Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2018 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2018 Volume 18 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury

  • Authors:
    • Yang Liu
    • Wanting Cao
    • Xiangbo Kong
    • Jie Li
    • Xueying Chen
    • Yaping Ge
    • Wanzhen Zhong
    • Silian Fang
  • View Affiliations / Copyright

    Affiliations: Department of Oral and Maxillofacial Surgery, The Sixth Affiliated Hospital of Sun Yat‑Sen University, Guangzhou, Guangdong 510655, P.R. China, Department of Stomatology, Sun Yat‑Sen Memorial Hospital of Sun Yat‑Sen University, Guangzhou, Guangdong 510120, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4219-4228
    |
    Published online on: September 4, 2018
       https://doi.org/10.3892/mmr.2018.9449
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Osteoradionecrosis of the jaws (ORNJ) is a complication of oral and maxillofacial malignancy that arises following radiotherapy; progressive jaw necrosis severely decreases the quality of life of patients. Human bone marrow mesenchymal stem cells (hBMMSCs) are a cell type with self‑renewal and pluripotent differentiation potential in the bone marrow stroma. These cells are associated with bone tissue regeneration and are one of the primary cell types affected by bone tissue radiation injury. α‑2‑macroglobulin (α2M) is a glycoprotein‑rich macromolecule that interacts with cytokines, growth factors and hormones to serve a variety of biological roles. In addition, α2M possesses radio‑protective effects. The aim of the present study was to investigate whether α2M has protective effects against radiation injury of hBMMSCs. Cell counting kit‑8 and colony formation assays were used to monitor cell proliferation. Western blot analysis and reverse transcription‑quantitative polymerase chain reaction were used to detect Beclin1, microtubule‑associated protein 1A/1B, sex determining region Y, Nanog, runt‑related transcription factor 2, osteoglycin and manganese superoxide dismutase expression. The formation of calcium nodules was evaluated by Alizarin red staining after osteogenic induction. Flow cytometric analysis of Annexin‑V and propidium iodide double staining was used to detect changes in apoptosis rate. Alkaline phosphatase and superoxide dismutase activity were determined using colorimetric assays. Reactive oxygen species levels were detected using 2',7'‑dichlorodihydrofluorescein diacetate. The results of the present study revealed that α2M increased the rate of proliferation, reduced autophagy, alleviated pluripotent differentiation injury, increased the osteogenic differentiation ability and decreased the rate of apoptosis in hBMMSCs following irradiation via an antioxidative pathway. In conclusion, α2M exhibited protective effects against radiation injury in hBMMSCs and may be considered a potential therapeutic agent for the prevention and treatment of ORNJ.

Introduction

At present, radiation therapy is one of the primary means of treatment for malignant tumors. When radiation is used to eliminate tumor cells, the adjacent normal tissues and organs are unavoidably exposed, causing various complications (1). Osteoradionecrosis of the jaws (ORNJ) is a serious complication of oral and maxillofacial malignancies that commonly follows a regimen of radiotherapy treatment. Symptoms in patients include tissue necrosis, exposure of dead bone and pathological fractures (2,3).

Human bone marrow mesenchymal stem cells (hBMMSCs) are cells with pluripotent differentiation potential, which can differentiate into osteoblasts, adipocytes and chondrocytes. hBMMSCs are also one of the major target cell types involved in damage of bone tissue via radiation (4,5). It has been demonstrated that radiation can induce hBMMSC proliferative abnormalities, genomic DNA damage and micronucleus formation (6); radiation has been reported to inhibit osteogenic differentiation in hBMMSCs (6).

Previously, the authors reported that α-2-macroglobulin (α2M) is expressed at low levels in the serum of patients with ORNJ, which was determined via the analysis of clinical samples (7,8). In addition, ELISA demonstrated a positive correlation between α2M expression and radiotherapy dosage in patients who received radiotherapy for the treatment of nasopharyngeal carcinoma (9). This suggested that α2M is closely associated with radiation injury in the jaw bone; however, the underlying mechanism is unknown. α2M is an important macromolecular glycoprotein in the plasma and belongs to a family of broad-spectrum protease inhibitors (10). Accumulating data has demonstrated that α2M possesses a wide range of biological functions, including radioprotective, anti-infective and anti-inflammatory effects (11). In addition, α2M was reported to exhibit protection against damage from anti-ionizing radiation (12).

In the present study, the protective effects of α2M on hBMMSCs exposed to radiation injury were investigated by applying various concentrations of α2M to the cell medium following exposure to ionizing radiation.

