Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2018 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway

Corrigendum in: /10.3892/mmr.2025.13647
  • Authors:
    • Tian‑Hua Yao
    • Parekejiang Pataer
    • Krishna Prasad Regmi
    • Xi‑Wen Gu
    • Quan‑Yan Li
    • Jing‑Ting Du
    • Su‑Meng Ge
    • Jun‑Bo Tu
  • View Affiliations / Copyright

    Affiliations: Key Laboratory of Shaanxi Province for Craniofacial Precision Medicine Research, College of Stomatology, Xi'an Jiaotong University Xi'an, Shaanxi 710004, P.R. China, Oncology Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Xinjiang Medical University, Urumqi, Xinjiang 830054, P.R. China, Stomatological Hospital of Tai'an, Tai'an, Shandong 271000, P.R. China
    Copyright: © Yao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 684-694
    |
    Published online on: May 14, 2018
       https://doi.org/10.3892/mmr.2018.9013
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The use of propranolol for the treatment of infantile hemangioma (IH) has been widely investigated in recent years. However, the underlying therapeutic mechanism of propranolol for the treatment of IH remains poorly understood. The aim of the present study was to investigate the expression of proteins regulated by cellular tumor antigen p53 (p53) in associated apoptosis pathways in IH endothelial cells (HemECs) treated with propranolol. Furthermore, the present study aimed to investigate the exact apoptotic pathway underlying the therapeutic effect of propranolol against IH. In the present study, HemECs were subcultured and investigated using an inverted phase contrast microscope, immunocytochemical staining and a scanning electron microscope (SEM). Experimental groups and blank control groups were prepared. All groups were subjected to drug treatment. A high p53 expression model of HemECs was successfully established via transfection, and a low p53 expression model of HemECs was established using pifithrin‑α. The apoptosis rate of each group was determined using Annexin V‑fluorescein isothiocyanate/propidium iodide double staining and flow cytometry. The expression levels of downstream proteins regulated by p53 [tumour necrosis factor receptor superfamily member 6 (FAS), p53‑induced death domain‑containing protein (PIDD), death receptor 5 (DR5), BH3‑interacting domain death agonist (BID), apoptosis regulator BAX (BAX), p53 unregulated modulator of apoptosis (PUMA), phosphatidylinositol‑glycan biosynthesis class S protein (PIGS), and insulin‑like growth factor‑binding protein 3 (IGF‑BP3)] were revealed in the experimental and control groups via western blotting. Microscopic observation revealed the growth of an adherent monolayer of cells, which were closely packed and exhibited contact inhibition. Immunocytochemical staining demonstrated increased expression of clotting factor VIII. SEM analysis revealed presence of Weibel‑Palade bodies. The results of the analyses verified that the cultured cells were HemECs. The staining of the samples resulted in a significantly increased rate of apoptosis in experimental groups compared with the blank control group. This result suggested that there is an association between p53 expression and the rate of apoptosis of propranolol‑treated HemECs. The results of the western blot analysis demonstrated an upregulation of BAX expression and a downregulation of IGF‑BP3 expression in the HemECs treated with propranolol. There were no significant differences in the expression levels of FAS, DR5, PIDD, BID, PUMA and PIGS between experimental and control groups. This result suggests that p53 has an important role in HemEC apoptosis. The results of the present study additionally suggest that the propranolol‑induced HemEC apoptosis pathway is a mitochondrial apoptosis pathway and is regulated by p53‑BAX signaling.

Introduction

Infantile hemangioma (IH) is the most common benign tumor affecting infants (1), with an incidence of 5–10% 1 year post-birth (2,3). IH is more prevalent in African, American and Asian populations compared with Caucasian populations. IH occurs more frequently in females (male:female ratio, 1:3) (1,4). The head and neck are the most commonly-affected bodily areas (60%), which are followed by the trunk (25%) and the extremities (15%) (1,5). IH is typically characterized by dramatic postnatal growth followed by spontaneous regression, with a complete regression rate of 90% by the age of 9 years (1,6). Therefore, the majority of patients with IH do not require treatment, as tumors naturally regress over time; however, during the dramatic postnatal growth phase, ~10% of cases, dependent upon their anatomical location, may exhibit severe symptoms of ulceration and hemorrhage (7). Occasionally, potentially life-threatening complications such as airway impairment may develop (7). Previous studies have suggested numerous pharmacological agents for the treatment of problematic IHs, including oral corticosteroids, interferon-α and bleomycin A5; however, long-term use of these agents may have harmful side effects (8). Léauté-Labrèze and Taïeb (9) revealed that propranolol exhibits a therapeutic effect against IH, which has provided potential new treatment options for complicated IH (10). Following this discovery, numerous studies have investigated the clinical application of propranolol for the treatment of IH, and have demonstrated that propranolol is an effective and safe therapeutic agent (8,9,11–13). In recent years, propranolol has become the fist-line treatment for IH in many major medical centers globally (14,15).

Despite widespread use of propranolol as a therapeutic agent for the treatment of IH, the mechanism underlying its therapeutic effects has not yet been determined (1,16). Vasoconstriction, inhibition of angiogenesis and induction of apoptosis are three possible mechanisms that propranolol may be associated with that result in the inhibition of IH growth (17–19). Several molecules have been revealed to regulate the interactions between pericytes and hemangioma-derived endothelial cells (HemECs) (20–22). Mancini and Smoller (21) revealed that the apoptosis rate of HemECs during the proliferation stage of IH is enhanced compared with during the involution stage. Furthermore, the expression of Bcl-2 (an inhibitor of apoptosis) during the proliferation stage of IH is significantly suppressed compared with during the regression stage (22,23). These findings suggest a close association between the regression of IH and the apoptosis of HemECs. Furthermore, a previous study (24) demonstrated the contribution of p53-dependent apoptosis to the therapeutic effect of pingyangmycin against IH. Therefore, in the present study, an enhanced p53-expression model was established via transient transfection, and a serum-starved p53-expression model was established using a p53 inhibitor to inhibit the function of p53 during the induction of apoptosis in HemECs, following treatment with propranolol. The results demonstrated that enhanced p53 expression increases the apoptosis rate of HemECs, and that the p53-BAX mediated mitochondrial pathway has an important role in this process.

