Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2019 Volume 19 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2019 Volume 19 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes

  • Authors:
    • Yang Wang
    • Hua‑Jun Sun
    • Rong‑Gui Li
    • Xiao‑Mei Wang
    • Zhi‑Qiang Cheng
    • Nan Lou
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Shenzhen People's Hospital, Second Clinical Medical College of Jinan University, Shenzhen, Guangdong 518020, P.R. China, Department of Pathology, Sichuan Provincial People's Hospital, School of Medicine, University of Electronic Science and Technology of China, Chengdu, Sichuan 610015, P.R. China, Key Laboratory of Pathobiology, Ministry of Education, Norman Bethune College of Medicine, Jilin University, Changchun, Jilin 130012, P.R. China, Department of Orthopaedics and Traumatology, The University of Hong Kong‑Shenzhen Hospital, Shenzhen, Guangdong 518053, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 967-973
    |
    Published online on: December 12, 2018
       https://doi.org/10.3892/mmr.2018.9753
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Uncontrolled proliferation and defective apoptosis are two major factors responsible for maintaining the malignant properties of melanoma cells. Our previous study demonstrated that induced expression of four reprogramming factors remodeled the phenotype of B16‑F10 mouse melanoma cells into melanoma stem cells. The present study was conducted to investigate the effect of the four Yamanaka reprogramming factors, namely Oct4, Sox2, Klf4 and c‑Myc (OSKM), on the proliferation and apoptosis of melanoma cells, and to identify the responsible molecular signals. The results identified that expression of the four reprogramming factors was highly induced by doxycycline treatment in the stable melanoma cell clone that was transfected with a plasmid expressing these factors, driven by the Tet‑On element. It was further confirmed that induced expression of these factors enhanced the proliferation and suppressed the apoptosis of the melanoma cells. In addition, induced OSKM expression increased cell proliferation, accelerated the progression of the cell cycle, and upregulated the mRNA expression levels of Janus kinase 2 (JAK2) and Cyclin‑B1. Induced expression of these factors also decreased the apoptosis, as well as upregulated B‑cell lymphoma 2 (BCL‑2) and downregulated BCL‑2‑associated X (BAX) mRNA expression levels. Taken together, the results suggested that upregulated JAK2 and Cyclin‑B1 may be responsible for the enhanced proliferation of melanoma cells, and that BCL‑2 upregulation and BAX downregulation may account for the suppressed apoptosis of these cells.

Introduction

Malignant melanoma is a highly aggressive disease exhibiting drug-resistant behavior (1). Higher melanoma incidence is reported in children and adolescents, whose longer life expectancy than adult patients may be seriously affected (2). Melanoma treatments include conventional surgery, chemotherapy, radiotherapy and biotherapy; however, these are not always successful. Furthermore, certain of these treatment strategies are associated with adverse reactions and/or emergence of drug resistance (3,4), due to the involvement of relatively complicated cellular and molecular mechanisms.

Uncontrolled proliferation and defective apoptosis have been recognized as major factors responsible for the transformation of normal melanocytes into malignant melanoma cells (5). This has been further proven by studies reporting that benign nevi can be transformed into melanoma cells through uncontrolled proliferation and decreased apoptosis (6,7).

The Yamanaka transcription factors: Oct4, Sox2, Klf4, and c-Myc (OSKM) have been successfully used to induce the differentiation of osteosarcoma and breast cancer cells into osteosarcoma stem cells and breast cancer stem cells, respectively (8–11). Our previous study demonstrated that the plasmid expressing these four factors driven by the Tet-On element is transfected into melanoma F10-B16 cells and doxycycline (DOX) is used to induce the expression of these factors in stable transfected cell clones; thus the expression of four reprogramming factors OSKM were induced, remodeling the phenotype of B16-F10 mouse melanoma cells into melanoma stem cells (12). Therefore, the present study was conducted to seek evidence for the effect of induced expression of these four reprogramming factors on the proliferation and apoptosis of melanoma cells, as well as to identify the responsible molecular signals involved.

