Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 18 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway

  • Authors:
    • Fujun Luan
    • Kunlong Ma
    • Jia Mao
    • Fan Yang
    • Minghua Zhang
    • Hexu Luan
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedics, Yongchuan Hospital of Chongqing Medical University, Chongqing 402160, P.R. China, Department of Dermatology, Yongchuan Hospital of Chongqing Medical University, Chongqing 402160, P.R. China
  • Pages: 5717-5725
    |
    Published online on: October 22, 2018
       https://doi.org/10.3892/mmr.2018.9571
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Human amniotic epithelial cells (hAECs) have recently been recognized as a potential source of stem cells. The present study was designed to investigate the effects of mechanical stretch on the osteogenic differentiation of hAECs. As it has been previously reported that the physical environment is an important factor in maintaining the phenotype and functionality of differentiated cells, mechanical stretch was use to mimic the mechanical environment in the present study, with the following parameters: 5% elongation of the hAECs at a frequency of 0.5 Hz, with evaluation at 2, 6, 12 and 24 h time points. The osteogenic differentiation process of the hAECs followed by mechanical stimulation was evaluated by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR), western blotting and immunocytochemistry. Additionally, in a parallel study, a runt‑related transcription factor 2 (Runx2)/core binding factor α 1 (Cbfa1)‑specific short hairpin RNA (shRNA) plasmid vector and a scrambled shRNA control plasmid was constructed for transfection into the hAECs prior to mechanical stimulation. The cultured hAECs exhibited a cobblestone‑shaped epithelial‑like phenotype and were positive for stage‑specific embryonic antigen‑4, cytokeratin‑19, cluster of differentiation 44 and octamer‑binding protein 4, as detected by flow cytometry, western blotting or confocal microscopy. The qPCR and western blotting data demonstrated that the mRNA and protein expression levels of Runx2/Cbfa1, alkaline phosphatase and osteocalcin were upregulated compared with the control group following stretching and they peaked at 12 h. These results indicated that the osteogenic differentiation of the hAECs was induced by mechanical stimuli. Additionally, the mRNA and protein expression levels of β‑catenin and cyclin D were increased significantly following stretching; however, they were decreased following Runx2/Cbfa1‑shRNA transfection as observed by RT‑qPCR and western blotting. These results suggested that the Wnt/β‑catenin pathway may have an important role in mechanical stretch‑induced osteogenic differentiation of the hAECs. Furthermore, the combination of stretch and osteogenic induction medium had synergistic effects on the osteogenic differentiation. The results of the present study demonstrated that mechanical stimuli have an important role in osteogenic differentiation of hAECs via the Wnt/β‑catenin signalling pathway, which may be a potential therapeutic strategy in bone regenerative medicine.

Introduction

Mechanical stimulation is an important environmental factor that influences bone metabolism (1). The molecular signals driving the regenerative process in distraction osteogenesis involves a complex system of cellular behaviours triggered by mechanical strain (1). Previously, attention has been focused on the role of mechanical forces in the differentiation of stem cells, including the differentiation of mesenchymal stem cells (MSCs) into osteoblasts (2,3). However, whether mechanical stimuli can modulate the osteogenic differentiation of human amniotic epithelial cells (hAECs) remains unknown.

hAECs can be derived from the full-term placenta and express embryonic stem cell (ESC) markers, including stage-specific embryonic antigen-4 (SSEA-4) and octamer-binding protein 4 (Oct-4) (4,5). According to Miki et al (5), the amnion is derived from the totipotent epiblast and is considered an alternative source of stem cells due to the expression of SSEA-4. Furthermore, as Toda et al (6) reported that various advantages make the amnion a potentially useful and noncontroversial source of cells for transplantation and regenerative medicine. The considerable advantages described in detail were as follows: hAECs can differentiate into all three germ layers; they demonstrate low immunogenicity and anti-inflammatory functions; and they prompt no ethical concerns due to not requiring the sacrifice of human embryos for their isolation, therefore avoiding the current controversies associated with the use of human ESCs (5,6).

hAECs have the potential to differentiate into all three germ layers: Endoderm (liver, pancreas), mesoderm (cardiomyocyte) and ectoderm (neural cells) in vitro (7,8). According to Kakishita et al (9), AECs can differentiate into mature neural cells that synthesize and release acetylcholine, norepinephrine and dopamine. Wlodarski et al (10) demonstrated that WISH cells (an amniotic epithelial cell line) grafted intramuscularly into rats or into Syrian hamsters survived 14 days and induced both cartilage and bone formation. It has also been reported that hAECs can differentiate into osteoblasts following stimulation with a pulsed electromagnetic field (11). Therefore, stimulation of hAECs in this manner has been proposed as a potential source of stem cells for cell therapy.

