Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2018 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2018 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing

  • Authors:
    • Changqiang Chen
    • Xuqian Fang
    • Shunchang Sun
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, Ruijin Hospital North, Shanghai Jiao Tong University School of Medicine, Shanghai 201801, P.R. China
  • Pages: 1037-1042
    |
    Published online on: May 22, 2018
       https://doi.org/10.3892/mmr.2018.9043
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Spinocerebellar ataxia (SCA) is a group of genetic diseases of the nervous system with genetic and clinical heterogeneity. SCA is often caused by an expanded CAG repeat sequence in the encoding protein. Genetic testing is necessary to diagnose and classify the types of SCA. Next‑generation DNA sequencing usually generates a high error rate for insertion or deletion mutations, so it is unhelpful for classifying the types of SCA. In the present study, a Chinese SCA pedigree was preliminarily diagnosed with SCA1 using polymerase chain reaction (PCR) amplification. The propositus and his three younger siblings were diagnosed with SCA1 as a result of the identification of the length of the expanded CAG repeat sequence in the ATXN1 gene performed using Sanger sequencing. The current study presents a convenient and efficient method to identify causative mutations for polyglutamine SCA using PCR amplification followed by Sanger sequencing.

Introduction

Spinocerebellar ataxias (SCAs), a genetically heterogeneous group of disorders, are inherited in an autosomal-dominant pattern. Currently, over 30 different types of SCA have been reported, however only ~50% of causative mutations have been identified (1). The majority of SCA cases are caused by an abnormally expanded CAG repeat sequence that leads to the expansion of a tract of polyglutamine residues in the encoded proteins (2). The SCAs caused by the CAG repeat expansion mutation are classified as polyglutamine SCAs. These include SCA1, SCA2, SCA3, SCA6, SCA7, SCA12, SCA17, and dentatorubral-pallidoluysian atrophy (DRPLA), in which the expansion within the glutamine-encoding CAG trinucleotide repeats accounts for SCA (3). Healthy individuals usually carry the heterozygous CAG repeats at a number below the predicted pathological threshold. SCA8, probably arising from a non-coding CTG repeat expansion is also grouped with polyglutamine SCAs (4). The threshold of CAG/CTG expansions that determine disease carrier status varies between the different types of SCA (5). Several methods have been used for detecting polyglutamine SCA mutations including fluorescence polymerase chain reaction (PCR), denaturing polyacrylamide gel electrophoresis of DNA, next-generation DNA sequencing and direct sequencing (6). However, these methods have some limitations when applied to a clinical laboratory setting (7). Therefore, there is a need to develop a simple and rapid method for the detection of CAG repeat mutations. PCR amplification of the CAG repeat mutations followed by Sanger sequencing is a simple and inexpensive method for detection. In the current study, the authors present a convenient method for screening causative mutations for polyglutamine SCA using PCR amplification followed by Sanger sequencing. A Chinese SCA1 pedigree was identified using this method.

Materials and methods

Pedigree

The study was approved by the ethics committee of Shenzhen Baoan Hospital, Southern Medical University (Shenzhen, China). Written informed patient consent was obtained before initiating the study. The pedigree investigated in the present study is shown in Fig. 1. The propositus (IV-3) a 24-year-old male individual phenotypically characterized by a slowly progressive incoordination of gait, associated with poor coordination of hands, was referred to the Department of Neurology due to primary difficulty walking. The propositus complained of slow walking and unsteady gait from the age of 18. The clinical features of the propositus included limb ataxia, dysarthria, dysphagia, action tremors, increased tendon reflexes and handwriting difficulties on examination. Brain magnetic resonance imaging (data not shown) indicated prominent atrophy of the cerebellum and brainstem. The family was diagnosed with SCA by a clinical neurologist according to neuroimaging, family history and physical examination. The age of onset was defined according to the early signs of gait disturbance and slurred speech described by the family members in the SCA pedigree. Genomic DNA was extracted from the peripheral leukocytes of the 8 subjects given serial numbers in the SCA pedigree and 205 normal controls using standard protocol (8). Three subjects (IV-5, 7 and 8) were asymptomatic causative SCA1 gene carriers at gene diagnosis in the pedigree.

Figure 1.

Pedigree of the family with SCA. Squares indicate males; circles indicate females; an arrow indicates the propositus. Slash marks indicate subjects who are deceased. Roman numerals indicate generations, and Arabic numbers indicate subjects. SCA, spinocerebellar ataxia.