Materials and methods

Materials

High-glucose Dulbecco's modified Eagle's medium (H-DMEM), sucrose-based solution, SYBR Green PCR Master Mix, Lipofectamine® 2000 and Zeocin were obtained from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Fetal bovine serum (FBS) was purchased from GE Healthcare Life Science (Hyclone; Logan, UT, USA). Doxycycline (DOX) was from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). The Cell Counting kit-8 (CCK-8) assay kit was provided by Dojindo Molecular Technologies, Inc. (Tokyo, Japan). The Cell Cycle Detection kit was from Beyotime Institute of Biotechnology (Jiangsu, China). The Annexin V/PI Apoptosis Detection kit was purchased from BD Biosciences (San Jose, CA, USA). The RNAiso Plus reagent, polymerase chain reaction (PCR) primers and reverse transcription (RT) reaction kit were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). The plasmids TetO-FUW-OSKM and FUW-M2rtTA were kindly provided by Professor Rudolf Jaenisch (Whitehead Institute for Biomedical Research, Cambridge, MA, USA; Addgene plasmid nos. 20321 and 20342, respectively).

Cell culture and transfection

B16-F10 mouse melanoma cells were obtained from the American Type Culture Collection (Manassas, VA, USA). These cells were maintained in H-DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere with 5% CO2. Cell transfection with the plasmid TetO-FUW-OSKM or FUW-M2rtTA was performed using the Lipofectamine® 2000 reagent, according to the manufacturer's protocol. After 24 h, the transfection was terminated by washing away the media, following which fresh complete medium was added to the cells. On day 3, we seeded the cells in a 10-cm plate, and then Zeocin (400 µg/ml) was added at day 5 to start the selection. The cells were checked daily, and the medium was changed when necessary in order to remove dead cells. When the clones were clearly visible and isolated from one another, they were selected, transferred to 96-well plates (one clone/well) and then expanded.

Cell proliferation assay

The transfected cells were seeded into 96-well plates at a density of 1,000 cells/well and incubated at 37°C overnight to allow for cell attachment. Then, the expression of OSKM was induced via a Tet-On inducer, DOX (2 µg/ml,). After 0, 24, 48, 72 and 96 h of incubation with the control group that absence of DOX, the CCK-8 assay kit was used to respectively evaluate the cell proliferation, according to the manufacturer's protocols. Briefly, following incubation, the cells were incubated with CCK-8 solution, and then the absorbance was determined at a wavelength of 450 nm with a microplate reader. The absorbance values determined the cell number based on a standard curve of cell numbers against the absorbance value, which resulted from a series of samples analyses in which the cell numbers were known.

Cell cycle progression assay

The B16-F10 cells were plated in 6-cm diameter dishes (0.5×106 cells/dish) and allowed to grow for 3 days. A Cell Cycle Detection kit was then used to determine the cell cycle status, according to the manufacturer's protocol. Briefly, the cells were washed with cooled PBS, fixed with 70% alcohol at for >2 h. Next, cells were treat ed with RNase A (included in kit) and stained with PI solution. Flow cytometry was then conducted at an excitation wavelength of 488 nm and analyzed. The percentage of S-phase cells was calculated according to the number of cells at each phase, as follows: SPF(%)=S/(G0/G1+S+G2M). In addition, the proliferation index was calculated according to the following formula: PI(%)=(S+G2M)/(G0/G1+S+G2M).

Cell apoptosis assay

The cells were plated in 6-cm diameter dishes (0.5×106 cells/dish) and allowed to grow for 3 days. Flow cytometry with Annexin V-FITC/PI dual staining was conducted to detect the apoptotic cells, according to the protocol suggested by the manufacturer. Briefly, subsequent to staining with Annexin V-FITC and PI, the cells were analyzed with a FACSCalibur flow cytometer (BD Biosciences). The emitted green fluorescence of Annexin V (FL1) and red fluorescence of PI (FL3) were detected at excitation wavelengths of 488 and 546 nm, respectively, and at emission wavelengths of 525 and 647 nm, respectively. The degrees of early and late apoptosis were determined based on the percentages of Annexin V+/PI− and Annexin V+/PI+ cells, respectively.

RNA purification and RT-quantitative PCR (qPCR)

Total RNA purification and RT-qPCR were performed according to the detailed procedure described in a previous study (13). The primer sets used in the PCR amplification are listed in Table I. Following amplification, a melting curve was generated, and data analysis was performed using Dissociation Curve software, version 1.0 (Applied Biosystems; Thermo Fisher Scientific, Inc.). The normalized value was given by the ratio of the target gene mRNA to the reference gene (β-actin) mRNA in each sample.