Materials and methods

Ethical approval

The present study was approved by the Ethical Board of The Second Affiliated Hospital of Xi'an Jiaotong University (Xi'an, China). Clinical diagnoses of each patient were confirmed in the Department of Pediatric Surgery, The Second Affiliated Hospital of Xi'an Jiaotong University. Written informed consent was obtained routinely from the families of each patient, in accordance with the treatment protocol of the associated hospital. Additionally, written informed consent was obtained regarding the handling of samples according to the Declaration of Helsinki.

Isolation and culture of HemECs

The HemEC cell line was same as in a previous study (24). HemECs were isolated from a proliferating IH at the Department of Pediatric Surgery of The Second Affiliated Hospital of Xi'an Jiaotong University. Resected tissue of a proliferating IH were subjected to enzymatic digestion by trypsin (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and then centrifuged at 100–200 × g at 37°C for 30 sec. HemECs were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 µg/ml streptomycin and 100 µg/ml penicillin (all Invitrogen; Thermo Fisher Scientific, Inc.) and incubated at 37°C with 5% CO2. The culture medium was replaced with fresh medium every 2 days, and the confluent cells were isolated using trypsin-EDTA solution (0.05%; Invitrogen; Thermo Fisher Scientific, Inc.). HemECs at passages 6–8 were used in the present study.

HemECs at passage 6 were harvested and fixed in 2.5% glutaraldehyde at 4°C for 2 h and coated using 1% osmium tetroxide, then observed under both inverted phase contrast microscope and scanning electron microscope (SEM; magnificatiom, ×8,000).

Immunocytochemical staining

Cell climbing slices were made using HemECs at sixth passage and then treated with paraformaldehyde for 30 min at room temperature. The cells were treated with 5% normal goat serum (Abcam, Cambridge, UK) for 10 min at rrom temperature and incubated with anti-factor VIII primary antibody (1 mg/ml; cat. no. ab6190; Abcam) at 4°C overnight. Following three washes in PBS, sections were incubated with streptavidin-peroxidase (S-P)-conjugated secondary antibodies. The cells were visualized using DAB-chromogen (Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) according to the manufacturer's protocol. Then after gradient alcohol treatment, the cells were treated with dimethylbenzene for 1 min and sealed with neutral resin. Cells were observed using converted microscope at a magnification of ×400. Yellow-stained particles indicate the presence of clotting factor VIII.

Sequencing of p53 gene

The full-length sequence of the target gene was determined using Illumina HiSeq 2000 platform (Illumina, Inc., San Diego, CA, USA), as previously described (25) and sequence alignment was done with Quality software (maq.sourceforge.net; version number: Bwa-05.0.tar.bz2), which was corresponding with the sequence of p53, confirming that false positive clones or mutations had not been established (26).

Construction of high p53 expression model of HemECs

The coding region of human wild-type p53 gene was amplified and inserted into the Bg1II site of the 1 µg plasmid p3XFlag-CMV7.1 (Fermentas; Thermo Fisher Scientific, Inc.) (27). As the resultant plasmid p3XFlag-CMV-p53 did not express green fluorescent protein (GFP), the 1 µg pEGFP plasmid (Fermentas; Thermo Fisher Scientific, Inc.) was co-transfected. HemECs were transferred to 12-well plates, seeded at 2×106 cells/well and incubated overnight at 37°C. Transfection with p3XFlag-Cmv7.1 or pEGFP was performed using EndoFectin™ (GeneCopoeia, Inc., Rockville, MD, USA). A total of 0.5 µg plasmid DNA was mixed with 1.5 µl EndoFectin™ to generate a final concentration of 0.33 µg DNA/ml, which is then dissolved in serum-free RPMI-1640. The resulting complex was incubated at 37°C for 3 h and then added to cells in 12-well plates. The cells were incubated at 37°C for 3 h and then washed using RPMI-1640. The cells were incubated at 37°C for a further 32 h in RPMI-1640 with 10% FBS prior to further experimentation. Fluorescence microscopy was performed to determine transfection efficiency (magnification, ×400).

Construction of a low p53 expression model of HemECs

Pifithrin-α (PFT-α; Merck KGaA, Darmstadt, Germany) was used to inhibit p53-induced apoptosis pathways. Serum-starved HemECs were treated with PFT-α at gradient concentrations (100 and 500 nM; and 1, 10, 5, 100 and 200 µM) for 3 h at 37°C followed by treatment with propranolol (100 µmol/l at 37°C for 24 h) (8,9,28,29). Cells were harvested according to morphological alterations and investigated for apoptosis using an Annexin V-fluorescein isothiocyanate (FITC) kit (Trevigen, Inc., Gaithersburg, MD, USA), according to the manufacturer's protocol. Morphological alterations associated with apoptosis were observed under a fluorescent microscope at a magnification of ×400.

Verification of HemEC models via reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA from HemEC models and a blank control group was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and its purity and concentration were investigated using ultraviolet spectrophotometry and A260/A280 ratio of 1.8–2.1 was considered as acceptable purity of the RNA. Complimentary DNA synthesis was performed using reverse transcriptase and oligo(dT) primers (Thermo Fisher Scientific, Inc.). RevertAid M-MulV Reverse Transcriptase (200 u/µl; 1 µl), oligo(dT) primer 1 µl; 5X reaction buffer 4 µl were used for reverse transcription. The temperature protocol of reverse transcription was 42°C for 60 min and then 70°C for 5 min. Primer sequences used for PCR are detailed in Table I. SYBR-Green Super Mix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for qPCR. The following thermocycling conditions were used for the qPCR: Initial denaturation at 95°C for 10 min; 40 cycles of 95°C for 15 sec and 60°C for 30 sec. Expression levels were quantified using the 2−ΔΔCq method (30). All expression levels were normalized to GAPDH.