Screening PCR

Polyglutamine SCA includes SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12, SCA17 and DRPLA. A total of 9 fragments including CAG/CTG expansion sequences were amplified by PCR using primer sets shown in Table I. First, 100 ng of genomic DNA was amplified by PCR in a 50 µl reaction volume containing 10 mM Tris-HCl, (pH 8.3), 2.5 mM MgCl2, 50 mM KCl, 200 M of each dNTP, 2 U Taq polymerase, and 0.5 M each primer (Table I). Following denaturation at 95°C for 7 min, amplification was performed at 95°C for 50 seconds, annealing for 50 sec under different temperatures as described in Table I, and 72°C for 60 sec for 35 cycles followed by a final extension at 72°C for 7 min. After amplification, electrophoresis was performed in a 2% agarose gel (100 V, 45 min) to detect the amplified DNA fragments, then agarose gel was exposed under a UV light imager.

Table I.

Sequences of oligonucleotide primer sets for polymerase chain reaction.

Table I.

Sequences of oligonucleotide primer sets for polymerase chain reaction.

PrimerSequence (5′-3′)Annealing temperature (°C)Fragment size of the wild-type allele
SCA1-F ggtcctcccaatacagtgga60364–403
SCA1-R ttctgcggagaactggaaat
SCA2-F ctccgcctcagactgttttg61810–837
SCA2-R ctgaccatcgccgctacc
SCA3-F tctgtatcagactaactgctcttgc59369–438
SCA3-R gagggaatgaagaataatgtaaagc
SCA6-F tcccgtgtctcctttgattt59378–411
SCA6-R gacccgcctctccatcct
SCA7-F taggagcggaaagaatgtcg56280–310
SCA7-R cccagcatcacttcaggact
SCA8-F gcagtatgaggaagtatggaaaaa59230–335
SCA8-R ttctgactcccagcttccac
SCA12-F ccactgcagcaaagagca59280–355
SCA12-R ggaatgagggtgctggtc
SCA17-F gaccccacagcctattcaga60196–247
SCA17-R gcctgaggttccctgtgtt
DRPLA-F ccaccacctcctccctatg60209–257
DRPLA-R agtgggtggggaaatgct

[i] SCA, spinocerebellar ataxia; DRPLA, dentatorubral-pallidoluysian atrophy; F, forward; R, reverse.

Sanger sequencing

Following purification, amplified PCR fragments were subjected to bidirectional direct and cycle sequencing. Direct sequencing was performed using the ABI3730 Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Cycle sequencing was performed using Stratagene's RoboCycler Gradient (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) 96 temperature cycler with Hot Top Assembly. The DNA polymerase used in sequencing was Platinum SuperFi DNA Polymerase (Invitrogen, Thermo Fisher Scientific, Inc.) which combines high fidelity and high sequence accuracy. All sequencing of PCR fragments was performed more than twice, the identical sequencing results were regarded as the number of CAG triplet repeats carried by individuals.

Results

Mutation screening

The mutation screening results of SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12, SCA17 and DRPLA are presented in Fig. 2 for the propositus in the SCA pedigree and a healthy subject. Two amplification fragments of distinctly different sizes were observed for the propositus using the primer sets to amplify the CAG repeats in the ATXN1 gene and two fragments of nearly the same size or only a fragment of amplification were found using other primer sets. Two fragments of nearly the same size or only a fragment of amplification were seen for the healthy subject using each pair of PCR primers. Mutation screening suggested that the propositus was a SCA1 patient. The screening PCR detected two fragments of distinctly different sizes in 4 out of the 8 tested individuals including the propositus using the given set of primers to amplify the SCA1 CAG expansion (Fig. 3). The three siblings of the propositus (IV-5, IV-7 and V-8) were asymptomatic causative SCA1 gene carriers as determined by gene mutation analysis. Sanger sequencing was needed in order to count the number of CAG repeats in the ATXN1 gene in the SCA pedigree for accurate diagnosis. The other four members (II-1, III-4, IV-1 and IV-6) were healthy subjects because only two fragments of nearly the same size were found.

Figure 2.

