translation of vital pathways during I/R injury. Thus, lncRNAs may be promising novel targets for the development of therapeutics to reduce cerebral damage. Future studies should determine whether modulating specific lncRNAs can prevent post-CA pathophysiological events and/or promote plasticity and regeneration.

Acknowledgements

Not applicable.

Funding

The present study was supported by funding from The National Nature Science Foundation of China (grant nos. 81272021 and 81571867), The Science and Technology Foundation of Guangdong Province, China (grant nos. 2012B061700046 and 2012B031800286), and The Research Program for Colleges and Universities in Guangzhou (grant no. 2012C054).

Availability of data and materials

The datasets used and/or analyzed during the current study are available in the Genome Expression Omnibus (GEO) repository, www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE108342.

Authors' contributions

CH and ZL conceived the idea for the study. CH, RL, MY, XZ and XLi contributed to the design, and performed the animal experiments and harvested samples. XLia and HW contributed to sample measurement procedures. ZZ and QL performed data analysis. CH, MY and RL wrote the manuscript, and CH and XZ revised the manuscript.

Ethics approval and consent to participate

The animal studies were approved by the Institutional Animal Care and Use Committee of Sun Yat-sen University (Guangdong, China) and the procedures used were in accordance with the Animal Research Reporting for In Vivo Experiments guidelines on animal research.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Writing Group Members, Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, Das SR, de Ferranti S, Després JP, et al: Executive summary: Heart disease and stroke statistics-2016 update: A report from the american heart association. Circulation. 133:447–454. 2016. View Article : Google Scholar : PubMed/NCBI

2 

Neumar RW, Nolan JP, Adrie C, Aibiki M, Berg RA, Böttiger BW, Callaway C, Clark RS, Geocadin RG, Jauch EC, et al: Post-cardiac arrest syndrome: Epidemiology, pathophysiology, treatment, and prognostication. A consensus statement from the International Liaison Committee on Resuscitation (American Heart Association, Australian and New Zealand Council on Resuscitation, European Resuscitation Council, Heart and Stroke Foundation of Canada, InterAmerican heart foundation, Resuscitation Council of Asia, and the Resuscitation Council of Southern Africa); the American Heart Association Emergency Cardiovascular Care Committee; the Council on Cardiovascular Surgery and Anesthesia; the Council on Cardiopulmonary, Perioperative, and Critical care; the Council on Clinical Cardiology; and the Stroke Council. Circulation. 118:2452–2483. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Wang KC and Chang HY: Molecular mechanisms of long noncoding RNAs. Mol Cell. 43:904–914. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, Thomas K, Presser A, Bernstein BE, van Oudenaarden A, et al: Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci USA. 106:pp. 11667–11672. 2009; View Article : Google Scholar : PubMed/NCBI

5 

Cabili MN, Trapnell C, Goff L, Koziol M, Tazon-Vega B, Regev A and Rinn JL: Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. Genes Dev. 25:1915–1927. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Leung A, Trac C, Jin W, Lanting L, Akbany A, Sætrom P, Schones DE and Natarajan R: Novel long noncoding RNAs are regulated by angiotensin II in vascular smooth muscle cells. Circ Res. 113:266–278. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Bonasio R and Shiekhattar R: Regulation of transcription by long noncoding RNAs. Annu Rev Genet. 48:433–455. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Dong X, Yu LG, Sun R, Cheng YN, Cao H, Yang KM, Dong YN, Wu Y and Guo XL: Inhibition of PTEN expression and activity by angiotensin II induces proliferation and migration of vascular smooth muscle cells. J Cell Biochem. 114:174–182. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Qureshi IA and Mehler MF: Long non-coding RNAs: Novel targets for nervous system disease diagnosis and therapy. Neurotherapeutics. 10:632–646. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Yin KJ, Hamblin M and Chen YE: Non-coding RNAs in cerebral endothelial pathophysiology: Emerging roles in stroke. Neurochem Int. 77:9–16. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Antoniou D, Stergiopoulos A and Politis PK: Recent advances in the involvement of long non-coding RNAs in neural stem cell biology and brain pathophysiology. Front Physiol. 5:1552014. View Article : Google Scholar : PubMed/NCBI