Materials and methods

Materials and reagents

α2M was obtained from Enzo Life Sciences (Farmingdale, NY, USA). hBMMSCs were obtained from Cyagen Biosciences (Guangzhou) Inc. (HUXMA-01001; Guangzhou, China). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin-streptomycin mixture and 0.25% trypsin-EDTA were purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Osteogenic induction medium was purchased from Cyagen Biosciences (Guangzhou) Inc. (GUXMX-90021). Antibodies against Beclin1 (1:1,000; cat. no. 11306-1-AP), microtubule-associated protein 1A/1B (LC-3; 1:1,000; cat. no. 14600-1-AP), sex determining region Y (Sox2; 1:5,000; cat. no. 11064-1-AP), Nanog (1:2,000; cat. no. 14295-1-AP), manganese superoxide dismutase (MnSOD; 1:3,000; cat. no. 24127-1-AP) and GAPDH (1:10,000; cat. no. 60004-1-Ig) were purchased from ProteinTech Group (Chicago, IL, USA). The runt-related transcription factor 2 (RUNX2; 1:1,000; cat. no. 12556) antibody was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA), the osteoglycin (OGN; 1:1,000; cat. no. sc-365228) antibody was obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), and the goat anti-rabbit (1:10,000; cat. no. ab6721) and goat anti-mouse (1:10,000; cat. no. ab6789) horseradish peroxidase (HRP) conjugated secondary antibodies were obtained from Abcam (Cambridge, MA, USA).

Culture of hBMMSCs

hBMMSCs were cultured in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2 with saturated humidity. The culture medium was replaced every 3 days. When the cells reached 80% confluence, they were digested with trypsin and passaged at a 1:3 ratio. The fourth generation of cells was used for subsequent analysis.

α2M solution preparation and cell irradiation

A total of 1 mg α2M was dissolved in 0.5 ml sterilized ddH2O to prepare a solution of 2.0 mg/ml α2M, which was stored at −20°C. X-ray irradiation was performed when hBMMSCs attained 70% confluence. hBMMSCs were irradiated at the Sun Yat-Sen University Medical Experimental Center (Guangzhou, China). An RS2000 X-ray irradiator (Radsource, LLC, Brentwood, TN, USA) was used at a voltage of 160 kV, a current of 25 mA, and a dose rate of 1.24 Gy/min. Cells were irradiated at room temperature for 1.61, 3.23, 6.45 and 9.68 min to obtain a dose of 2, 4, 8 and 12 Gy, respectively.

Experimental groups

hBMMSCs were randomly divided into the following groups: Blank control, radiation control, 0.25 and 0.50 mg/ml α2M, respectively. The blank control group was not administered any treatment, whereas the remaining three groups received X-ray irradiation. The α2M treatment groups were supplemented with α2M to the final concentrations of 0.25 and 0.50 mg/ml, respectively, in the complete medium (DMEM supplemented with 10% FBS and 1% penicillin-streptomycin) and osteogenic induction medium (DMEM supplemented with 10% FBS, 1% penicillin-streptomycin, 50 mg/l ascorbic acid, 10 mmol/l β-glycerophosphate and 1 µmol/l dexamethasone). Following irradiation, cells in complete medium were treated with α2M for 24 h, whereas cells in the osteogenic induction medium were treated with α2M for 3 days at 37°C.

Cell Counting Kit-8 (CCK-8) assay

hBMMSCs were seeded into 96-well plates at a density of 5×103 cells/well, with five wells per group. Following adhesion to the well, the cells were exposed to various doses of X-ray radiation, to explore the relationship between dose and cell proliferation. After incubation for 1, 3, 5 and 7 days, 10 µl CCK-8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) solution was added to each well. Following incubation for 2 h, the absorbance was measured at a wavelength of 450 nm using a 96-well-plate reader (Thermo Fisher Scientific, Inc.).

Colony formation assay

hBMMSCs were seeded at 100 cells/well and cultured in 6-cm petri dishes. After 2 weeks culture in complete medium at 37°C and 5% CO2 with saturated humidity, the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 20 min at room temperature, washed twice with ddH2O, and stained with 0.1% crystal violet (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 15 min at room temperature. Images of the colonies were obtained using an Epson scanner (Seiko Epson Corp., Suwa, Japan). Then, images were collected for analysis.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

hBMMSCs were seeded into 6-well plates at a density of 4×105 cells/well, and total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara Bio, Inc., Otsu, Japan), according to the manufacturer's instructions and amplified using a SYBR® Premix Ex Taq™ II kit (Takara Bio, Inc.). The PCR cycling conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 20 sec. The housekeeping gene GAPDH was used for normalization, and the relative expression was calculated by the 2−ΔΔCq relative quantitation method (13). The primers used are listed in Table I. All primer sequences were determined via established GenBank sequences (https://www.ncbi.nlm.nih.gov/genbank/).

Table I.

Primer sequences.

Table I.

Primer sequences.