Screening PCR for SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12, SCA17 and DRPLA for the (A) propositus in the SCA pedigree and (B) the healthy subject. Lane M: Molecular weight marker DNA ladder (1,000, 900, 800, 700, 600, 500, 400, 300, 250, 200, 150, 100 and 50 bp); lane 1-D: The amplified fragments with primer sets for SCA1, SCA2, SCA3, SCA6, SCA7, SCA8, SCA12, SCA17, and DRPLA, respectively; lane B: blank. PCR, polymerase chain reaction; SCA, spinocerebellar ataxia; DRPLA, dentatorubral-pallidoluysian atrophy.

Figure 3.

Screening PCR for SCA1 for the SCA pedigree. Lane M: molecular weight marker DNA ladder. Lanes marked with roman numerals indicated the serial number of subjects. The serial number was given to the individuals according to The American Society of Human Genetics. The Roman numerals indicated generation, the Arabic numerals indicated the number in the same generation. PCR, polymerase chain reaction; SCA, spinocerebellar ataxia; DRPLA, dentatorubral-pallidoluysian atrophy.

Sanger sequencing

With Sanger sequencing, 67 CAG trinucleotide repeat genotypes were detected in 205 normal healthy subjects (Table II). The normal range of the SCA1 CAG trinucleotide repeats was 7–38 repeats, with the common repeat being 23–33 repeats in the Chinese population (Fig. 4). The normal range of CAG repeats was similar to that reported for other ethnic populations. Usually normal alleles containing 18–38 CAG repeats were interrupted by 1–3 CAT interruptions, however a few alleles containing 7–23 repeats were not interrupted. In the present study, a CAG triplet repeat (length 61) was detected for the propositus (IV-3). A repeat length of 51 (IV-7) and 50 (in both IV-5 and IV-8) was observed in the three younger siblings for the SCA1 pedigree. The other two subjects (IV-1 and IV-6) carried a normal range of CAG repeats (28–33) in the ATXN1 gene (Table III). The larger the CAG repeat, the earlier the age of onset for SCA1 (Table IV). The three siblings with 50 or 51 triplet repeats had no SCA1 symptoms, which indicated a possible late onset. The family members IV-5, IV-7 and IV-8 could be diagnosed with SCA1 according to the sequencing results, while the subjects IV-1 and IV-6 could be considered healthy individuals.

Figure 4.

Genotype frequency of different CAG trinucleotide repeats in the ATXN1 gene in healthy Chinese subjects.

Table II.

Frequency of the CAG trinucleotide repeat genotype in the ATXN1 gene in healthy subjects.

Table II.

Frequency of the CAG trinucleotide repeat genotype in the ATXN1 gene in healthy subjects.

AlleleNumber of polyglutamines (histidines)FrequencyAlleleNumber of polyglutamines (histidines)Frequency
(CAG)11CAT(CAG)16280.282927 (CAG)13CATCAGCAT(CAG)15310.002439
(CAG)13CATCAGCAT(CAG)10260.14878 (CAG)12CATCAGCATCAGCAT(CAG)14310.002439
(CAG)12CATCAGCAT(CAG)15300.092683 (CAG)19CAT(CAG)10300.002439
(CAG)17CATCAGCAT(CAG)10300.063415 (CAG)13CATCAGCAT(CAG)14300.002439
(CAG)16CATCAGCAT(CAG)10290.053659 (CAG)11CATCAGCAT(CAG)14280.002439
(CAG)13CATCAGCAT(CAG)13290.039024 (CAG)10CATCAGCAGCAT(CAG)14280.002439
(CAG)14CATCAGCAT(CAG)10270.026829 (CAG)12CATCAGCATCAGCAT(CAG)10270.002439
(CAG)11CAT(CAG)11230.02439 (CAG)12CATCAGCAT(CAG)12270.002439
(CAG)18CATCAGCAT(CAG)10310.019512 (CAG)14CAT(CAG)12270.002439
(CAG)11CAT(CAG)11230.019512 (CAG)15CAT(CAG)11270.002439
(CAG)11CAT(CAG)15270.017073 (CAG)13CAT(CAG)12260.002439
(CAG)15CATCAGCAT(CAG)10280.014634 (CAG)11CATCAGCAGCAT(CAG)11260.002439
(CAG)14CATCAGCAT(CAG)13300.012195 (CAG)13CATCAGCAT(CAG)10260.002439
(CAG)14CATCAGCAT(CAG)16330.009756 (CAG)13CAT(CAG)12260.002439
(CAG)12CATCAGCAT(CAG)14290.009756 (CAG)13CATCAGCAT(CAG)9250.002439
(CAG)12CATCAGCAT(CAG)10250.009756 (CAG)8CAT(CAG)16250.002439
(CAG)19CATCAGCAT(CAG)10320.007317 (CAG)12CAT(CAG)12250.002439
(CAG)12CATCAGCAT(CAG)16310.007317 (CAG)8CAT(CAG)16250.002439
(CAG)12CATCAGCAGCAT(CAG)14300.004878 (CAG)12CATCAGCAT(CAG)9240.002439
(CAG)11CATCAGCAT(CAG)15290.004878 (CAG)11CATCAGCAT(CAG)10240.002439
(CAG)11CAT(CAG)17290.004878 (CAG)7CAT(CAG)16240.002439
(CAG)11CATCAGCAGCAT(CAG)14290.004878 (CAG)11CAT(CAG)12240.002439
(CAG)13CATCAGCAT(CAG)12280.004878 (CAG)8CAT(CAG)14230.002439
(CAG)10CAT(CAG)16270.004878 (CAG)23230.002439
(CAG)11CAT(CAG)15270.004878 (CAG)11CAT(CAG)10220.002439
(CAG)11CAT(CAG)12240.004878 (CAG)5CATCAGCAT(CAG)10180.002439
(CAG)17170.004878 (CAG)15150.002439
(CAG)11CAT(CAG)9CAT(CAG)16380.002439 (CAG)14140.002439
(CAG)21CATCAGCAT(CAG)10340.002439 (CAG)13130.002439
(CAG)12CAT(CAG)20330.002439 (CAG)11110.002439
(CAG)13CATCAGCAT(CAG)16320.002439 (CAG)10100.002439
(CAG)11CAT(CAG)20320.002439 (CAG)9  90.002439
(CAG)12CATCAGCAGCAT(CAG)15310.002439 (CAG)7  70.002439
(CAG)15CATCAGCAT(CAG)13310.002439