Table I.

Gene and primer sequence.

Table I.

Gene and primer sequence.

GenePrimer sequences
p53F: GAGGTTGGCTCTGACTGTACC
R: TCCGTCCCAGTAGATTACCAC
GAPDHF: ACCCACTCCTCCACCTTTG
R: CACCACCCTGTTGCTGTAG

[i] Primer sequences used for the amplification of the p53 gene and reference gene. F, forward; R, reverse.

Drug treatment and apoptosis analysis

HemECs were cultured overnight at 37°C and then assorted into six groups, including the blank control group, dosing+transfection group, transfection group, dosing+inhibitor group, inhibitor group and dosing group. Blank control group, HemECs untreated; Dosing Group, HemECs treated with Propranolol 100 µM/l; Inhibitor group, HemECs treated with PFT-alpha (10 µM/l); Dosing + Inhibitor Group, HemECs treated with PFT-α (10 µM/l) for 3 h and then treated with propranolol (100 µM/l) for 3 h; Transfection Group, high p53 expression model of HemECs untreated; and Dosing + Transfection group, high p53 expression model of HemECs treated with propranolol (100 µM/l) for 3 h. All treatments were at 37°C. The Dosing and transfection group were incubated with propranolol (100 µM/l) for 3 h following transfection. In addition, HemECs in Dosing + Inhibitor group were treated with propranolol for 3 h following addition of PFT-α (10 µm). Following this treatment, cells were collected, washed and subjected to apoptosis analysis using an Annexin V-FITC kit (Trevigen, Inc.), according to the manufacturer's protocol. The cells were analyzed on a FACScan flow cytometer with Cell Quest software (version 5.1; BD Biosciences, Franklin Lakes, NJ, USA).

Western blot analysis

Total proteins were extracted using an ultrasonic method (22) following treatment with 1X SDS Sample Buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 30 min at 0°C. Bicinchoninic acid was used for protein determination. Protein samples (10–30 µg) were separated by 10% SDS-PAGE and then transferred to polyvinylidene fluoride membranes (Ameresco, Inc., Framingham, MA, USA). The protein determination method we uses was BCA method. The membranes were incubated at 37°C with Ponceau staining solution (0.1%) for 2 min followed by incubation at 37°C with Tris buffered saline containing Tween-20. The membranes were blocked with 5% Bovine Serum Albumin (HyClone; GE Healthcare Life Sciences, Logen, UT, USA) at 4°C for 24 h. The membranes were incubated overnight at 4°C with the following primary antibodies: Anti-β-actin (cat. no. ab8226; dilution, 1 mg/ml, molecular weight 45 kDa), antibody against tumor necrosis factor receptor superfamily member 6 (FAS; cat. no. ab133619, dilution 1:1,000), p53-induced death domain-containing protein (PIDD; cat. no. ab78389, dilution 1 µg/ml), death receptor 5 (DR5; cat. no. ab199357, dilution 1:1,000), apoptosis regulator BAX (BAX; cat. no. ab53154, dilution 1:1,000), BH3-interacting domain death agonist (BID; cat. no. ab32060, dilution 1:1,000), p53 unregulated modulator of apoptosis (PUMA; cat. no. ab33906, dilution 1:1,000), insulin-like growth factor-binding protein 3 (IGF-BP3; cat. no. ab77635, dilution 0.03 µg/ml) and phosphatidylinositol-glycan biosynthesis class S protein (PIG-S; cat. no. ab157211, dilution 1:1,000; all Abcam). Following this process, membranes were incubated at 20°C for 2 h with secondary antibodies. For IGF-BP3 the secondary antibody used was donkey anti-goat IgG (dilution, 1:300; cat. no. ab6566). Goat anti-rabbit IgG (dilution, 1:3,000; cat. no. ab6721; all Abcam) was the secondary antibody used for all other primary antibodies.

Following washing, the proteins were visualized using a western blot fluorography developer kit (Beyotime Institute of Biotechnology, Haimen, China) and scanned as computer files. Densitometry was analyzed using ImageJ software version 1.8.0 (National Institutes of Health, Bethesda, MD, USA) and β-actin expression was used for normalization. All experiments were performed in triplicate.

Statistical analysis

Statistical differences between two groups were determined using the Student's t-test, and the statistical differences between multiple groups was determined using one-way analysis of variance followed by Tukey's post hoc test. All statistical analyses were performed using SPSS 20.0 software for Windows 7 operating system (IBM Corp., Armonk, NY, USA). Data were presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

HemECs are successfully transfected with p53

Colonies were identified via PCR. The results revealed two positive colonies (Fig. 1, lanes 6 and 7).

Figure 1.

Colony identification. Western blot analysis revealed that the protein samples in lanes 6 and 7 are positive for p53 expression.

Gene amplification

The positive colonies were propagated and the plasmid extracted. Double enzyme digestion was performed to further identify the colony. The results demonstrated that the colony inserted into lane 6 had been successfully transfected with the target sequence Fig. 2.

Figure 2.

The identification of p53+p3XFlag-Cmv7.1 by the Bgl+BamHI digestion. The positive samples were amplified via polymerase chain reaction and plasmids were extracted. Furthermore, the results demonstrated that the protein sample in lane 6 contained the target gene. The lanes (lane 6 and lane 7) are the corresponding lanes presented in Fig. 1.

Sequencing of Gene

Sequencing of the positive colony of target gene was done. Fig. 3 revealed that the sequence of the target gene in the positive colony was exactly same with that of p53, which confirmed that there were no false positive clones or mutations (Fig. 3) (26).