GenePrimer sequences (5′-3′)NCBI reference sequences
Beclin1
  F ATGCAGGTGAGCTTCGTGTGNC_000017.11
  R CTGGGCTGTGGTAAGTAATGGA
LC-3
  F AGTTGGCACAAACGCAGGGTANC_000020.11
  R TTAGGAGTCAGGGACCTTCAGCA
Sox2
  F GTGAGCGCCCTGCAGTACAANC_000003.12
  R GCGAGTAGGACATGCTGTAGGTG
Nanog
  F CATTCTCCTGCCTCAGCCTCNC_000012.12
  R CCCGTCTCTACTAAAAATACAAAA
RUNX2
  F CTTTGTAGCACAAACATTGCTGGANC_000006.12
  R CAAAGCTGTGGTACCTGTTCTGGA
OGN
  F GGTGCCAGTGCACACTACCTTCNC_000009.12
  R CTCTGGCACCACTGAGTCATCATAA
GAPDH
  F AGGCTAGCTGGCCCGATTTCNC_000012.12
  R TGGCAACAATATCCACTTTACCAGA

[i] F, forward; R, reverse; LC-3, microtubule-associated protein 1A/1B; NCBI, The National Center for Biotechnology Information; OGN, osteoglycin; RUNX2, runt-related transcription factor 2; Sox2, sex determining region Y.

Western blot analysis

hBMMSCs were seeded into 6-well plates at a density of 4×105 cells/well, and total protein was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology, Haimen, China). Protein concentration was determined via a Bicinchoninic Acid (BCA) kit (Thermo Fisher Scientific, Inc.). A total of 30 µg protein was separated by 10% SDS-PAGE (Beyotime Institute of Biotechnology) at 120 V for ~1.5 h. Following the completion of electrophoresis, proteins were transferred to a polyvinylidiene difluoride membrane at a current of 280 mA for ~90 min. The membrane was blocked in 5% skim milk for 1 h at room temperature and then incubated at 4°C overnight with primary antibodies. The membrane was washed three times in tris-buffered saline with 0.1% Tween-20 (TBST) three times, followed by incubation with secondary antibodies at room temperature for 1 h. The membrane was washed three times with TBST, then treated with an Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore, Billerica, MA, USA), according to the manufacturer's protocols. The grayscale values of the bands were analyzed by using ImageJ software v. 1.47 (National Institutes of Health, Bethesda, MA, USA) and the expression levels of the target protein were calculated by normalizing the gray value of the target protein to that of GAPDH.

Osteogenic differentiation

When hBMMSCs attained 70% confluence, the complete medium was replaced with osteogenic induction differentiation medium, and cells were cultured at 37°C and 5% CO2 with saturated humidity. The induction medium was replaced every 3 days. The gene expression of RUNX2 and OGN was detected following 1 and 2 weeks of culture in osteogenesis induction medium, respectively.

Alkaline phosphatase (ALP) activity assay

hBMMSCs were seeded into 12-well plates at a density of 4×104 cells/well, and 200 µl of 1% Triton X-100 (Beyotime Institute of Biotechnology) was added to each well for lysis overnight at 4°C. Following the completion of lysis, 30 µl lysate was obtained for analysis. An ALP assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) was used according to the manufacturer's protocols to determine the absorbance at a wavelength of 520 nm, using a 96-well-plate reader (Thermo Fisher Scientific, Inc.). An additional 10 µl lysate was used to determine the protein concentration of each group of samples by using the BCA method. The activity was normalized to cellular protein and expressed as U/g.

Alizarin red staining and quantitative analysis

hBMMSCs were seeded into 12-well plates at a density of 4×104 cells/well and cultured in osteogenic induction medium for 3 weeks before 1 ml of 4% formaldehyde was added to each well at room temperature. After 30 min, the formaldehyde solution was removed, and cells were washed twice with PBS. Cells were then treated with 0.5 ml Alizarin red solution [Cyagen Biosciences (Guangzhou) Inc.] for 5 min at room temperature; following staining with Alizarin red dye, the cells were washed with PBS three times. Cells were analyzed under an optical microscope (Nikon Corporation, Tokyo, Japan; magnification, ×100) to observe staining. After washing with PBS, 10% cetylpyridinium chloride (Sigma-Aldrich; Merck KGaA) was added, and cells were lysed for 1 h at room temperature. The lysate was transferred to a 96-well plate, and the absorbance was measured at 570 nm using a 96-well-plate reader (Thermo Fisher Scientific, Inc.).

Flow cytometric analysis of apoptosis

hBMMSCs were cultured in 6-well plates at a density of 4×105 cells/well. Apoptosis was determined by flow cytometry using an Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining kit (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Cells were collected and stained in working solution (500 µl binding buffer with 5 µl Annexin V-FITC and 5 µl PI) for 15 min at room temperature in the dark. Apoptotic cells were analyzed using a BD FACS Canto II flow cytometer running BD FACSDiva software version 4.1 (Franklin Lakes, NJ, USA). Annexin V-FITC single positive and Annexin V-FITC/PI double positive cells were considered apoptotic cells. The ratio of apoptotic cells to total cells was used to calculate the cell apoptosis rate.

SOD activity assay

hBMMSCs were incubated in 12-well plates at 4×104 cells/well, and 200 µl RIPA lysis buffer was added to each well. Following lysis, 40 µl lysate was obtained for analysis via a Superoxide Dismutase Assay kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's protocols. The absorbance values were measured at a wavelength of 450 nm using a 96-well-plate reader (Thermo Fisher Scientific, Inc.). The BCA method was applied using 10 µl lysate to determine the protein concentration for each group of samples, in which the protein per milligram of SOD activity was determined.