12 

Dharap A, Pokrzywa C and Vemuganti R: Increased binding of stroke-induced long non-coding RNAs to the transcriptional corepressors Sin3A and coREST. ASN Neuro. 5:283–289. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Kilkenny C, Browne WJ, Cuthill IC, Emerson M and Altman DG: Improving bioscience research reporting: The ARRIVE guidelines for reporting animal research. Osteoarthritis Cartilage. 20:256–260. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Lin JY, Liao XX, Li H, Wei HY, Liu R, Hu CL, Huang GQ, Dai G and Li X: Model of cardiac arrest in rats by transcutaneous electrical epicardium stimulation. Resuscitation. 81:1197–1204. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Chun-Lin H, Jie W, Xiao-Xing L, Xing L, Yu-Jie L, Hong Z, Xiao-Li J and Gui-Fu W: Effects of therapeutic hypothermia on coagulopathy and microcirculation after cardiopulmonary resuscitation in rabbits. Am J Emerg Med. 29:1103–1110. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Dharap A, Nakka VP and Vemuganti R: Effect of focal ischemia on long noncoding RNAs. Stroke. 43:2800–2802. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Xiang Y, Zhao H, Wang J, Zhang L, Liu A and Chen Y: Inflammatory mechanisms involved in brain injury following cardiac arrest and cardiopulmonary resuscitation. Biomed Rep. 5:11–17. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Uchino H, Ogihara Y, Fukui H, Chijiiwa M, Sekine S, Hara N and Elmér E: Brain injury following cardiac arrest: Pathophysiology for neurocritical care. J Intensive Care. 4:312016. View Article : Google Scholar : PubMed/NCBI

19 

Quillinan N, Herson PS and Traystman RJ: Neuropathophysiology of brain injury. Anesthesiol Clin. 34:453–464. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Quillinan N, Grewal H, Deng G, Shimizu K, Yonchek JC, Strnad F, Traystman RJ and Herson PS: Region-specific role for GluN2B-containing NMDA receptors in injury to Purkinje cells and CA1 neurons following global cerebral ischemia. Neuroscience. 284:555–565. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Yao C, Zhang J, Chen F and Lin Y: Neuroprotectin D1 attenuates brain damage induced by transient middle cerebral artery occlusion in rats through TRPC6/CREB pathways. Mol Med Rep. 8:543–550. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Wei X, Zhang B, Zhang Y, Li H, Cheng L, Zhao X, Yin J and Wang G: Hydrogen sulfide inhalation improves neurological outcome via NF-κB-mediated inflammatory pathway in a rat model of cardiac arrest and resuscitation. Cell Physiol Biochem. 36:1527–1538. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Tang ZX, Chen GX, Liang MY, Rong J, Yao JP, Yang X and Wu ZK: Selective antegrade cerebral perfusion attenuating the TLR4/NF-κB pathway during deep hypothermia circulatory arrest in a pig model. Cardiology. 128:243–250. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Ottani A, Neri L, Canalini F, Calevro A, Rossi R, Cappelli G, Ballestri M, Giuliani D and Guarini S: Protective effects of the melanocortin analog NDP-α-MSH in rats undergoing cardiac arrest. Eur J Pharmacol. 745:108–116. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Wang H, Wang G, Zhang L, Zhang J, Zhang J, Wang Q and Billiar TR: ADAR1 suppresses the activation of cytosolic RNA-sensing signaling pathways to protect the liver from ischemia/reperfusion injury. Sci Rep. 6:202482016. View Article : Google Scholar : PubMed/NCBI

26 

Lebesgue D, Chevaleyre V, Zukin RS and Etgen AM: Estradiol rescues neurons from global ischemia-induced cell death: Multiple cellular pathways of neuroprotection. Steroids. 74:555–561. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Jover-Mengual T, Zukin RS and Etgen AM: MAPK signaling is critical to estradiol protection of CA1 neurons in global ischemia. Endocrinology. 148:1131–1143. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Wang Y, Qiu B, Liu J, Zhu WG and Zhu S: Cocaine- and amphetamine-regulated transcript facilitates the neurite outgrowth in cortical neurons after oxygen and glucose deprivation through PTN-dependent pathway. Neuroscience. 277:103–110. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Bin J, Wang Q, Zhuo YY, Xu JP and Zhang HT: Piperphentonamine (PPTA) attenuated cerebral ischemia-induced memory deficits via neuroprotection associated with anti-apoptotic activity. Metab Brain Dis. 27:495–505. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Tjepkema-Cloostermans MC, Hindriks R, Hofmeijer J and van Putten MJ: Generalized periodic discharges after acute cerebral ischemia: Reflection of selective synaptic failure? Clin Neurophysiol. 125:255–262. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Steinberg SF, Alcott S, Pak E, Hu D, Protas L, Möise NS, Robinson RB and Rosen MR: beta(1)-Receptors increase cAMP and induce abnormal Ca(i) cycling in the German shepherd sudden death model. Am J Physiol Heart Circ Physiol. 282:H1181–H1188. 2002. View Article : Google Scholar : PubMed/NCBI