Previously, stem cell-based therapies have been utilized for their ability to regenerate osteoblasts and have been demonstrated to be efficacious in experimental contexts and human disease. In addition, dexamethasone, β-glycerol phosphate and ascorbic acid have been identified as osteogenic differentiation inducers in hAECs (12). Furthermore, reports of hAECs differentiating into osteoblasts upon induction by mechanical stretching are rare. In the present study, the hypothesis that mechanical stretching serves important roles in the process of osteogenic differentiation of hAECs was confirmed.

Materials and methods

Isolation and culture of hAECs

Placentas were donations from six patients (from February 15th 2015 to August 4th 2017; mean age, 32±4.5) of Yongchuan Hospital of Chongqing Medical University (Chongqing, China). All patients gave written informed consent. The present study was performed according to the Declaration of Helsinki and approved by the Medical Ethics Committee of the Yongchuan Hospital of Chongqing Medical University.

As described by Miki et al (13), the amnion layer was mechanically peeled from human placenta and digested with 0.05% trypsin + 0.02% EDTA for 30 min at 37°C (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Following filtration with 200-mesh filter and centrifugation at 200 × g for 5 min at 4°C, the cells were cultured in low glucose Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) at a density of 1×105 cells/cm2 and placed in a 37°C and 5% CO2 humidified incubation chamber. The medium was supplemented with 5% foetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 2 mmol/l-glutamine, 1% non-essential amino acids and 55 µmol/l β-mercaptoethanol. New culture medium was supplied after 24 h of subculture. Experiments were performed once the cells were fused into a single layer and reached 80–90% confluence.

Identification of hAECs

The hAECs were identified immunocytochemically by the specific epithelial cell marker cytokeratin-19 (CK19) and the ESC marker Oct-4, the cell surface marker cluster of differentiation 44 (CD44), and the stem cell surface marker SSEA-4 (all Abcam, Cambridge, UK).

hAECs (3rd passage) were seeded onto cover slips in 6-well plates. At 80–90% confluence, they were incubated with primary antibodies (1:300) at 4°C and secondary antibodies (Goat anti-Mouse/rabbit IgG (H+L) secondary antibody; Alex Fluor 488/594; 1:200; Jackson) at 25°C following a standard immunocytochemistry protocol including fixing with 4% polyoxymethylene at 4°C for 30 min, permeabilizing with 1% Triton-X100 for 10 min at 25°C and blocking with 5% bovine serum albumin (BSA; Sigma-Aldrich, Darmstadt, Germany, USA) for 30 min at 25°C. Eventually, 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; Invitrogen; Thermo Fisher Scientific, Inc.) was used to mark the nucleus for 10 min at 25°C. The stained cells were imaged on a confocal inverted microscope (Olympus FluoView FV 1,000; Olympus Corporation, Tokyo, Japan).

Mechanical stretch stimulation

In the mechanical stretch group, the 3rd to 5th passage hAECs were seeded reached 60–70% confluency on silicone membranes coated with collagen type I, transferred onto a uniaxial stretch chamber (size, 4.0×7.0 cm), the maximum uniaxial stretched length is 7.35 cm, using a machine similar to that in Hata et al (14) and stretched for 2, 6, 12 and 24 h with 5% elongation at a frequency of 0.5 Hz (15,16). The positive control group was treated with osteogenic induction medium (OM; DMEM supplemented with 100 nmol/l dexamethasone, 50 mg/l ascorbic acid and 5 mmol/l β-glycerophosphate) for 21 days. The stretch-biochemical combined stimulation group was treated with stretching with 5% elongation at 0.5 Hz for 2, 6, 12 and 24 h following 21 days of OM stimulation. The cells were collected using TRIzol™ (Thermo Fisher Scientific, Inc.) or radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) at each time point. Each experiment was conducted in five replicates.