Table III.

CAG repeats in the ATXN1 gene in the spinocerebellar ataxia pedigree.

Table III.

CAG repeats in the ATXN1 gene in the spinocerebellar ataxia pedigree.

SubjectsAlleleNumber of polyglutamines (histidines)
II-1 (CAG)16CATCAGCAT(CAG)10/(CAG)17CATCAGCAT(CAG)1029/30
III-4 (CAG)16CATCAGCAT(CAG)10/(CAG)13CATCAGCAT(CAG)1029/26
IV-1 (CAG)16CATCAGCAT(CAG)10/(CAG)11CAT (CAG)1629/28
IV-3 (CAG)13CATCAGCAT(CAG)10/(CAG)6126/61
IV-5 (CAG)12CATCAGCAT(CAG)15/(CAG)5030/50
IV-6 (CAG)15CATCAGCAT(CAG)15/(CAG)17CATCAGCAT(CAG)1033/30
IV-7 (CAG)12CATCAGCAT(CAG)15/(CAG)5130/51
IV-8 (CAG)12CATCAGCAT(CAG)15/(CAG)5030/50

Table IV.

Age of the onset in the spinocerebellar ataxia 1 pedigree.

Table IV.

Age of the onset in the spinocerebellar ataxia 1 pedigree.

SubjectsAge of the onset (Years)Number of polyglutamines (histidines)
I-137N/A
II-234N/A
III-228N/A
III-526N/A
III-729N/A
IV-222N/A
IV-31826/61
IV-5Asymptomatic30/50
IV-7Asymptomatic30/51
IV-8Asymptomatic30/50

[i] N/A, not applicable (DNA was not obtained).