Table I.

Primer sets used in reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sets used in reverse transcription-quantitative polymerase chain reaction.

GenesPrimerSequenceGenBank no.
Oct4Forward 5′-CAGCCAGACCACCATCTGTC-3′NM_013633.3
Reverse 5′-GTCTCCGATTTGCATATCTCCTG-3′
Sox2Forward 5′-GCTCGCAGACCTACATGAAC-3′NM_011443.4
Reverse 5′-GCCTCGGACTTGACCACAG-3′
Klf4Forward 5′-CTTCAGCTATCCGATCCGGG-3′NM_010637.3
Reverse 5′-GAGGGGCTCACGTCATTGAT-3′
c-MycForward 5′-TCTCCATCCTATGTTGCGGTC-3′NM_010849.4
Reverse 5′-TCCAAGTAACTCGGTCATCATCT-3′
JAK2Forward5′- CTGGCGAGGTGGTCGCTGTG −3NM_146145.2
Reverse5′- GCCGACCCGCACTGTAGCAC −3′
Cyclin-B1Forward5′- GGCGAGCCTCAAAAGCCGGA −3′NM_008655.1
Reverse5′- GCGGCTGCCACCTGAGAAGG −3′
BCL2Forward5′- ATGGCGCAAGCCGGGAGAAC −3′NM_009741.5
Reverse5′- CGCGTCCGCATCTCCAGCAT −3′
BAXForward5′- TCCGGGGAGCAGCTTGGGAG −3′NM_007527.3
Reverse5′- GGCGGCTGCTCCAAGGTCAG −3′
CDK1Forward5′- GTTGCTGGGCTCGGCTCGTT −3′NM_007658.3
Reverse5′- GCGGCTTCTTGGTGGCCAGT −3′
SKP2Forward5′- TGCCCCAACCTCATCCGCCT −3′NM_013787.3
Reverse5′- ACCGGCTGAGCGAGAGGTGT −3′
Caspase 3Forward5′- TCATTCAGGCCTGCCGGGGT −3′NM_009810.3
Reverse5′- TGGATGAACCACGACCCGTCC −3′
Caspase 9Forward5′- AGGGTGCGCCTAGTGAGCGA −3′NM_015733.5
Reverse5′- CCTGATCCCGCCGAGACCCA −3′
P53Reverse 5′-GGACGATCTGTTGCTGCCCCGAGA −3′NM_011640.3
Forward5′- TGACAGGGGCCATGGAGTGGCT −3′
β-actinReverse 5′-CATGTACGTTGCTATCCAGGC-3′NM_001101
Reverse 5′-CTCCTTAATGTCACGCACGAT-3′

[i] JAK2, Janus kinase 2; CDK1, cyclin-dependent kinase 1; SKP2, S-phase kinase-associated protein 2; BCL-2, B-cell lymphoma 2; BAX, BCL-2-associated X; Caspase, cysteinyl aspartate specific proteinase.

Statistical analysis

Statistical analyses were performed using GraphPad Prism software, version 5.0 (San Diego, CA, USA). Student's t-test was used to analyze the statistical significance of any differences between two groups. P<0.05 was considered to indicare a statistically significant difference.

Results

Induction of OSKM expression by DOX treatment

In our previous study, B16-F10 mouse melanoma cells were transfected with a plasmid expressing the four Yamanaka transcription factors, known as OSKM, driven by the Tet-On element. The stable cell clones were then used to study the role of induced expression of these factors. The present study further attempted to ensure the induction of OSKM expression by a Tet-On inducer, DOX (2 µg/ml). The mRNA levels of the OSKM factors were analyzed by RT-qPCR in a selected stable cell clone, cultured in the presence or absence of DOX. As shown in Fig. 1, the expression of the four factors at the mRNAs level was significantly induced by the DOX treatment, when compared with that in cells without DOX exposure. The induction of elevated protein levels has been proven in our previous study (12). These results indicated that high expression of these factors was obtained by treating the melanoma cells with DOX.

Figure 1.