RNA interference

4 µg of runt-related transcription factor 2 (Runx2)/core binding factor α 1 (Cbfa1)-specific short hairpin RNA (shRNA) plasmid and 4 µg of scrambled shRNA control plasmid was constructed, followed by cationic lipid (Lipofectamine™ 2000 Invitrogen; Thermo Fisher Scientific, Inc.) transfection for 48 h at 37°C. OM induction and stretch was performed following transfection for 24 h. The sequences of Runx2/Cbfa1-shRNA and scrambled shRNA, designed based on NCBI GeneBank data, are demonstrated in Table I.

Table I.

Sequences of Runx2-shRNA and scrambled control.

Table I.

Sequences of Runx2-shRNA and scrambled control.

NameSequence
Runx2-shRNAF: 5′-GATCCCCAGACTTACTGTATGTATAGTTCAAGAGACTATACATACAGTAAGTCTTTTTTGGAAA-3′
R: 5′-AGCTTTTCCAAAAAAGACTTACTGTATGTATAGTCTCTTGAACTATACATACAGTAAGTCTGGG-3′
Control shRNAF: 5′-GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTGGAAA-3′
R: 5′-AGCTTTTCCAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAGGG-3′

[i] Runx2, Runt-related transcription factor 2; shRNA, short hairpin RNA.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The hAECs in each group were collected with TRIzol and the corresponding RNA samples were obtained following extraction and purification. For extraction, 1 ml TRIzol was used to collect total RNA and 0.2 ml chloroform was added to each sample to extract RNA. Following incubation at 4°C for 5 min, samples were centrifuged at 12,000 × g for 15 min at 4°C. Then, the upper aqueous fraction was collected by the addition of 0.5 ml ethanol. Followed centrifugation at 12,000 × g for 15 min at 4°C, 75% ethanol was used to purify the extracted RNA. Following air-drying, RNA was eluted in 20 µl RNase-free water. RNA concentrations were quantified by spectrophotometry (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and cDNA was synthesized using a RT kit (FSQ-101; Toyobo Life Science, Osaka, Japan) at 37°C for 5 min and then 95°C for 5 min. To detect the accumulation of PCR products, EvaGreen (Bio-Rad Laboratories, Inc.) with the CFX-96™ (Bio-Rad Laboratories, Inc.) Real-Time PCR Detection System was used followed by 40 cycles of: 95°C for 5 min, 95°C for 10 sec, 59°C for 1 min. The sequences of qPCR primers and program are presented in Table II. The β-actin gene was used as an internal reference (17).

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GeneGenBank IDPrimer sequence (5′-3′)
ALPNM_000478F: 5′GGAACTCCTGACCCTTGACC 3′
R: 5′TCCTGTTCAGCTCGTACTGC 3′
OCNM_001199662F: 5′AGGGCAGCGAGGTAGTGAA 3′
R: 5′TCCTGAAAGCCGATGTGGT 3′
Runx2/Cbfa1NM_001015051F: 5′TTACTTACACCCCGCCAGTC 3′
R: 5′TATGGAGTGCTGCTGGTCTG 3′
β-cateninNM_020248F: 5′CCTATGCAGGGGTGGTCAAC 3′
R: 5′CGACCTGGAAAACGCCATCA 3′
Cyclin D1NM_053056.2F: 5′TTTGTTGTGTGTGCAGGGAG 3′
R: 5′TTTCTTCTTGACTGGCACGC 3’
β-actinNM_001099771F: 5′ACTATCGGCAATGAGCGGTTC 3′
R: 5′ATGCCACAGGATTCCATACCC 3′

[i] OC, osteocalcin; ALP, alkaline phosphatase; Runx2, runt-related transcription factor 2; Cbfa1, core binding factor α 1.

Western blot analysis

The proteins from each group of hAECs were separately collected in RIPA lysis buffer (Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Following centrifugation at 4°C and 16,000 × g for 10 min, the supernatant proteins were collected. The concentration was determined by the bicinchoninic acid method, followed by loading 20 µg total proteins onto the SDS-PAGE gels (4% separation gel, 5% spacer gel) and transferred to 0.45 µm Immobilon polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked with 5% BSA in Tris Buffered Saline with Tween® 20 (TBST) at 25°C for 1 h, incubated with the indicated primary antibodies [anti-β-catenin (1:1,000; cat. no. ab16051), anti-Runx2 (1:1,000; ab23981), anti-Cyclin D1 (1:1,000; cat. no. ab226977), anti-alkaline phosphatase (1:1,000; cat. no. ab229126) and anti-osteocalcin (1:1,000; cat. no. ab93876; Abcam)] at 4°C overnight and then incubated with the corresponding secondary antibodies (Goat anti-mouse/rat secondary antibodies; 1:3,000; cat. no. ZB2305/ZB2306; Zsbio; OriGene Technologies, Inc., Beijing, China) at 25°C for 1 h. Images were obtained with an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.) on film and the images were captured, and analysed with a gel imaging system (2.0 version of quantity one 1-D, Bio-Rad Laboratories, Inc.).