Figure 3.

Sequencing of p53 gene. The full-length sequence of the target gene was determined, and it was an exact match with the sequence of p53, thus confirming that false positive clones or mutations had not been established.

Immunocytochemical staining

Immunocytochemical staining results exhibited yellow dyed particles demonstrating the presence of clotting factor VIII related antigen in HemECs. SEM revealed presence of Weibel-Palade bodies (magnification, ×8,000; Fig. 4) (31).

Figure 4.

Immunocytochemical staining. (A) Yellow particles in immunocytochemical staining image indicate the presence of clotting factor VIII (magnification, ×400). (B) Negative control fibroblasts (magnification, ×400). (C) Weibel-Palade bodies (scanning electron microscopy; magnification, ×8,000). Weibel-Palade bodies are the storage granules of endothelial cells, the cells that form the inner lining of the blood vessels and heart. Therefore, Weibel-Palade bodies were considered to identify endothelial cells.

Transfection with p53 is optimal following 24 h of incubation

Gene transfection revealed morphological alterations associated with apoptosis, typically rounding and floating of the HemECs (Fig. 5).

Figure 5.

Morphological alterations in hemangioma-derived endothelial cells were observed using an inverted microscope (scale bar:161 um). Morphological changes following transfection at (A) 6 h, (B) 12 h, (C) 18 h, (D) 24 h, (E) 32 h and (F) 40 h time intervals are presented (magnification, ×400).

Fluorescence microscopy

The expression of fluorescence was investigated at 6, 12, 18, 24 and 32 h time intervals. The results revealed that the expression of fluorescence increased in a time-dependent manner and at the 24 h time interval, the expression of fluorescence reached a maximum cell transfection ratio ~60% (Fig. 6). The values were calculated using cell-counting chamber. Total cell number was counted using an inverted microscope followed by the counting of fluorescent cell number using a fluorescence microscope. The transfection ratio=fluorescent cell number/total cell number. Three fields of view were observed. The magnification used was ×400.

Figure 6.

Fluorescent protein expression investigated using fluorescence microscopy. Picture A to F showed the fluorescent protein expression in (A) 6 h, (B) 12 h, (C) 18 h, (D) 24 h, (E) 32 h and (F) 40-h time intervals following transfection. The expression of fluorescence exhibited in (D) represents the greatest transfection ratio.

RT-qPCR analysis reveals the successful establishment of a low p53 expression model group and a high p53 expression model group

RT-qPCR analysis was performed to further verify the successful establishment of the cell models. The high p53 expression model group, the low p53 expression model group and the blank control groups were investigated. The results revealed that the low p53 expression model group demonstrated significantly suppressed p53 expression compared with the control group (P<0.05; Fig. 7). Furthermore, the results revealed that the high p53 expression model group demonstrated significantly enhanced p53 expression compared with the control group (P<0.05; Fig. 7).

Figure 7.

Reverse transcription-quantitative polymerase chain reaction analyses of the expression level of p53 exhibited by the high p53 expression model group, the low p53 expression model group and the control group. Both the high p53 expression model and the low p53 expression group demonstrated a statistically significant statistical difference in p53 expression compared with the control. *P<0.05 vs. control.

p53 expression is significantly enhanced in HemECs following treatment with propranolol

The western blot analysis results demonstrated that p53 expression was significantly enhanced in HemECs following treatment with propranolol (100 µmol/l; Fig. 8).

Figure 8.

Western blot analysis of p53 in the propranolol group and the control is presented. p53 expression was significantly higher in the propranolol group compared with the control group. *P<0.05 vs. control.

Enhanced p53 expression increases the apoptosis rate of HemECs

The results of the flow cytometry and Annexin/propidium iodide (PI) double staining analyses demonstrated a significantly increased rate of apoptosis exhibited by the dosing group compared with the blank control group, thus suggesting that propranolol (100 µM) may induce apoptosis in HemECs. To further investigate the effect of the administration of propranolol on HemECs expressing different levels of p53, a control group and different experimental groups were established, as previously mentioned. Different experimental groups had different level of apoptosis rate. Following treatment with propranolol, the apoptosis rate of the transfection group was significantly enhanced compared with the control group, and the apoptosis rate of the inhibitor group was significantly suppressed compared with the control group. This result demonstrated an association between p53 expression and apoptosis rate (Fig. 9).

Figure 9.

p53 expression affects the apoptosis rate of hemangioma-derived endothelial cells treated with propranolol (100 µmol/l). *P<0.05 vs. dosing group; &P<0.05 vs. blank control group; #P<0.05 vs. transfection group; ^P<0.05 vs. inhibitor group.

Furthermore, the apoptosis rate of HemECs dosed with propranolol (Dosing group) was significantly enhanced compared with the blank control group and that with the inhibitor group. The apoptosis rate of the Dosing group was significantly increased compared with the Inhibitor group. The apoptosis rate of transfected HemECs treated with propranolol (Dosing + Transfection) was significantly enhanced compared with Dosing group and Transfection groups (Fig. 9).

BAX expression is significantly upregulated, and IGF-BP3 expression is significantly downregulated, following treatment with propanolol

To determine the mechanism underlying the effect of propranolol on HemECs, the expression of eight proteins associated with the p53 downstream pathway were investigated via western blotting (Fig. 10). The signaling pathway of p53 gene has been shown in Fig. 11 (Fig. 11) which was taken from DAVID Database (david.ncifcrf.gov/home.jsp) (32).

Figure 10.

Protein expression levels in hemangioma-derived endothelial cells treated with propranolol (100 µmol/l) and the control group.

Figure 11.

p53 signaling pathway obtained from the DAVID Database.