Induction of OSKM expression by DOX treatment. B16-F10 mouse melanoma cells, stably-transfected with TetO-FUW-OSKM, were cultured in the presence or absence of DOX. The OSKM mRNA levels were analyzed using reverse transcription-quantitative polymerase chain reaction and normalized to β-actin mRNA. The relative fold activation was obtained based on the ratio of the normalized values of the DOX-induced cells to that of the cells without DOX exposure. *P<0.01 vs. cells without exposure to DOX. OSKM, Oct4, Sox2, Klf4 and c-Myc; DOX, doxycycline.

Induced expression of OSKM enhances the proliferation of melanoma cells

Uncontrolled proliferation is a crucial factor that characterizes the malignancy of melanoma cells (6). To examine whether induction of OSKM expression was able to enhance the proliferation of melanoma cells, a CCK-8 cell proliferation assay was used in cells cultured in the presence or absence of DOX. As shown in Fig. 2, cells in the two culture conditions proliferated in a time-dependent manner; however, the cell proliferation was significantly increased following exposure to DOX as compared with that of cells without DOX exposure. These findings indicated that induction of OSKM expression enhanced the proliferation of melanoma cells.

Figure 2.

Induced expression of OSKM promoted the proliferation of melanoma cells, as examined using the Cell Counting kit-8 assay. Relative cell proliferation was calculated based on the ratio of the number of cells at a specific time point over the total number of cells at 0 h. *P<0.05 and **P<0.01, vs. cells without exposure to DOX. OSKM, Oct4, Sox2, Klf4 and c-Myc; DOX, doxycycline.

Induced expression of OSKM accelerates the cell cycle progression

The cell proliferation rate is determined by the progression of the cell cycle (14). Based on the earlier finding that the proliferation of melanoma cells is enhanced by the induction of OSKM expression, the present study next analyzed the percentage of melanoma cells at each cell division phase following culture in the absence or presence of DOX. The representative histograms of the flow cytometric assay are shown in Fig. 3A, while statistically analyzed data are presented in Fig. 3B. The percentage of S-phase cells and the proliferation index significantly increased in the cells cultured in the presence of DOX, when compared with those in cells cultured in the absence of DOX. Taken together, these results indicated that the induced expression of OSKM enhanced cell proliferation by accelerating cell cycle progression.

Figure 3.

Induced expression of OSKM accelerated the procession of the cell cycle. (A) Representative histograms of the flow cytometric assay, and (B) quantified results of the relative cell percentage are shown. *P<0.05 vs. cells without exposure to DOX. OSKM, Oct4, Sox2, Klf4 and c-Myc; SPF, S-phase fraction; PI, proliferation index; DOX, doxycycline.

Induced expression of OSKM inhibits the apoptosis of melanoma cells

Defective apoptosis is another major factor deciding the malignancy of melanoma cells (7,14). To determine whether induced OSKM expression was able to decrease the apoptosis of melanoma cells, the proportion of apoptotic cells was analyzed through a flow cytometric assay. The representative histograms of the flow cytometric assay are shown in Fig. 4A, while statistically analyzed results are shown in Fig. 4B. As shown in Fig. 4, the percentage of apoptotic cells significantly decreased following exposure to DOX as compared with that in cells without DOX exposure. These results indicated that induction of OSKM expression suppressed the apoptosis of melanoma cells.

Figure 4.

Induced expression of OSKM suppressed the apoptosis of melanoma cells. (A) Representative histograms of the flow cytometric assay, and (B) quantified results of apoptotic cells are shown. Cells at the early apoptosis (Annexin V+/PI−) and late apoptosis (Annexin V+/PI+) stages were used in the statistical analysis. *P<0.05 vs. cells without exposure to DOX. OSKM, Oct4, Sox2, Klf4 and c-Myc; DOX, doxycycline.

Induced expression of OSKM changes the expression of associated genes

To explore the underlying mechanism by which OSKM factors enhance the proliferation and suppress the apoptosis of melanoma cells, the mRNA levels of certain associated genes were analyzed with RT-qPCR. These genes included Janus kinase 2 (JAK2), Cyclin-B1, cyclin-dependent kinase 1 (CDK1) and S-phase kinase-associated protein 2 (SKP2), whose products serve crucial roles in regulating the cell cycle progression and cell proliferation (15–17). In addition, B-cell lymphoma 2 (BCL-2), BCL-2-associated X (BAX), cysteinyl aspartate specific proteinase 3 (Caspase 3), Caspase 9 and P53 (also known as transformation-related protein 53) were detected, whose products are important in controlling cell apoptosis (18–21).