Statistical analysis

The data are presented as the mean ± standard deviation. Single-tailed Student's t-test of unpaired data or one-way analysis of variance, followed by the least significance difference performed in SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA) was used for comparisons between groups, n=3. P<0.05 was considered to indicate a statistically significant difference.

Results

Morphology and characteristics of isolated hAECs

hAECs were successfully isolated from full-term amnion without disease. Following 3 days in culture, the hAECs demonstrated the typical morphology of cobblestone-shape epithelial-like cells (Fig. 1A).

Figure 1.

Morphology and characteristics of isolated hAECs. (A) Phase contrast microscopy image of isolated hAECs (×200). (B) Protein expression levels of CK-19, Oct-4 and CD44 as detected by immunocytochemistry. (C) Confocal microscopy (magnification, ×600) demonstrated positive expression of the stem cell surface marker SSEA-4 but was negative for SSEA-1. hAECs, human amniotic epithelial cells; CK, cytokeratin; Oct-4, octamer binding protein-4; SSEA, stage-specific embryonic antigen.

Expression of the epithelial cell marker CK19, and the ESC markers CD44 and Oct-4 was detected in the primary cultures of hAECs by immunocytochemistry (Fig. 1B). The stem cell surface marker SSEA-4 was highly expressed in the hAECs, as indicated by the confocal images; whereas, SSEA-1 was negative (Fig. 1C). Together, the results suggested that the hAECs that were obtained were CK19-positive and expressed stem cell markers, CD44, Oct-4 and SSEA-4, which is consistent with previous reports (4,5). Based on the DAPI and marker staining that were performed in Fig. 1, the majority of the cells that were isolated were indeed hAECs.

Stretch regulates the osteogenic differentiation of AECs

To determine whether the mechanical stimulation affected the osteogenic differentiation of the hAECs, the protein level of osteocalcin was detected by immunocytochemistry. The data demonstrated that the osteocalcin (OC) level was induced at 12 h post-treatment by OM and OM + stretch compared with the control (Fig. 2A). This indicated that hAECs can be induced to differentiate into osteogenic-like cells.

Figure 2.

Quantitative polymerase chain reaction and western blot analysis for expression of Cbfa1, ALP and OC following different treatments. (A) The OC expression was increased at 12 h post-treatment in the OM and OM + stretch treatments (magnification, ×600). (B) The mRNA and protein expression levels of (C) Runx2/Cbfa1 (D) ALP and (E) OC were increased significantly following treatment for 6, 12 and 24 h with the combined biochemical stimulation and stretching treatment but were decreased at 24 h (n=5). *P<0.05 vs. control, #P<0.05 vs. stretch and &P<0.05 vs. OM. OC, osteocalcin; ALP, alkaline phosphatase; OM, osteogenic induction medium; Runx2, Runt-related transcription factor 2; Cbfa1, core binding factor α 1.

To investigate the whether that mechanical stretch induces hAECs to differentiate into osteoblasts, RT-qPCR and western blotting were performed to determine the expression levels of osteoblast markers, including Runx2/Cbfa1, alkaline phosphatase (ALP) and OC. The results suggested that the expression levels of Runx2/Cbfa1, ALP and OC demonstrated were significantly increased in the OM-induced group, the positive control group, and there was an increasing trend in the stretch group but with no significant differences compared with the control group (Fig. 2B-E).

Compared with the stretch or OM group alone, the mRNA and protein expression levels of Runx2/Cbfa1, ALP and OC increased following 6 h of treatment with OM combined with stretch (OM + stretch) and peaked at 12 h but decreased at 24 h (P<0.05; Fig. 2B-E). In brief, the above results suggested that the combination of OM and stretch had a synergistic effect on the osteogenic differentiation of hAECs.