As presented in Fig. 12, the expression of BAX in the propranolol group was significantly increased compared with the control group (P<0.05). Furthermore, the expression of IGF-BP3 in the propranolol group was significantly decreased compared with the control group (P<0.05). No significant differences were exhibited by any of the other proteins investigated.

Figure 12.

Relative expression of different apoptosis related proteins with control and propranolol. Bax, Bcl-2-associated X protein; Bid, BH3 interacting-domain death agonist; Dr5, death receptor 5; Fas, tumor necrosis factor receptor superfamily member 6; Igf-bp3, insulin-like growth factor-binding protein 3; Pidd, p53-induced protein with a death domain; pigs, phosphatidylinositol glycan anchor biosynthesis class S; puma, p53 unregulated modulator of apoptosis.

BAX activates the release of Cytochrome C via membrane remodeling and increasing membrane permeability, which subsequently results in the activation of caspases Signaling pathway of propranolol inducing apoptosis in HemECs in vitro is presented in Fig. 13. The figure was constructed using Portable Pathway Builder 2.0. (www.proteinlounge.com/PathwayBuilder.aspx).

Figure 13.

Signaling pathway of propranolol inducing apoptosis in HemECs in vitro (Portable Pathway Builder 2.0; www.proteinlounge.com/PathwayBuilder.aspx).

Discussion

Despite IH being widely studied, the disease is not completely understood due to differences in therapeutic options and patient ages, in addition to tumor location, stage and size (33,34). Treatment is typically initiated during the early proliferative stage of the tumor, at which point numerous treatment options are available (35–39).

Propranolol, a nonselective β-blocker, has been demonstrated to be the most effective treatment option available with few adverse side effects (40). Propranolol has become the first-line treatment option in a number of tertiary healthcare centers around the world (34). Despite its effectiveness, the underlying therapeutic mechanism through which propranolol attenuates the regression of IH is not completely understood (41). At a molecular level, propranolol has been revealed to induce the expression of apoptotic genes, such as BAX, p53, caspase-8 and cytochrome C in HemECs (28,42). Therefore, the p53-dependent apoptosis pathway may represent a potential mechanism involved in the therapeutic effect of propranolol against IH. In the present study, a high p53 expression model and a low p53 expression model of HemECs was constructed. The results demonstrated enhanced apoptotic activities in the high p53 expression model of HemECs in vitro. Furthermore, eight key proteins downstream of the p53-dependent apoptosis pathway were selected and subsequently detected using western blotting. The results revealed a significant upregulation of BAX expression. In addition, the results suggested that the mitochondrial apoptotic pathway regulated by p53-BAX may be the underlying mechanism responsible for the therapeutic effect of propranolol against IH. However, this result is in contrast with findings of Kum and Khan (43), which suggested that propranolol inhibits the growth of HemECs without inducing apoptosis. However, the results of the present study are somewhat similar to those obtained by Wong et al (28), which suggested that propranolol enhances the apoptosis of HemECs, although not hemangioma stem cells (HemSCs), and enhances adipogenesis in HemSCs. The results of the present study differ from the results obtained by Munabi et al (44) who found that the propranolol at doses of <10-4 M, had reduced cyclic adenosine monophosphate (cAMP) level causing decreased proliferation and viability of HemSC and propranolol at ≥10-5 M had reduced cyclic adenosine monophosphate (cAMP) levels and increased extracellular signal regulated kinase (ERK1/2) activation, suggesting induction of HemSC apoptosis and cytotoxicity at ≥10-4 M propranolol. Stimulation with isoprenaline, a β androgen receptor (βAR) agonist, had promoted HemSC proliferation and rescued the antiproliferative effects of propranolol, indicating that propranolol inhibited βAR signaling in HemSCs (44). The HemSC cell viability suppressed by propranolol was partially rescued by treatment with a cyclic adenosine monophosphate (cAMP) analog or a mitogen activated protein kinase (MAPK) inhibitor (44). A selective β 2 androgenic receptor (β2AR) antagonist mirrored propranolol's effects on HemSCs in a dose-dependent manner and a selective β1AR antagonist had no effect, supporting a role for β2AR signaling in IH pathobiology (44). Therefore, Munabi et al (44) demonstrated that propranolol acts on HemSCs in infantile hemangioma to suppress proliferation and promote apoptosis in a dose-dependent manner via β2 adrenergic receptor activation, resulting in reduced cAMP and MAP activation.

Transfection is the process of introducing nucleic acids into cells and is widely used in gene therapy, model construction and drug screening. In the present study, a plasmid with amplified p53 sequences was inserted into HemECs. Flow cytometry analysis, following treatment with propranolol, revealed that the apoptosis rate of transfected HemECs was significantly enhanced compared with the control. PFT-α is a p53 inhibitor that is widely used to study p53 function (45), and it is able to specifically inhibit the p53-dependent apoptotic pathway (45–47). In the present study, the apoptosis rate of HemECs inhibited by PFT-α was significantly suppressed compared with the control. In conclusion, the results suggest that p53 has an important role in propranolol-induced apoptosis.

Apoptosis is a process of programmed cell death in multicellular organisms, and it has an important role in the accommodation and adaptation of organisms. The mitochondrial pathway and the receptor signaling pathway represent the two major apoptosis pathways, and numerous proteins in these two pathways are targets of the p53 gene, including FAS, PIDD, DR5, BID, BAX, PIGs, PUMA and IGF-BP3. Considering this, the present study aimed to investigate the expression level alterations of these proteins between cells treated and untreated with propranolol using western blotting analysis. The results demonstrated that the expression level of BAX was significantly upregulated and the expression level of IGF-BP3 was significantly downregulated following treatment with propranolol, and the expression levels of the other investigated proteins did not significantly alter following treatment with propranolol. A further study (28) revealed that p53 and BAX were upregulated in HemECs following treatment with propranolol. BAX, a member of the Bcl-2 gene family, may be activated by p53 to induce apoptosis (48,49). In the present study, the expression level of BAX in HemECs treated with propranolol was significantly upregulated compared with the control, thus suggesting that BAX was activated following treatment with propranolol.