Discussion

Polyglutamine SCAs represent a genetically heterogeneous group of disorders involving the nervous system with a dominant pattern of inheritance. These SCAs are caused by the expansion of a CAG/CTG triplet repeat (9). Diagnosis of polyglutamine SCA requires clinical assessment for the presence of ataxia and onset age, a family history, and the clinical characteristics. The diagnosis is only the beginning; a confirmative genetic study should be performed to classify the type of SCA for genetic counseling and family planning (10). This would gradually reduce the incidence of the SCA. Healthy subjects often carry the heterozygous CAG repeats below the pathological threshold, therefore, two PCR fragments of nearly the same size are usually found using agarose gel electrophoresis. Two fragments of distinctly different sizes indicate the pathologically expanded CAG repeat sequence is present. The present study demonstrated a convenient molecular analysis technique for accurate diagnosis of polyglutamine SCA by PCR amplification and Sanger sequencing. The diagnosis of SCA1 was suspected for the family of the propositus with the CAG expansion in the ATXN1 gene by PCR amplification. The CAG triplet repeat expansion was found in the propositus and his three younger siblings in the ATXN1 gene. PCR is a relatively simple and inexpensive tool that can be used in most clinical laboratories, and agarose gel electrophoresis of the PCR products is easy to perform. Screening for polyglutamine SCAs by PCR is a rapid and efficient method compared with other mutation detection methods. The definitive diagnosis of SCA1 depended on the results of Sanger sequencing of the CAG repeat expansion in the ATXN1 gene. A total of 61 CAG triplet repeats were detected for the propositus who presented with initial ataxia symptoms and signs at the age of 18. The three younger siblings of the propositus carrying 51 or 50 CAG repeats in the ATXN1 gene showed no symptoms or signs of ataxia at the age of 22–28 years for the SCA1 pedigree. Three subjects carrying the CAG repeat expansion were diagnosed with SCA1 according to the sequencing results.

The onset age is inversely correlated with the number of CAG triplet repeats, the triplet repeat number is also associated with the severity of the disease. The larger the CAG triplet repeat number, the more serious the disease (11). In the present study, a pedigree showing genetic anticipation in SCA was investigated. Genetic anticipation in the age at which onset was observed in the past three generations for the family according to the families' recollection (Table IV). The mechanism of genetic anticipation in SCA is the intergenerational unstable amplification of CAG triplet repeat sequences. The greater the CAG repeat number increases with the generation, the more the age-at-onset decreases in successive generations (12). Genetic anticipation tends to be more prominent when the CAG expansion comes from paternal inheritance compared with maternal inheritance (13). The different onset age between the propositus and his three younger siblings should be caused by a distinctive inheritance pattern. The propositus obtained the causative mutation of CAG repeat expansion from his father who died of SCA1 at the age of 35. Three siblings of the propositus carrying 50–51 CAG repeats showed no symptoms or signs of SCA1 at the age of 22–28 years as a result of maternal inheritance. The phenotype of the disease may be present ~10 years later for the three younger siblings carrying 50–51 CAG repeats, according to the correlation between the length of CAG repeat expansion and age at disease onset, although statistical analyses were not performed. Certainly, the age-at-onset and phenotype of the disease can be affected by regulating genetic and environmental factors (14). Thus, Sanger sequencing of the fragments of the trinucleotide repeat sequence is helpful to predict the age-at-onset and phenotype of SCA. In the Chinese population, gene mutations in ATXN3 are the most common, followed by SCA2, SCA1, SCA7, SCA6, and SCA12 (15). In the present study, there was evidence of genetic anticipation, which could be caused by an abnormally expanded CAG repeat sequence in the pedigree. The family was affected by a polyglutamine SCA. The SCA1 was a preliminary diagnosis for the family by PCR amplification. Accurate diagnosis of 4 cases with SCA1 was performed using Sanger sequencing of the CAG repeat expansion in the ATXN1 gene, which was helpful to infer the age-at-onset. The results of the present study suggest that PCR amplification followed by Sanger sequencing is a useful tool to diagnose polyglutamine SCA.

Acknowledgments

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (31571294).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

CC analyzed the patient data and performed screening PCR. XF performed Sanger sequencing. SS designed the study and was a major contributor in writing the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the ethics committee of Shenzhen Baoan Hospital, Southern Medical University. Written informed patient consent was obtained before initiating the study.

Consent for publication

The patient has provided written informed consent for the publication of any associated data.

Competing interests

The authors declare that they have no competing interests.

References

1 

Nibbeling EAR, Duarri A, Verschuuren-Bemelmans CC, Fokkens MR, Karjalainen JM, Smeets CJLM, de Boer-Bergsma JJ, van der Vries G, Dooijes D, Bampi GB, et al: Exome sequencing and network analysis identifies shared mechanisms underlying spinocerebellar ataxia. Brain. 140:2860–2878. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Dell'Orco JM, Pulst SM and Shakkottai VG: Potassium channel dysfunction underlies Purkinje neuron spiking abnormalities in spinocerebellar ataxia type 2. Hum Mol Genet. 26:3935–3945. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Sutton JR, Blount JR, Libohova K, Tsou WL, Joshi GS, Paulson HL, Costa MDC, Scaglione KM and Todi SV: Interaction of the polyglutamine protein ataxin-3 with Rad23 regulates toxicity in drosophila models of spinocerebellar ataxia type 3. Hum Mol Genet. 26:1419–1431. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Terada T, Kono S, Konishi T, Miyajima H and Ouchi Y: Altered GABAergic system in the living brain of a patient with spinocerebellar ataxia type 8. J Neurol. 260:3164–3166. 2013. View Article : Google Scholar : PubMed/NCBI