Detection of reactive oxygen species (ROS) levels

hBMMSCs were cultured in 6-well plates at 4×105 cells/well in complete medium. 2′,7′-Dichlorodihydrofluorescein diacetate (Nanjing Jiancheng Bioengineering Institute) was diluted 1:1,000 with serum-free cell culture medium and incubated in the cell incubator for 20 min at 37°C. The cells were washed three times in serum-free cell culture medium, and analyzed under a Leica TCS-SP8 confocal microscope (Leica Microsystems GmbH, Wetzlar, Germany; magnification, ×100). An excitation wavelength of 502 nm was applied and images of the cells were collected.

Statistical analysis

All experiments were performed at least three times. The results were analyzed using SPSS software, version 20.0 (IBM Corp., Armonk, NY, USA) and are expressed as the mean ± standard deviation. The data were analyzed by one-way analysis of variance, followed by a Bonferroni post-hoc test for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

Results

X-ray inhibits hBMMSC proliferation, α2M increases hBMMSC colony formation rate and reduces autophagy following radiation

hBMMSC proliferation decreased with increasing doses of radiation; the hBMMSCs treated with 8 and 12 Gy radiation exhibited significantly lower proliferation rates than the 0 Gy-treated group. Cell proliferation was too low in the 12 Gy group after 5 and 7 days of treatment; thus, 8 Gy was selected for follow-up experiments (Fig. 1A). The colony formation experiment demonstrated that hBMMSCs irradiated with 8 Gy X-rays and cultured with 0.50 mg/ml α2M exhibited a significantly increased colony formation rate compared with in the irradiated group; however, the colony formation rate of the irradiated group was significantly decreased compared with in the control (Fig. 1B and C). RT-qPCR revealed that α2M significantly downregulated the mRNA expression levels of Beclin1 and LC-3 in hBMMSCs in a dose-dependent manner compared with the irradiation group. Treatment with 0.50 mg/ml α2M appeared to markedly downregulate the mRNA expression levels of Beclin and LC-3 compared with the 0.25 mg/ml α2M-treated group; however, no notable differences were observed in the protein expression levels of LC-3 between the two α2M treatment groups (Fig. 1D-G).

Figure 1.

Effects of X-ray irradiation on hBMMSC proliferation and α2M on the CFU-F and expression of autophagy-associated genes in irradiated hBMMSCs. (A) Cell Counting Kit-8 was used to detect the effects of various doses of X-ray radiation on the proliferation of hBMMSCs on days 1, 3, 5 and 7 following irradiation. *P<0.05 vs. 0 Gy group (n=3). (B and C) A colony formation assay was performed to detect the effect of α2M on the CFU-F of hBMMSCs following radiation at 24 h (magnification, ×100). *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). Reverse transcription-quantitative polymerase chain reaction was used to detect the effects of α2M on (D) Beclin1 and (E) LC-3 mRNA expression levels. (F and G) Western blotting was used to detect the effects of α2M on protein expression levels of Beclin1 and LC-3 in hBMMSCs at 24 h following irradiation. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). α2M, α-2-macroglobulin; CFU-F, colony formation rate; hBMMSC, human bone marrow mesenchymal stem cells; LC-3, microtubule-associated protein 1A/1B; OD, optical density.

α2M increases the pluripotency of hBMMSCs following irradiation

RT-qPCR revealed that the mRNA expression levels of Sox2 and Nanog were significantly upregulated at doses of 0.50 mg/ml α2M, compared with in the radiation group; however, at doses of 0.25 mg/ml α2M, Nanog mRNA expression was only markedly upregulated whereas Sox2 was significantly upregulated. Protein expression levels of Nanog and Sox2 were also significantly upregulated at doses of 0.50 mg/ml α2M, compared with in the radiation group however, at doses of 0.25 mg/ml α2M, Sox2 protein levels were markedly upregulated (Fig. 2A-D).

Figure 2.

Effects of α2M on the expression of pluripotency-associated genes in irradiated hBMMSCs. Reverse transcription-quantitative polymerase chain reaction was employed to detect the effects of α2M on the mRNA expression levels of (A) Sox2 and (B) Nanog in hBMMSCs at 24 h following radiation. (C and D) Western blotting was employed to detect the effects of α2M on the protein expression levels of Sox2 and Nanog in hBMMSCs at 24 h following radiation. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). hBMMSC, human bone marrow mesenchymal stem cells; α2M, α-2-macroglobulin; Sox2, sex determining region Y.

α2M increases the osteogenic differentiation ability of hBMMSCs following irradiation

The mRNA and protein expression levels of RUNX2 and OGN were significantly increased with the addition of α2M following X-ray irradiation compared with in the radiation group; however, treatment with 0.25 mg/ml only markedly increased the protein expression level of RUNX2 (Fig. 3A-D). In addition, ALP activity significantly increased in response to α2M treatment compared with in the radiation group (Fig. 3E). Microscopic analysis revealed the formation of calcium nodules and the degree of staining increased (Fig. 3F and G).