IGF-BP3 is able to interact with the cell surface proteins and is involved in the process of transduction of extracellular signals into cells with corresponding ligands (50). It has previously been demonstrated that there is a negative association between IGF-BP3 and p53 (51,52). In the present study, the expression level of IGF-BP3 was suppressed following treatment with propranolol, thus suggesting that p53 expression is upregulated. BAX activates the release of Cytochrome C via membrane remodeling and increasing membrane permeability, which subsequently results in the activation of caspases (Fig. 12).

A previous study (24) demonstrated that the p53-dependent pathway is the mechanism underlying the propranolol-induced apoptotic effect on HemECs in vitro so and the clinical use of propranolol has been increased gradually (53,54). In the present study, propranolol was revealed to have an apoptotic effect on HemECs in vitro and, simultaneously, the expression of BAX by the mitochondrial pathway was significantly elevated. Furthermore, the results of the present study demonstrated that enhanced p53 expression increased the apoptosis rate of HemECs, in which the p53-BAX-mediated mitochondrial pathway has an important role. Therefore, the results of the present study suggested that p53-BAX-mediated apoptosis of HemECs is the underlying mechanism responsible for the therapeutic effect of propranolol administration against IH.

Acknowledgements

The authors would like to thank the Department of Pediatric Surgery, The Second Affiliated Hospital of Xi'an Jiaotong University for providing experimental materials and support. The authors are grateful to Dr Zhong-Cheng Gong and Dr Bin Ling (Oncology Department of Oral and Maxillofacial Surgery, The First Affiliated Hospital of Xinjiang Medical University, Urumqi, China) who helped to make detailed adjustments of the procedures during the experiments.

Funding

The present study was supported by the National Natural Science Foundation of China (grant no. 30700954), and the Shaanxi Province Social Science and Technology Development and Research Project (grant no. 2016SF-315).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

T-HY and PP participated in the design of the study and conducted of the whole study. J-BT designed of the experiments and provided funding. KPR designed of the study, wrote the manuscript and was involved in word processing of data. X-WG and Q-YL constructed of high p53 expression model of HemECs and low p53 expression model of HemECs. J-TD and S-MG performed isolation and culture of HemECs and immunocytochemical staining.

Ethics approval and consent to participate

The present study was approved by the Ethical Board of The Second Affiliated Hospital of Xi'an Jiaotong University. Written informed consent was obtained routinely from the families of each patient, in accordance with the treatment protocol of the associated hospital. Additionally, written informed consent was obtained regarding the handling of samples according to the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

IH

infantile hemangioma

HemECs

hemangioma-derived endothelial cells

PFT-α

pifithrin-α

cDNA

complimentary DNA

PID

p53-induced protein with death domain

DR5

death receptor 5

BAX

apoptosis regulator BAX

BID

BH3-interacting domain death agonist (a pro-apoptotic protein)

PUMA

p53 unregulated modulator of apoptosis

IGF-BP3

insulin-like growth factor-binding protein 3

References

1 

Starkey E and Shahidullah H: Propranolol for infantile haemangiomas: A review. Arch Dis Child. 96:890–893. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Drolet BA, Swanson EA and Frieden IJ: Hemangioma Investigator Group: Infantile hemangiomas: An emerging health issue linked to an increased rate of low birth weight infants. J Pediatr. 153(712–715): 715.e12008.

3 

Greenberger S and Bischoff J: Infantile hemangioma-mechanism(s) of drug action on a vascular tumor. Cold Spring Harb Perspect Med. 1:a0064602011. View Article : Google Scholar : PubMed/NCBI

4 

Bowers RE, Graham EA and Tomlinson KM: The natural history of the strawberry nevus. Arch Dermatol. 82:667–680. 1960. View Article : Google Scholar

5 

Léauté-Labrèze C and Taïeb A: Efficacy of beta-blockers in infantile capillary haemangiomas: The physiopathological significance and therapeutic consequences. Ann Dermatol Venereol. 135:860–862. 2008.(In French). View Article : Google Scholar : PubMed/NCBI