As shown in Table II, among the analyzed genes that are associated with cell proliferation, the mRNA expression levels of JAK2 and Cyclin-B1 were significantly increased when the cells were exposed to DOX, as compared with those in cells not exposed to DOX. By contrast, the mRNA expression levels of CDK1 and SKP2 were unchanged in the DOX-induced cells. Among the analyzed genes associated with cell apoptosis, the mRNA level of BCL-2 was increased, while the mRNA of BAX was decreased, when the cells were exposed to DOX. However, the expression of other genes associated with cell apoptosis was unchanged in the DOX-induced cells. The increased expression of JAK2 and Cyclin-B1 mRNAs supported the observation that induced expression of the four OSKM factors enhanced cell proliferation, suggesting that upregulation of JAK2 and Cyclin-B1 may be responsible for the enhanced proliferation. Furthermore, the upregulated BCL-2 and downregulated BAX mRNAs verified the conclusion that induced expression of the OSKM factors was able to suppress cell apoptosis, suggesting that the altered expression levels of BCL-2 and BAX may be involved in the suppression of apoptosis.

Table II.

Induction of OSKM expression by DOX treatment altered the expression levels of associated genes.

Table II.

Induction of OSKM expression by DOX treatment altered the expression levels of associated genes.

GenesFold change (DOX+/DOX-)
JAK2 7.9±0.81a
Cyclin-B1 1.8±0.10b
CDK10.90±0.07
SKP21.22±0.05
BCL-2 2.4±0.18b
BAX 0.56±0.02a
Caspase 31.4±0.10
Caspase 91.3±0.08
P531.39±0.17

a P<0.01

b P<0.05, vs. group without DOX exposure. mRNA levels were analyzed by reverse transcription-quantitative polymerase chain reaction and normalized to β-actin mRNA. Relative fold activation was calculated based on the ratio of the normalized values of the cells induced by DOX to that of the cells without DOX exposure. DOX, doxycycline; JAK2, Janus kinase 2; CDK1, cyclin-dependent kinase 1; SKP2, S-phase kinase-associated protein 2; BCL-2, B-cell lymphoma 2; BAX, BCL-2-associated X; Caspase, cysteinyl aspartate specific proteinase.

Discussion

The effects of induced expression of the four reprogramming factors on the proliferation and apoptosis of melanoma cells, which are the two major factors affecting the malignancy of the cells, has not been extensively investigated (22). In our previous study, stable B16-F10 mouse melanoma cell clones that were transfected with a plasmid expressing the Yamanaka reprogramming factors, namely OSKM, driven by the Tet-On element, had been used to study the role of the induced expression of these factors in remodeling the phenotype of melanoma cells. In the present study, the effects of these factors on the proliferation and apoptosis of melanoma cells, as well as the involved mechanisms, were investigated. Initially, the mRNA expression of these four factors in a stable cell clone cultured in the presence or absence of DOX was analyzed to ensure that the expression of OSKM was successfully induced. As expected, the mRNA levels of the OSKM factors were significantly enhanced when the cells were exposed to DOX, indicating that high expression of these factors was achieved by DOX exposure. This had also been reported in our earlier study (12), in which high induction of the protein levels of these factors had been observed. Furthermore, this was also supported by the knowledge that the plasmid TetO-FUW-OSKM is a single polycistronic vector encoding the four transcription factors, driven by the Tet-On element (23,24). These results provided the preliminary basis for the next phase of the present study.

The malignant growth of tumors is a complex process, involving activation of sustained growth signals and inhibition of cellular death signals (22). In the present study, it was observed that induction of the expression of the four reprogramming OSKM factors in B16-F10 melanoma cells significantly increased the proliferation and suppressed the apoptosis of melanoma cells. These results indicated that the reprogramming factors were able to elevate the malignancy of B16-F10 melanoma cells, based on the crucial role of uncontrolled cell proliferation and defective cell apoptosis in the development of melanoma and the development of the malignant phenotype of other various tumors (6,25,26). This observation was also supported by other studies reporting that induction of the reprogramming factors increased the cell proliferation rate of mature epithelial cells and Kaposi's sarcoma tumorigenesis (27,28).