Figure 3.

Effects of α2M on osteogenic differentiation potential of irradiated hBMMSCs. Reverse transcription-quantitative polymerase chain reaction was used to detect the effect of α2M on the mRNA expression of (A) RUNX2 after 1 week and (B) OGN after 2 weeks of osteogenesis induction in irradiated hBMMSCs. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (C and D) Western blotting was used to detect the effects of α2M on the protein expression levels of RUNX2 after 1 week and OGN after 2 weeks of osteogenesis induction in irradiated hBMMSCs. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (E) Effects of α2M on ALP activity after 1 week of osteogenesis induction in irradiated hBMMSCs. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (F and G) Alizarin red staining was used to detect the effects of α2M on the formation of calcium nodules after 3 weeks of osteogenesis induction in irradiated hBMMSCs (magnification, ×100). *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). α2M, α-2-macroglobulin; ALP, alkaline phosphatase; hBMMSC, human bone marrow mesenchymal stem cells; OD, optical density; OGN, osteoglycin; RUNX2, runt-related transcription factor 2.

α2M reduces the rate of apoptosis and improves the antioxidative abilities of hBMMSCs following irradiation

hBMMSCs were irradiated with X-rays and then treated with α2M. The rate of apoptosis was significantly decreased in response to treatment with 0.50 mg/ml α2M compared with in the irradiated group (Fig. 4A and B). Additionally, treatment with 0.50 mg/ml α2M significantly increased SOD activity and the protein expression levels of MnSOD compared with in the radiation group (Fig. 4C-E). The levels of ROS were notably decreased following treatment with α2M compared with in the radiation group (Fig. 4F).

Figure 4.

Effects of α2M on the rate of apoptosis and the antioxidative capacity of irradiated hBMMSCs. (A and B) Effects of α2M on the rate of apoptosis in hBMMSCs at 24 h following radiation. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (C) Effects of α2M on SOD activity in hBMMSCs at 24 h following radiation. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (D and E) Western blotting was used to detect the effects of α2M on the protein expression levels of MnSOD in hBMMSCs at 24 h following radiation. *P<0.05 vs. blank control group, #P<0.05 vs. radiation control group (n=3). (F) Effects of α2M on the levels of ROS in hBMMSCs at 24 h following radiation. α2M, α-2-macroglobulin; hBMMSC, human bone marrow mesenchymal stem cells; MnSOD, manganese superoxide dismutase; ROS, reactive oxygen species.

Discussion

ORNJ, a serious complication of head and neck radiotherapy, often results in poor prognosis. Investigations into protective strategies against radiation are required to minimize radiotherapy-induced damage to normal tissue. The development of efficient, low-toxicity radiation protectants to reduce and prevent the occurrence of symptoms associated with radiation sickness, such as ORNJ, is an important area of radiation protection research. Certain drugs can serve anti-radiation roles; however, due to toxic side effects, their application is not recommended for the treatment of malignancies.

The pathogenesis of ORNJ is not completely understood; however, in the majority of cases, the balance of bone reshaping is disrupted, and is accompanied by the accumulation of extracellular matrix and microvascular thrombosis, ultimately leading to necrosis of bone tissue (14). BMMSCs are a cell type with pluripotent differentiation potential and are one of the cell types most affected by bone tissue radiation injury. Studies have reported that the renewal and formation of bone tissue is a continuous process, which mainly involves the differentiation of BMMSCs into osteogenic progenitor cells that gradually mature into differentiated osteoblasts. In the process of bone remodeling, dysregulation of the balance between bone formation and bone resorption balance may lead to bone defects (15).

In a previous study, the authors reported that the serum from patients with ORNJ contains 12 proteins, which exhibits differential expression, including α2M and three additional proteins with abnormally low expression levels. By expanding the clinical sample size, it was demonstrated that α2M expression was low in the serum of patients with ORNJ, and patients with nasopharyngeal carcinoma exhibited a positive correlation between serum α2M levels and radiotherapy dose. These findings suggested that serum α2M and radiation damage from jaw ionization may be closely associated; however, the underlying mechanism requires further investigation.

α2M is a member of an important class of macromolecules in the plasma, which contains a broad spectrum of protease inhibitors. In recent years, accumulating evidence has revealed that α2M has a wide range of biological functions, including antioxidant activity against ROS and anti-ionizing radiation effects. It was reported that α2M can remove oxygen free radicals by increasing the activity of Mn/copper SOD and reduce the extent of DNA damage, which may induce protection against radiation in liver tissue (16). This finding suggested that α2M may possess an important protective effect against tissue damage caused by ionizing radiation.

In the present study, hBMMSCs were subjected to high doses of X-ray irradiation and treated with 0.25 and 0.50 mg/ml of α2M to determine whether α2M exerts protective effects against radiation damage. High doses of X-rays can induce the abnormal proliferation of normal hBMMSCs and cause DNA damage. The present study reported that the proliferative ability of hBMMSCs treated with X-ray irradiation was inhibited in a dose-dependent manner. The proliferative ability of hBMMSCs irradiated at 12 Gy was notably low. Therefore, 8 Gy was selected as the experimental dose in the present study.