32 

Li P, Gu T, Wang C, Zhang G and Shi E: Neuregulin 1 attenuates neuronal apoptosis induced by deep hypothermic circulatory arrest through ErbB4 signaling in rats. J Cardiovasc Pharmacol. 66:551–557. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Wang W, Zhao L, Bai F, Zhang T, Dong H and Liu L: The protective effect of dopamine against OGD/R injury-induced cell death in HT22 mouse hippocampal cells. Environ Toxicol Pharmacol. 42:176–182. 2016. View Article : Google Scholar : PubMed/NCBI

34 

Sui B, Li Y and Ma L: Postconditioning improvement effects of ulinastatin on brain injury following cardiopulmonary resuscitation. Exp Ther Med. 8:1301–1307. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Norman GJ, Morris JS, Karelina K, Weil ZM, Zhang N, Al-Abed Y, Brothers HM, Wenk GL, Pavlov VA, Tracey KJ and Devries AC: Cardiopulmonary arrest and resuscitation disrupts cholinergic anti-inflammatory processes: A role for cholinergic α7 nicotinic receptors. J Neurosci. 31:3446–3452. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Hu CL, Xia JM, Cai J, Li X, Liao XX, Li H, Zhan H, Dai G and Jing XL: Ulinastatin attenuates oxidation, inflammation and neural apoptosis in the cerebral cortex of adult rats with ventricular fibrillation after cardiopulmonary resuscitation. Clinics (Sao Paulo). 68:1231–1238. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Kaneko T and Kibayashi K: Mild hypothermia facilitates the expression of cold-inducible RNA-binding protein and heat shock protein 70.1 in mouse brain. Brain Res. 1466:128–136. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Anju TR, Jayanarayanan S and Paulose CS: Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation. J Biomed Sci. 18:312011. View Article : Google Scholar : PubMed/NCBI

39 

Tyree MM, Dalgard C and O'Neill JT: Impact of room air resuscitation on early growth response gene-1 in a neonatal piglet model of cerebral hypoxic ischemia. Pediatric Res. 59:423–427. 2006. View Article : Google Scholar

40 

Vincze C, Pál G, Wappler EA, Szabó ER, Nagy ZG, Lovas G and Dobolyi A: Distribution of mRNAs encoding transforming growth factors-beta1, −2, and −3 in the intact rat brain and after experimentally induced focal ischemia. J Comp Neurol. 518:3752–3770. 2010. View Article : Google Scholar : PubMed/NCBI

41 

Zhu Y, Culmsee C, Roth-Eichhorn S and Krieglstein J: Beta(2)-adrenoceptor stimulation enhances latent transforming growth factor-beta-binding protein-1 and transforming growth factor-beta1 expression in rat hippocampus after transient forebrain ischemia. Neuroscience. 107:593–602. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu R, Liao X, Li X, Wei H, Liang Q, Zhang Z, Yin M, Zeng X, Liang Z, Hu C, Hu C, et al: Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains. Mol Med Rep 17: 6413-6424, 2018.
APA
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z. ... Hu, C. (2018). Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains. Molecular Medicine Reports, 17, 6413-6424. https://doi.org/10.3892/mmr.2018.8703
MLA
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z., Yin, M., Zeng, X., Liang, Z., Hu, C."Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains". Molecular Medicine Reports 17.5 (2018): 6413-6424.
Chicago
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z., Yin, M., Zeng, X., Liang, Z., Hu, C."Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains". Molecular Medicine Reports 17, no. 5 (2018): 6413-6424. https://doi.org/10.3892/mmr.2018.8703
Copy and paste a formatted citation
x
Spandidos Publications style
Liu R, Liao X, Li X, Wei H, Liang Q, Zhang Z, Yin M, Zeng X, Liang Z, Hu C, Hu C, et al: Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains. Mol Med Rep 17: 6413-6424, 2018.
APA
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z. ... Hu, C. (2018). Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains. Molecular Medicine Reports, 17, 6413-6424. https://doi.org/10.3892/mmr.2018.8703
MLA
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z., Yin, M., Zeng, X., Liang, Z., Hu, C."Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains". Molecular Medicine Reports 17.5 (2018): 6413-6424.
Chicago
Liu, R., Liao, X., Li, X., Wei, H., Liang, Q., Zhang, Z., Yin, M., Zeng, X., Liang, Z., Hu, C."Expression profiles of long noncoding RNAs and mRNAs in post-cardiac arrest rat brains". Molecular Medicine Reports 17, no. 5 (2018): 6413-6424. https://doi.org/10.3892/mmr.2018.8703
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team