Mechanical and biochemical stimulation modulates the osteogenic differentiation of hAECs via the Wnt/β-catenin signalling pathway

The Wnt/β-catenin signalling pathway has been known to affect the bone formation and homeostasis. A previous report indicated that the Wnt/β-catenin signalling pathway enhanced osteogenic differentiation from human periodontal ligament fibroblasts (18). In the present study, the mRNA and protein expression levels of β-catenin and cyclin D1 were assessed following different treatments to confirm whether Wnt/β-catenin signalling also has an important role in the osteogenic differentiation of hAECs. As shown in Fig. 3, the mRNA and protein expression levels of β-catenin, Runx2/Cbfa1 and cyclin D1 were significantly increased in the OM group (P<0.05). Furthermore, the combined application of stretching (the cells were stretched for 12 h) with OM led to significant upregulation of β-catenin, Runx2/Cbfa1 and cyclin D1 expression compared with the other treatments (P<0.05). This suggested that the Wnt/β-catenin signalling pathway may mediate the osteogenic differentiation of AECs.

Figure 3.

Quantitative polymerase chain reaction and western blot analysis for the expression of β-catenin, Runx2/Cbfa1 and cyclin D1 following stretch and OM. The mRNA and protein expression levels of β-catenin, Runx2/Cbfa1 and cyclin D1 were significantly upregulated following OM, stretch or OM + stretch and the levels in the OM + stretch group were increased compared the control group or the OM or stretch alone groups (time of cells stretched was 12 h). *P<0.05 vs. control, #P<0.05 vs. stretch. OM, osteogenic induction medium; Runx2, Runt-related transcription factor 2; Cbfa1, core binding factor α 1.

Based on these results, a Runx2-targeting shRNA was constructed and transfected into hAECs prior to OM or stretch stimulation to further investigate the mechanism of the Wnt/β-catenin signalling pathway in osteoblastic differentiation of hAECs. As exhibited in Fig. 4A, the mRNA and protein levels of Runx2/Cbfa1 were decreased by ~50 and 70%, respectively, following Runx2-shRNA transfection. The gene and protein levels of β-catenin and cyclin D1, as detected by RT-qPCR and western blotting, were significantly decreased following transfection of Runx2-shRNA in the basal and OM/stretch-stimulated groups (P<0.05; Fig. 4B).

Figure 4.

Quantitative polymerase chain reaction and western blot analysis for the expression of β-catenin, Runx2/Cbfa1 and cyclin D1 following stretch and OM, and Runx2-shRNA transfection. (A) Runx2-shRNA was successfully transfected into hAECs and captured by fluorescence microscopy (×100). Green fluorescent protein is encoded by the shRNA vector and therefore GFP fluorescence was visualized as a surrogate for the infection efficiency and was demonstrated to be 47%. (B) The mRNA and protein expression levels of β-catenin, Runx2/Cbfa1 and cyclin D1 decreased significantly following transfection of Runx2-shRNA in both the basal and stimulated groups; (n=3). (C) The osteocalcin expression was decreased following transfection of Runx2-shRNA (×600). *P<0.05 vs. control. OM, osteogenic induction medium; Runx2, Runt-related transcription factor 2; Cbfa1, core binding factor α 1; shRNA, short hairpin RNA.

To examine whether Runx2-shRNA transfection could inhibit the differentiation process, confocal microscopy was used to assess the expression of OC in hAECs. The immunocytochemistry results in Fig. 4C demonstrated that the OC expression was decreased in the transfected group compared with the control group, in the basal and stimulated groups, demonstrating that the osteogenic differentiation of AECs was blocked by cutting off the Wnt/β-catenin signalling pathway. These results demonstrated that combined OM and stretch had an important role in the modulation of osteogenic differentiation of AECs via the Wnt/β-catenin signalling pathway.

Discussion

The present study revealed certain significant results: i) Among all the treatment groups, the combined application of mechanical stretch and biochemical osteogenic stimulation of the hAECs has the most intense effects on gene or protein expression; and ii) the Wnt/β-catenin signalling pathway had an important role in the osteogenic differentiation of the hAECs induced by stretch and/or biochemical stimulation. These results suggest that mechanical stretch, particularly when combined with biochemical stimulation, had an important role in the modulation of osteogenic differentiation of hAECs. Wnt/β-catenin signalling leads to the differentiation of the hAECs into osteogenic lineage following mechanical stretch stimulation of osteogenic transcription factors.