The colony formation rate is the rate of cell survival, which indicates the number of cloned cells that have survived and divided following cell inoculation. This reflects two important traits: Cell population dependence and proliferative ability (17). Autophagy is a conserved regulatory mechanism of cells that functions via structural remodeling within the cell, material renewal processes, and adaptive responses of cells to injury stimuli (18,19). Beclin1 and LC-3 are important genes involved in the initiation of autophagy (20); the expression levels of these two genes may partly reflect the extent of autophagy of cells (20). In the present study, it was observed that α2M increased the colony formation rate of hBMMSCs following irradiation and downregulated the gene expression levels of Beclin1 and LC-3, thereby reducing cell autophagy. These results suggest that α2M may protect hBMMSCs by inducing the autophagy protective mechanism and increasing the cell proliferation rate.

Sox2 and Nanog are cytokines which are employed as markers of stem cell pluripotency and serve key roles in maintaining stem cell function (21,22). Dysregulation in the expression of these cytokines are associated with alterations in the pluripotent differentiation characteristics of stem cells. In addition, the present study investigated the effects of α2M on the osteogenic differentiation potential of irradiated hBMMSCs. ALP is one of the enzymes necessary for cell ossification and is an early marker of osteoblasts; ALP expression increases during osteogenic differentiation (23,24). RUNX2 is a well-reported characteristic marker gene associated with the early stages of bone formation and is an important transcription factor for the early stage of osteogenic differentiation (25,26). OGN is a secretory protein in bone tissue, which serves an important role in inhibiting osteoclasts and inducing osteogenesis. OGN has been reported as an osteoinductive factor that can promote bone formation following binding with transforming growth factor-β1 or -β2 (27). Calcium nodules represent the final stage of osteogenic differentiation and are produced by the mineralization of osteoblasts (28).

The results of the present study demonstrated that α2M increased the expression levels of Sox2 and Nanog in hBMMSCs following irradiation. The effects 0.50 mg/ml α2M were further increased compared with 0.25 mg/ml α2M and indicated that α2M may alleviate multipotent differentiation injury induced by X-rays. In addition, α2M at 0.25 or 0.50 mg/ml was added to the osteogenic induction differentiation medium for 3 days following irradiation. Compared with in the untreated control group, the treated groups exhibited increased ALP activities and upregulated gene expression levels of RUNX2 and OGN; a further increase in effects was observed in the group treated with 0.50 mg/ml α2M compared with 0.25 mg/ml α2M. In addition, increased calcium nodule formation was observed in accordance with an increased degree of staining. This indicated that α2M may alleviate radiation damage to hBMMSCs and improve their osteogenic differentiation ability, further verifying the protective effects of α2M on the osteogenic differentiation of hBMMSCs.

Tissue damage caused by ionizing radiation arises not only from the direct damage of macromolecules but also from the formation of superoxide anion molecules, such as ROS. These molecules possess oxidative strong abilities, and are capable of inducing the degeneration of macromolecules such as DNA, via oxidation. This results in damage to cell structure and function, eventually leading to tissue damage and genetic mutations. ROS are classic indicators for the degree of oxidative stress (29,30). In addition, ROS can initiate chain reactions, and react with a variety of unsaturated fatty acids and cholesterol on the cell membrane, resulting in oxidative damage to cells and eventually apoptosis. Cell death via apoptosis serves a role in maintaining normal tissue morphology and cell death, which are under the control of apoptosis-associated genes (31,32).

Using immunofluorescence, Hou et al (33) reported that the irradiation of hBMMSCs with 6 Gy of X-rays results in increased intracellular ROS levels, further confirming that ionizing radiation increases the levels of ROS, resulting in DNA damage, decreasing the ability of hBMMSCs to differentiate into multiple cell types. SOD is an important factor associated with the removal of free radicals in the body by antioxidant enzymes, and is known as the first line of antioxidative defense of the body.

Antioxidative removal of ROS is an important mechanism for improving the activity of SOD (34). In the present study, hBMMSCs were treated with 8 Gy X-ray radiation and then treated with α2M. After 24 h, the activity of SOD and expression levels of MnSOD protein were significantly increased, the level of ROS decreased, and the rate of apoptosis decreased. This suggested that α2M may reduce the oxidative stress response induced by the irradiation of hBMMSCs and thus serve a role in prevention of radiation injury.

In conclusion, the present study proposed the possibility of using α2M to protect against bone tissue radiation injury. Further investigation with systematic experiments is required to determine the specific mechanism of action underlying α2M in the prevention and treatment of ORNJ in the future.

Acknowledgements

The authors thank Professor Huanliang Liu (Guangdong Provincial Key Laboratory of Colorectal and Pelvic Floor Diseases, Guangdong Institute of Gastroenterology and the Sixth Affiliated Hospital, Sun Yat-sen University, Guangzhou, China) for providing technical assistance and Professor Yi Liu (Laboratory of Tissue Regeneration and Immunology and Department of Periodontics, Beijing Key Laboratory of Tooth Regeneration and Function Reconstruction, School of Stomatology, Capital Medical University, Beijing, China) for guidance during revision of the manuscript.