6 

Zimmermann AP, Wiegand S, Werner JA and Eivazi B: Propranolol therapy for infantile haemangiomas: Review of the literature. Int J Pediatr Otorhinolaryngol. 74:338–342. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Schwartz RA, Sidor MI, Musumeci ML, Lin RL and Micali G: Infantile haemangiomas: A challenge in paediatric dermatology. J Eur Acad Dermatol Venereol. 24:631–638. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Buckmiller LM, Munson PD, Dyamenahalli U, Dai Y and Richter GT: Propranolol for infantile hemangiomas: Early experience at a tertiary vascular anomalies center. Laryngoscope. 120:676–681. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Léauté-Labrèze C, de la Roque Dumas E, Hubiche T, Boralevi F, Thambo JB and Taïeb A: Propranolol for severe hemangiomas of infancy. N Engl J Med. 358:2649–2651. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Handgretinger R: How an accidental discovery paved the way for the treatment of complicated infantile haemangiomas. Acta Paediatr. 103:896–897. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Manunza F, Syed S, Laguda B, Linward J, Kennedy H, Gholam K, Glover M, Giardini A and Harper JI: Propranolol for complicated infantile haemangiomas: A case series of 30 infants. Br J Dermatol. 162:466–468. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Missoi TG, Lueder GT, Gilbertson K and Bayliss SJ: Oral propranolol for treatment of periocular infantile hemangiomas. Arch Ophthalmol. 129:899–903. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Moodley ST, Hudson DA, Adams S and Adams KG: Shouldn't propranolol be used to treat all haemangiomas? Aesthetic Plast Surg. 39:963–967. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Schiestl C, Neuhaus K, Zoller S, Subotic U, Forster-Kuebler I, Michels R, Balmer C and Weibel L: Efficacy and safety of propranolol as first-line treatment for infantile hemangiomas. Eur J Pediatr. 170:493–501. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Vercellino N, Romanini MV, Pelegrini M, Rimini A, Occella C and Dalmonte P: The use of propranolol for complicated infantile hemangiomas. Int J Dermatol. 52:1140–1146. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Storch CH and Hoeger PH: Propranolol for infantile haemangiomas: Insights into the molecular mechanisms of action. Br J Dermatol. 163:269–274. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Lawley LP, Siegfried E and Todd JL: Propranolol treatment for hemangioma of infancy: Risks and recommendations. Pediatr Dermatol. 26:610–614. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Zhang D, Ma Q, Shen S and Hu H: Inhibition of pancreatic cancer cell proliferation by propranolol occurs through apoptosis induction: The study of beta-adrenoceptor antagonist's anticancer effect in pancreatic cancer cell. Pancreas. 38:94–100. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Phillips JD, Zhang H, Wei T and Richter GT: Expression of β-adrenergic receptor subtypes in proliferative, involuted, and propranolol-responsive infantile hemangiomas. JAMA Facial Plast Surg. 19:102–107. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Caporali A, Martello A, Miscianinov V, Maselli D, Vono R and Spinetti G: Contribution of pericyte paracrine regulation of the endothelium to angiogenesis. Pharmacol Ther. 171:56–64. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Mancini AJ and Smoller BR: Proliferation and apoptosis within juvenile capillary hemangiomas. Am J Dermatopathol. 18:505–514. 1996. View Article : Google Scholar : PubMed/NCBI

22 

Dong XY, Guo LL, Wei F, Li JF, Jiang ML, Li GM, Zhao YD and Chen H: Some characteristics and functional properties of rapeseed protein prepared by ultrasonication, ultrafiltration and isoelectric precipitation. J Sci Food Agric. 91:1488–1498. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Ahogo CK, Ezzedine K, Prey S, Colona V, Diallo A, Boralevi F, Taïeb A and Léauté-Labrèze C: Factors associated with the relapse of infantile haemangiomas in children treated with oral propranolol. Br J Dermatol. 169:1252–1256. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Tu JB, Li QY, Jiang F, Hu XY, Ma RZ, Dong Q, Zhang H, Pattar P and Li SX: Pingyangmycin stimulates apoptosis in human hemangioma-derived endothelial cells through activation of the p53 pathway. Mol Med Rep. 10:301–305. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Ye S, Zhao XY, Hu XG, Li T, Xu QR, Yang HM, Huang DS and Yang L: TP53 and RET may serve as biomarkers of prognostic evaluation and targeted therapy in hepatocellular carcinoma. Oncol Rep. 37:2215–2226. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Homo sapiens tumor protein p53 (TP53), transcript variant 1, mRNA-Nucleotide-NCBI. 2017.

27 

Li Y, Peart MJ and Prives C: Stxbp4 regulates DeltaNp63 stability by suppression of RACK1-dependent degradation. Mol Cell Biol. 29:3953–3963. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Wong A, Hardy KL, Kitajewski AM, Shawber CJ, Kitajewski JK and Wu JK: Propranolol accelerates adipogenesis in hemangioma stem cells and causes apoptosis of hemangioma endothelial cells. Plast Reconstr Surg. 130:1012–1021. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Ji Y, Li K, Xiao X, Zheng S, Xu T and Chen S: Effects of propranolol on the proliferation and apoptosis of hemangioma-derived endothelial cells. J Pediatr Surg. 47:2216–2223. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Weibel ER and Palade GE: New cytoplasmic components in arterial endothelia. J Cell Biol. 23:101–112. 1964. View Article : Google Scholar : PubMed/NCBI

32 

da Huang W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44–57. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Frieden IJ, Eichenfield LF, Esterly NB, Geronemus R and Mallory SB: Guidelines of care for hemangiomas of infancy. American Academy of Dermatology Guidelines/Outcomes Committee. J Am Acad Dermatol. 37:631–637. 1997. View Article : Google Scholar : PubMed/NCBI

34 

Haimowitz JE: Guidelines of care: Hemangiomas of infancy. J Am Acad Dermatol. 39:6621998. View Article : Google Scholar : PubMed/NCBI

35 

Lakshmi Chandrasekar K, Sankarapandiyan S and Mohanarangam Pulivadula VS: Intramuscular haemangioma with diagnostic challenge: A cause for strange pain in the masseter muscle. Case Rep Dent. 2014:2858342014.PubMed/NCBI

36 

Cho JK, Cha W and Sung MW: Intramuscular hemangioma in the anterior scalene muscle diagnosed by core needle biopsy. Clin Exp Otorhinolaryngol. 8:298–301. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Apfelberg DB, Maser MR and Lash H: Argon laser treatment of cutaneous vascular abnormalities: Progress report. Ann Plast Surg. 1:14–18. 1978. View Article : Google Scholar : PubMed/NCBI

38 

Edgerton MT: The treatment of hemangiomas: with special reference to the role of steroid therapy. Ann Surg. 183:517–532. 1976. View Article : Google Scholar : PubMed/NCBI

39 

Kveton JF and Pillsbury HC: Conservative treatment of infantile subglottic hemangioma with corticosteroids. Arch Otolaryngol. 108:117–119. 1982. View Article : Google Scholar : PubMed/NCBI