In present study, the hAECs derived from full-term placenta seem to retain the capability to differentiate and to produce cell types from all three germ layers. Furthermore, hAECs are considered an ideal source of stem cells because of their ability to produce growth factors and catecholamines, and to differentiate into specific lineages and there are few concerns about their limitations (5,6). These characteristics make the hAECs good candidates for use in the present study.

Previous studies have demonstrated that stem cell differentiation is affected by various factors, including the following: Static stretching increases cell proliferation and activates synergistic osteoblastic differentiation of mesenchymal cells; transforming growth factor-β1 induced by microenvironments adjacent to distracted areas in vivo is thought to be involved in the regulation of bone synthesis and turnover (19); the renin-angiotensin system has been reported to mediate vascular endothelial growth factor synthesis in MSCs (20); biochemical stimulation has been reported to mediate the differentiation of hAECs into osteoblasts (12); cyclic stretching has been reported to promote osteogenesis-associated gene expression in osteoblast-like cells through a cofilin-associated mechanism mechanical stimuli (21); and mechanical loading is known to be an important factor in regulating bone growth and development (22). Thus, in the present study, it was hypothesized that hAECs differentiate into osteoblasts following stimulation by mechanical stretching.

The results of the present study indicate that treating cultured AECs with mechanical stretching altered cell morphology and modestly increased the gene and protein expression levels of Runx2/Cbfa1, ALP and OC in the hAECs. However, the combined application of stretch with OM led to further induction of Runx2/Cbfa1, ALP and OC gene and protein expression compared with either treatment alone, which demonstrated that combining stretch and biochemical osteogenic stimulation was synergistic for the osteogenic differentiation of the hAECs.

The expression of β-catenin in vitro and in vivo may contribute to the enhanced osteogenic differentiation of MSCs and bone formation in vivo (19,20,23,24). Under physiological conditions, cytoplasmic β-catenin is maintained at low levels by a continuous process of phosphorylation-dependent ubiquitination and degradation in the absence of Wnt ligand. Upon Wnt stimulation, Wnt binds with a membrane receptor called frizzled, leading to the dimerization of membrane and cytoplasmic proteins. As a result, the kinases that phosphorylate and destabilize β-catenin are inhibited, and β-catenin then accumulates in the nucleus, where it associates with transcription factors such as T-cell-specific transcription factor/lymphoid enhancing factor to activate the expression of Wnt-responsive genes, including Runx2 and cyclin D (24–27). In the present study, the expression levels of β-catenin and cyclin D1 were upregulated following osteogenic differentiation of hAECs induced by mechanical stretching. Furthermore, combined stretching and biochemical stimulation induced the expression of β-catenin and cyclin D1.

Runx2/Cbfa1, the runt domain-containing transcription factor, is a bone-specific product of the Cbfa1 gene that is essential for bone formation. It is one of the earliest and most specific markers during osteogenesis, and induces osteoblast-specific gene expression in vitro (28–30). The expression of Runx2/Cbfa1 in response to different stimuli was examined, and the data demonstrated that the gene and protein expression was induced by the combination of mechanical and biochemical stimulation. However, the upregulation of Runx2/Cbfa1 was decreased by shRNA targeting Runx2/Cbfa1 into hAECs, as was the expression of β-catenin and cyclin D1. Notably, the OC protein level, as examined by confocal microscopy, was decreased following shRNA knockdown of Runx2/Cbfa1. Thus, the present observations demonstrated that mechanical stretching, and the combination of stretching and biochemical stimuli may induce the osteogenic differentiation of hAECs via activation of Wnt/β-catenin signalling.

In conclusion, the results of the present study demonstrated that the combined use of mechanical stretching and biochemical stimulation was synergistic for the osteogenic differentiation of hAECs, and that this differentiation may be partially mediated via the Wnt/β-catenin signalling pathway. Modulation of this may be a novel approach in bone regenerative medicine.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Yongchuan Science and Technology Commission (grant no. YCSTC, 2015nc5006).

Availability of data and materials

The analysed data sets generated during the study are available from the corresponding author on reasonable request.

Authors' contributions

FL and HL designed experiments; KM, MZ and FY carried out experiments; JM analysed results. FL, HL and KM wrote the manuscript.