5 

du Montcel Tezenas S, Durr A, Bauer P, Figueroa KP, Ichikawa Y, Brussino A, Forlani S, Rakowicz M, Schöls L, Mariotti C, et al: Modulation of the age at onset in spinocerebellar ataxia by CAG tracts in various genes. Brain. 137:2444–2455. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Li M, Pang SY, Song Y, Kung MH, Ho SL and Sham PC: Whole exome sequencing identifies a novel mutation in the transglutaminase 6 gene for spinocerebellar ataxia in a Chinese family. Clin Genet. 83:269–273. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Rothberg Gould BE and Rothberg JM: Massively parallel (‘next-generation’) DNA sequencing. Clin Chem. 61:997–998. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Miller SA, Dykes DD and Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:12151988. View Article : Google Scholar : PubMed/NCBI

9 

Shakkottai VG and Fogel BL: Clinical neurogenetics: Autosomal dominant spinocerebellar ataxia. Neurol Clin. 31:987–1007. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Melo AR, Ramos A, Kazachkova N, Raposo M, Bettencourt BF, Rendeiro AR, Kay T, Vasconcelos J, Bruges-Armas J and Lima M: Triplet repeat primed PCR (TP-PCR) in molecular diagnostic testing for spinocerebellar ataxia type 3 (SCA3). Mol Diagn Ther. 20:617–622. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Scoles DR, Meera P, Schneider MD, Paul S, Dansithong W, Figueroa KP, Hung G, Rigo F, Bennett CF, Otis TS and Pulst SM: Antisense oligonucleotide therapy for spinocerebellar ataxia type 2. Nature. 544:362–366. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Lai S, O'Callaghan B, Zoghbi HY and Orr HT: 14-3-3 Binding to ataxin-1(ATXN1) regulates its dephosphorylation at Ser-776 and transport to the nucleus. J Biol Chem. 286:34606–34616. 2011. View Article : Google Scholar : PubMed/NCBI

13 

McMurray CT: Mechanisms of trinucleotide repeat instability during human development. Nat Rev Genet. 11:786–799. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Chatterjee N, Lin Y, Santillan BA, Yotnda P and Wilson JH: Environmental stress induces trinucleotide repeat mutagenesis in human cells. Proc Natl Acad Sci USA. 112:3764–3769. 2015.PubMed/NCBI

15 

Wang J, Shen L, Lei L, Xu Q, Zhou J, Liu Y, Guan W, Pan Q, Xia K, Tang B and Jiang H: Spinocerebellar ataxias in mainland China: an updated genetic analysis among a large cohort of familial and sporadic cases. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36:482–489. 2011.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen C, Fang X and Sun S: Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing. Mol Med Rep 18: 1037-1042, 2018.
APA
Chen, C., Fang, X., & Sun, S. (2018). Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing. Molecular Medicine Reports, 18, 1037-1042. https://doi.org/10.3892/mmr.2018.9043
MLA
Chen, C., Fang, X., Sun, S."Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing". Molecular Medicine Reports 18.1 (2018): 1037-1042.
Chicago
Chen, C., Fang, X., Sun, S."Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing". Molecular Medicine Reports 18, no. 1 (2018): 1037-1042. https://doi.org/10.3892/mmr.2018.9043
Copy and paste a formatted citation
x
Spandidos Publications style
Chen C, Fang X and Sun S: Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing. Mol Med Rep 18: 1037-1042, 2018.
APA
Chen, C., Fang, X., & Sun, S. (2018). Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing. Molecular Medicine Reports, 18, 1037-1042. https://doi.org/10.3892/mmr.2018.9043
MLA
Chen, C., Fang, X., Sun, S."Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing". Molecular Medicine Reports 18.1 (2018): 1037-1042.
Chicago
Chen, C., Fang, X., Sun, S."Diagnosis of polyglutamine spinocerebellar ataxias by polymerase chain reaction amplification and Sanger sequencing". Molecular Medicine Reports 18, no. 1 (2018): 1037-1042. https://doi.org/10.3892/mmr.2018.9043
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team