Funding

The present study was supported by the Natural Science Foundation of Guangdong Province (grant no. 2015A030313064), and the Science and Technology Planning Project of Guangdong Province (grant nos. 2014A020212127 and 2017A010105027).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

YL, WC, XK, JL and SF made substantial contributions to the concept and design of the present study. YL, WC, JL and XC cultured human bone marrow mesenchymal stem cells. YL, WC and YG performed the experiments. YL, WC, WZ and SF acquired and analyzed the data. YL, WC, XC and SF wrote the manuscript. All the authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bots WTC, van den Bosch S, Zwijnenburg EM, Dijkema T, van den Broek GB, Weijs WLJ, Verhoef LCG and Kaanders JHAM: Reirradiation of head and neck cancer: Long-term disease control and toxicity. Head Neck. 39:1122–1130. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Nadella KR, Kodali RM, Guttikonda LK and Jonnalagadda A: Osteoradionecrosis of the Jaws: Clinico-therapeutic management: A literature review and update. J Maxillofac Oral Surg. 14:891–901. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Dhanda J, Pasquier D, Newman L and Shaw R: Current concepts in osteoradionecrosis after head and neck radiotherapy. Clin Oncol (R Coll Radiol). 28:459–466. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Moroni L and Fornasari PM: Human mesenchymal stem cells: A bank perspective on the isolation, characterization and potential of alternative sources for the regeneration of musculoskeletal tissues. J Cell Physiol. 228:680–687. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Baker N, Boyette LB and Tuan RS: Characterization of bone marrow-derived mesenchymal stem cells in aging. Bone. 70:37–47. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Wang Y, Zhu G, Wang J and Chen J: Irradiation alters the differentiation potential of bone marrow mesenchymal stem cells. Mol Med Rep. 13:213–223. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Fang S, Chen W, Wang S, Kong X, Sun X, Ge Y and Hu K: Proteomic Analysis of Serum in patients with Osteoradionecrosis of the Jaws. Int Dental J. 62:242012.

8 

Fang S, Kong X, Chen W, Chen Y, He F, Ge Y, Sun X and Wang S: Identification of differential proteins that related to bone metabolism in the serum of ORNJ patients. Int Dental J. 62:252012.

9 

Chen X, Kong X, Cao W, Ge Y, Wang S, Zhang Z, Li H, Liu Y and Fang S: The detection of serum and urine levels of alpha 2-Macroglobulin in nasopharyngeal carcinoma patients receiving late period radiotherapy and its significance. Int J Dentistry Oral Sci. 5:611–617. 2018.

10 

Rehman AA, Ahsan H and Khan FH: α2-macroglobulin: A physiological guardian. J Cell Physiol. 228:1665–1675. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Rehman AA, Zaman M, Zia MK, Ahsan H, Khan RH and Khan FH: Conformational behavior of alpha-2-macroglobulin: Aggregation and inhibition induced by TFE. Int J Biol Macromol. 104:539–546. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Chen X, Kong X, Zhang Z, Chen W, Chen J, Li H, Cao W, Ge Y and Fang S: Alpha-2-macroglobulin as a radioprotective agent: A review. Chin J Cancer Res. 26:611–621. 2014.PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Lyons A and Ghazali N: Osteoradionecrosis of the jaws: Current understanding of its pathophysiology and treatment. Br J Oral Maxillofac Surg. 46:653–660. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Wissing MD: Chemotherapy- and irradiation-induced bone loss in adults with solid tumors. Curr Osteoporos Rep. 13:140–145. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Bogojević D, Poznanović G, Grdović N, Grigorov I, Vidaković M, Dinić S and Mihailović M: Administration of rat acute-phase protein α(2)-macroglobulin before total-body irradiation initiates cytoprotective mechanisms in the liver. Radiat Environ Biophys. 50:167–179. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Aizman I, Holland WS, Yang C and Bates D: αSMA expression in large colonies of Colony-forming units-fibroblast as an early predictor of bone marrow MSC expandability. Cell Med. 8:79–85. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Liang DH, El-Zein R and Dave B: Autophagy Inhibition to Increase Radiosensiti-zation in breast cancer. J Nucl Med Radiat Ther. 6:2542015. View Article : Google Scholar : PubMed/NCBI

19 

Koukourakis MI, Mitrakas AG and Giatromanolaki A: Therapeutic interactions of autophagy with radiation and temozolomide in glioblastoma: Evidence and issues to resolve. Br J Cancer. 114:485–496. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Kim M, Fekadu J, Maronde E and Rami A: Alleviation of autophagy by knockdown of Beclin-1 enhances susceptibility of hippocampal neurons to proapoptotic signals indeced by amino acid starvation. Histochem Cell Biol. 139:99–108. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Go MJ, Takenaka C and Ohgushi H: Forced expression of Sox2 or Nanog in human bone marrow derived mesenchymal stem cells maintains their expansion and differentiation capabilities. Exp Cell Res. 314:1147–1154. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Heffernan C, Sumer H and Verma PJ: Generation of clinically relevant ‘induced pluripotent stem’ (iPS) cells. J Stem Cells. 6:109–127. 2011.PubMed/NCBI