Ethics approval and consent to participate

All patients gave written informed consent. The present study was performed according to the Declaration of Helsinki and approved by the Medical Ethics Committee of the Yongchuan Hospital of Chongqing Medical University.

Patient consent for publication

Patients gave their consent for the present data to be published.

Competing interests

The authors declare that they have no competing interests.

References

1 

Duncan RL and Turner CH: Mechanotransduction and the functional response of bone to mechanical strain. Calcif Tissue Int. 57:344–358. 1995. View Article : Google Scholar : PubMed/NCBI

2 

Qi MC, Zou SJ, Han LC, Zhou HX and Hu J: Expression of bone-related genes in bone marrow MSCs after cyclic mechanical strain: Implications for distraction osteogenesis. Int J Oral Sci. 1:143–150. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Maul TM, Chew DW, Nieponice A and Vorp DA: Mechanical stimuli differentially control stem cell behavior: Morphology, proliferation, and differentiation. Biomech Model Mechanobiol. 10:939–953. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Ilancheran S, Moodley Y and Manuelpillai U: Human fetal membranes: A source of stem cells for tissue regeneration and repair? Placenta. 30:2–10. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Miki T, Mitamura K, Ross MA, Stolz DB and Strom SC: Identification of stem cell marker-positive cells by immunofluorescence in term human amnion. J Reprod Immunol. 75:91–96. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Toda A, Okabe M, Yoshida T and Nikaido T: The potential of amniotic membrane/amnion-derived cells for regeneration of various tissues. J Pharmacol Sci. 105:215–228. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Hodge A, Lourensz D, Vaghjiani V, Nguyen H, Tchongue J, Wang B, Murthi P, Sievert W and Manuelpillai U: Soluble factors derived from human amniotic epithelial cells suppress collagen production in human hepatic stellate cells. Cytotherapy. 16:1132–1144. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Niknejad H, Peirovi H, Ahmadiani A, Ghanavi J and Jorjani M: Differentiation factors that influence neuronal markers expression in vitro from human amniotic epithelial cells. Eur Cells Mater. 19:22–29. 2010. View Article : Google Scholar

9 

Kakishita K, Elwan MA, Nakao N, Itakura T and Sakuragawa N: Human amniotic epithelial cells produce dopamine and survive after implantation into the striatum of a rat model of Parkinson's disease: A potential source of donor for transplantation therapy. Exp Neurol. 165:27–34. 2000. View Article : Google Scholar : PubMed/NCBI

10 

Wlodarski K, Moskalewski S, Skarzyńska S, Póltorak A and Ostrowski K: Irradiation and the bone induction properties of epithelial cells. Bull Acad Pol Sci Biol. 19:821–825. 1971.PubMed/NCBI

11 

Wang Q, Wu W, Han X, Zheng A, Lei S, Wu J, Chen H, He C, Luo F and Liu X: Osteogenic differentiation of amniotic epithelial cells: Synergism of pulsed electromagnetic field and biochemical stimuli. BMC Musculoskelet Disord. 15:2712014. View Article : Google Scholar : PubMed/NCBI

12 

Parolini O, Alviano F, Bagnara GP, Bilic G, Bühring HJ, Evangelista M, Hennerbichler S, Liu B, Magatti M, Mao N, et al: Concise review: Isolation and characterization of cells from human term placenta: Outcome of the first international workshop on placenta derived stem cells. Stem Cells. 26:300–311. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Miki T, Marongiu F, Dorko K, Ellis EC and Strom SC: Isolation of amniotic epithelial stem cells. Curr Protoc Stem Cell Biol Chapter. 1:Unit 1E.3. 2010. View Article : Google Scholar

14 

Hata M, Naruse K, Ozawa S, Kobayashi Y, Nakamura N, Kojima N, Omi M, Katanosaka Y, Nishikawa T, Naruse K, et al: Mechanical stretch increases the proliferation while inhibiting the osteogenic differentiation in dental pulp stem cells. Tissue Eng Part A. 19:625–633. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Yang YQ, Li XT, Rabie AB, Fu MK and Zhang D: Human periodontal ligament cells express osteoblastic phenotypes under intermittent force loading in vitro. Front Biosci. 1:776–781. 2006. View Article : Google Scholar