40 

Léauté-Labrèze C, Hoeger P, Mazereeuw-Hautier J, Guibaud L, Baselga E, Posiunas G, Phillips RJ, Caceres H, Gutierrez Lopez JC, Ballona R, et al: A randomized, controlled trial of oral propranolol in infantile hemangioma. N Engl J Med. 372:735–746. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Drolet BA, Frommelt PC, Chamlin SL, Haggstrom A, Bauman NM, Chiu YE, Chun RH, Garzon MC, Holland KE, Liberman L, et al: Initiation and use of propranolol for infantile hemangioma: Report of a consensus conference. Pediatrics. 131:128–140. 2013. View Article : Google Scholar : PubMed/NCBI

42 

Lin TT and He YJ: The advance of β-blockers in the treatment of infantile hemangiomas. Zhonghua Yan Ke Za Zhi. 49:1138–1144. 2013.(In Chinese). PubMed/NCBI

43 

Kum JJ and Khan ZA: Propranolol inhibits growth of hemangioma-initiating cells but does not induce apoptosis. Pediatr Res. 75:381–388. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Munabi NC, England RW, Edwards AK, Kitajewski AA, Tan QK, Weinstein A, Kung JE, Wilcox M, Kitajewski JK, Shawber CJ and Wu JK: Propranolol targets hemangioma stem cells via cAMP and mitogen-activated protein kinase regulation. Stem Cells Transl Med. 5:45–55. 2016. View Article : Google Scholar : PubMed/NCBI

45 

El-Gibaly AM, Scheuer C, Menger MD and Vollmar B: Improvement of rat liver graft quality by pifithrin-alpha-mediated inhibition of hepatocyte necrapoptosis. Hepatology. 39:1553–1562. 2004. View Article : Google Scholar : PubMed/NCBI

46 

Leker RR, Aharonowiz M, Greig NH and Ovadia H: The role of p53-induced apoptosis in cerebral ischemia: effects of the p53 inhibitor pifithrin alpha. Exp Neurol. 187:478–486. 2004. View Article : Google Scholar : PubMed/NCBI

47 

Murphy PJ, Galigniana MD, Morishima Y, Harrell JM, Kwok RP, Ljungman M and Pratt WB: Pifithrin-alpha inhibits p53 signaling after interaction of the tumor suppressor protein with hsp90 and its nuclear translocation. J Biol Chem. 279:30195–30201. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Gross A, McDonnell JM and Korsmeyer SJ: BCL-2 family members and the mitochondria in apoptosis. Genes Dev. 13:1899–1911. 1999. View Article : Google Scholar : PubMed/NCBI

49 

Czabotar PE, Lessene G, Strasser A and Adams JM: Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy. Nat Rev Mol Cell Biol. 15:49–63. 2014. View Article : Google Scholar : PubMed/NCBI

50 

Longobardi L, Torello M, Buckway C, O'Rear L, Horton WA, Hwa V, Roberts CT Jr, Chiarelli F, Rosenfeld RG and Spagnoli A: A novel insulin-like growth factor (IGF)-independent role for IGF binding protein-3 in mesenchymal chondroprogenitor cell apoptosis. Endocrinology. 144:1695–1702. 2003. View Article : Google Scholar : PubMed/NCBI

51 

Ali O, Cohen P and Lee KW: Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35:726–733. 2003. View Article : Google Scholar : PubMed/NCBI

52 

Grimberg A, Liu B, Bannerman P, El-Deiry WS and Cohen P: IGFBP-3 mediates p53-induced apoptosis during serum starvation. Int J Oncol. 21:327–335. 2002.PubMed/NCBI

53 

Fernandez-Pineda I, Williams R, Ortega-Laureano L and Jones R: Cardiovascular drugs in the treatment of infantile hemangioma. World J Cardiol. 8:74–80. 2016. View Article : Google Scholar : PubMed/NCBI

54 

Tian Y, Xu DP, Tong S, Xi SL, Liu ZM and Wang XK: Oral propranolol for the treatment of infantile hemangiomas in the post-proliferative phase: A-single center retrospective study of 31 cases. J Oral Maxillofac Surg. 74:1623–1629. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yao TH, Pataer P, Regmi KP, Gu XW, Li QY, Du JT, Ge SM and Tu JB: Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647. Mol Med Rep 18: 684-694, 2018.
APA
Yao, T., Pataer, P., Regmi, K.P., Gu, X., Li, Q., Du, J. ... Tu, J. (2018). Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647. Molecular Medicine Reports, 18, 684-694. https://doi.org/10.3892/mmr.2018.9013
MLA
Yao, T., Pataer, P., Regmi, K. P., Gu, X., Li, Q., Du, J., Ge, S., Tu, J."Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647". Molecular Medicine Reports 18.1 (2018): 684-694.
Chicago
Yao, T., Pataer, P., Regmi, K. P., Gu, X., Li, Q., Du, J., Ge, S., Tu, J."Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647". Molecular Medicine Reports 18, no. 1 (2018): 684-694. https://doi.org/10.3892/mmr.2018.9013
Copy and paste a formatted citation
x
Spandidos Publications style
Yao TH, Pataer P, Regmi KP, Gu XW, Li QY, Du JT, Ge SM and Tu JB: Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647. Mol Med Rep 18: 684-694, 2018.
APA
Yao, T., Pataer, P., Regmi, K.P., Gu, X., Li, Q., Du, J. ... Tu, J. (2018). Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647. Molecular Medicine Reports, 18, 684-694. https://doi.org/10.3892/mmr.2018.9013
MLA
Yao, T., Pataer, P., Regmi, K. P., Gu, X., Li, Q., Du, J., Ge, S., Tu, J."Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647". Molecular Medicine Reports 18.1 (2018): 684-694.
Chicago
Yao, T., Pataer, P., Regmi, K. P., Gu, X., Li, Q., Du, J., Ge, S., Tu, J."Propranolol induces hemangioma endothelial cell apoptosis via a p53‑BAX mediated pathway Corrigendum in /10.3892/mmr.2025.13647". Molecular Medicine Reports 18, no. 1 (2018): 684-694. https://doi.org/10.3892/mmr.2018.9013
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team