23 

Millán JL: The role of phosphatases in the initiation of skeletal mineralization. Calcif Tissue Int. 93:299–306. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Halling Linder C, Enander K and Magnusson P: Glycation contributes to interaction between human bone alkaline phosphatase and collagen type I. Calcif Tissue Int. 98:284–293. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Henriquez B, Hepp M, Merino P, Sepulveda H, van Wijnen AJ, Lian JB, Stein GS, Stein JL and Montecino M: C/EBPβ binds the P1 promoter of the Runx2 gene and up-regulates Runx2 transcription in osteoblastic cells. J Cell Physiol. 226:3043–3052. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Qin X, Jiang Q, Matsuo Y, Kawane T, Komori H, Moriishi T, Taniuchi I, Ito K, Kawai Y, Rokutanda S, et al: Cbfb regulates bone development by stabilizing runx family proteins. J Bone Miner Res. 30:706–714. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Tanaka K, Matsumoto E, Higashimaki Y, Katagiri T, Sugimoto T, Seino S and Kaji H: Role of osteoglycin in the linkage between muscle and bone. J Biol Chem. 287:11616–11628. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Gregory CA, Gunn WG, Peister A and Prockop DJ: An Alizarin red-based assay of mineralization by adherent cells in culture: Comparison with cetylpyridinium chloride extraction. Anal Biochem. 329:77–84. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Sakuma S, Abe M, Kohda T and Fujimoto Y: Hydrogen peroxide generated by xanthine/xanthine oxidase system represses the proliferation of colorectal cancer cell line Caco-2. J Clin Biochem Nutr. 56:15–19. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Ivanov VE, Usacheva AM, Chernikov AV, Bruskov VI and Gudkov SV: Formation of long-lived reactive species of blood serum proteins induced by low-intensity irradiation of helium-neon laser and their involvement in the generation of reactive oxygen species. J Photochem Photobiol B. 176:36–43. 2017. View Article : Google Scholar : PubMed/NCBI

31 

Wu J, Liu S, Meng H, Qu T, Fu S, Wang Z, Yang J, Jin D and Yu B: Neuropeptide Y enhances proliferation and prevents apoptosis in rat bone marrow stromal cells in association with activation of the Wnt/β-catenin pathway in vitro. Stem Cell Res. 21:74–84. 2017. View Article : Google Scholar : PubMed/NCBI

32 

Deng B, Jiang H, Zeng K, Liang Y, Wu Y and Yang Y: Removal from adherent culture contributes to apoptosis in human bone marrow mesenchymal stem cells. Mol Med Rep. 15:3499–3506. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Hou J, Han ZP, Jing YY, Yang X, Zhang SS, Sun K, Hao C, Meng Y, Yu FH, Liu XQ, et al: Autophagy prevents irradiation injury and maintains stemness through decreasing ROS generation in mesenchymal stem cells. Cell Death Dis. 4:e8442013. View Article : Google Scholar : PubMed/NCBI

34 

M Fetherolf M, Boyd SD, Winkler DD and Winge DR: Oxygen-dependent activation of Cu, Zn-superoxide dismutase-1. Metallomics. 9:1047–1059. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu Y, Cao W, Kong X, Li J, Chen X, Ge Y, Zhong W and Fang S: Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury. Mol Med Rep 18: 4219-4228, 2018.
APA
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y. ... Fang, S. (2018). Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury. Molecular Medicine Reports, 18, 4219-4228. https://doi.org/10.3892/mmr.2018.9449
MLA
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y., Zhong, W., Fang, S."Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury". Molecular Medicine Reports 18.5 (2018): 4219-4228.
Chicago
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y., Zhong, W., Fang, S."Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury". Molecular Medicine Reports 18, no. 5 (2018): 4219-4228. https://doi.org/10.3892/mmr.2018.9449
Copy and paste a formatted citation
x
Spandidos Publications style
Liu Y, Cao W, Kong X, Li J, Chen X, Ge Y, Zhong W and Fang S: Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury. Mol Med Rep 18: 4219-4228, 2018.
APA
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y. ... Fang, S. (2018). Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury. Molecular Medicine Reports, 18, 4219-4228. https://doi.org/10.3892/mmr.2018.9449
MLA
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y., Zhong, W., Fang, S."Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury". Molecular Medicine Reports 18.5 (2018): 4219-4228.
Chicago
Liu, Y., Cao, W., Kong, X., Li, J., Chen, X., Ge, Y., Zhong, W., Fang, S."Protective effects of α‑2‑macroglobulin on human bone marrow mesenchymal stem cells in radiation injury". Molecular Medicine Reports 18, no. 5 (2018): 4219-4228. https://doi.org/10.3892/mmr.2018.9449
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team