16 

Koike M, Shimokawa H, Kanno Z, Ohya K and Soma K: Effects of mechanical strain on proliferation and differentiation of bone marrow stromal cell line ST2. J Bone Miner Metab. 23:219–225. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Heo JS, Lee SY and Lee JC: Wnt/β-catenin signaling enhances osteoblastogenic differentiation from human periodontal ligament fibroblasts. Mol Cells. 30:449–454. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Kim IS, Song YM and Hwang SJ: Osteogenic responses of human mesenchymal stromal cells to static stretch. J Dent Res. 89:1129–1134. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Liu C, Zhang JW, Hu L, Song YC, Zhou L, Fan Y, Zhu HY, Wang Y and Li QP: Activation of the AT1R/HIF-1α/ACE axis mediates angiotensin II-induced VEGF synthesis in mesenchymal stem cells. Biomed Res Int. 2014:6273802014. View Article : Google Scholar : PubMed/NCBI

21 

Gao J, Fu S, Zeng Z, Li F, Niu Q, Jing D and Feng X: Cyclic stretch promotes osteogenesis-related gene expression in osteoblast-like cells through a cofilin-associated mechanism. Mol Med Rep. 14:218–224. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Wu Y, Zhang P, Dai Q, Yang X, Fu R, Jiang L and Fang B: Effect of mechanical stretch on the proliferation and differentiation of BMSCs from ovariectomized rats. Mol Cell Biochem. 382:273–282. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Dao DY, Jonason JH, Zhang Y, Hsu W, Chen D, Hilton MJ and O'Keefe RJ: Cartilage-specific β-CATENIN signaling regulates chondrocyte maturation, generation of ossification centers, and perichondrial bone formation during skeletal development. J Bone Miner Res. 27:1680–1694. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Jian H, Shen X, Liu I, Semenov M, He X and Wang XF: Smad3-dependent nuclear translocation of beta-catenin is required for TGFbeta1-induced proliferation of bone marrow-derived adult human mesenchymal stem cells. Genes Dev. 20:666–674. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Kestler HA and Kühl M: From individual Wnt pathways towards a Wnt signaling network. Philos Trans R Soc Lond B Biol Sci. 363:1333–1347. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Taurin S, Sandbo N, Qin Y, Browning D and Dulin NO: Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase. J Biol Chem. 281:9971–996. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Takemaru KI and Moon RT: The transcriptional eoaetivator CBP interaets with beta-catenin to activate gene expression. J Cell Biol. 149:249–254. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, et al: Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 89:755–764. 1997. View Article : Google Scholar : PubMed/NCBI

29 

Xiao G, Jiang D, Ge C, Zhao Z, Lai Y, Boules H, Phimphilai M, Yang X, Karsenty G and Franceschi RT: Cooperative interactions between activating transcription factor 4 and Runx2/Cbfa1 stimulate osteoblast-specific osteocalcin gene expression. J Biol Chem. 280:30689–30696. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole WG, Henn W, Knoll JH, et al: Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell. 89:773–779. 1997. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Luan F, Ma K, Mao J, Yang F, Zhang M and Luan H: Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway. Mol Med Rep 18: 5717-5725, 2018.
APA
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., & Luan, H. (2018). Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway. Molecular Medicine Reports, 18, 5717-5725. https://doi.org/10.3892/mmr.2018.9571
MLA
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., Luan, H."Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway". Molecular Medicine Reports 18.6 (2018): 5717-5725.
Chicago
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., Luan, H."Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway". Molecular Medicine Reports 18, no. 6 (2018): 5717-5725. https://doi.org/10.3892/mmr.2018.9571
Copy and paste a formatted citation
x
Spandidos Publications style
Luan F, Ma K, Mao J, Yang F, Zhang M and Luan H: Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway. Mol Med Rep 18: 5717-5725, 2018.
APA
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., & Luan, H. (2018). Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway. Molecular Medicine Reports, 18, 5717-5725. https://doi.org/10.3892/mmr.2018.9571
MLA
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., Luan, H."Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway". Molecular Medicine Reports 18.6 (2018): 5717-5725.
Chicago
Luan, F., Ma, K., Mao, J., Yang, F., Zhang, M., Luan, H."Differentiation of human amniotic epithelial cells into osteoblasts is induced by mechanical stretch via the Wnt/β‑catenin signalling pathway". Molecular Medicine Reports 18, no. 6 (2018): 5717-5725. https://doi.org/10.3892/mmr.2018.9571
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team