To explore the molecular mechanism by which the induced expression of the four reprogramming factors affected the proliferation and apoptosis of melanoma cells, the mRNA levels of the associated genes was analyzed. Special attention was paid to the genes whose functions are involved in cell cycle progression, proliferation and apoptosis. The results revealed that among all analyzed mRNAs associated with cell cycle progression and proliferation, only the mRNA expression levels of JAK2 and Cyclin-B1 were significantly increased, while the levels of other associated genes remained unchanged. These results indicated that JAK2 and Cyclin-B1 upregulation may be responsible for the increased proliferation of melanoma cells, which was induced by the reprogramming factors. This finding was supported by other studies reporting that Cyclin-B1 controlled the cell cycle progression and JAK2 upregulated Cyclin-B1 (29,30). Furthermore, the current study demonstrated that among all the analyzed mRNAs that control cell apoptosis, the mRNA expression of BCL-2 was significantly increased and that of BAX was significantly decreased by the induced expression of the reprogramming factors, while all other apoptosis-associated genes were unchanged. These results indicated that the increased expression of BCL-2 and decreased expression of BAX may be responsible for the suppressed apoptosis of melanoma cells, induced by the reprogramming factors. This finding was also supported by previous studies reporting that cell apoptosis was controlled by the upregulation of BCL-2 and downregulation of BAX (18,19).

In conclusion, the present study observed that induced expression of four reprogramming factors enhanced the proliferation and suppressed the apoptosis of B16-F10 mouse melanoma cells. The enhanced proliferation, indicated by the increase in cell proliferation and accelerated progression of the cell cycle, was found to be associated with upregulation of JAK2 and Cyclin-B1 expression levels. In addition, the suppression of apoptosis was supported by the upregulation of BCL-2 and downregulation of BAX mRNA expression levels. Taken together, the results revealed that upregulated JAK2 and Cyclin-B1 may be responsible for enhanced proliferation, while upregulated BCL-2 and downregulated BAX may be responsible for apoptosis suppression in melanoma cells with DOX-induced OSKM expression.

Acknowledgements

The authors would like to express their appreciation to Professor F. William Orr from the University of Manitoba (Manitoba, Canada) for his great help in revising the manuscript and to Professor Rudolf Jaenisch from the Whitehead Institute for Biomedical Research (Cambridge, MA, USA) for supplying the plasmids FUW-M2rtTA and TetO-FUW-OCT4 of Addgene.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YW provided the related materials and methods from previous studies, and made substantial contributions to the study conception and design. H-JS analyzed and interpreted the data. R-GL and X-MW wwere involved in the data collection and disposal, the manuscript drafting and critical revision. Z-QC and NL conceived and designed parts of the study and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy and integrity of any part of the work are appropriately investigated and resolved. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

OSKM

Oct4, Sox2, Klf4 and c-Myc

SPF

S-phase fraction

PI

proliferation index

DOX

doxycycline

References

1 

DeSantis CE, Lin CC, Mariotto AB, Siegel RL, Stein KD, Kramer JL, Alteri R, Robbins AS and Jemal A: Cancer treatment and survivorship statistics, 2014. CA Cancer J Clin. 64:252–271. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Hoang MT and Eichenfield LF: The rising incidence of melanoma in children and adolescents. Dermatol Nurs. 12:188–189. 2000.PubMed/NCBI

3 

Dudek-Peric AM, Ferreira GB, Muchowicz A, Wouters J, Prada N, Martin S, Kiviluoto S, Winiarska M, Boon L, Mathieu C, et al: Antitumor immunity triggered by melphalan is potentiated by melanoma cell surface-associated calreticulin. Cancer Res. 75:1603–1614. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Ribas A, Hamid O, Daud A, Hodi FS, Wolchok JD, Kefford R, Joshua AM, Patnaik A, Hwu WJ, Weber JS, et al: ssociation of pembrolizumab with tumor response and survival among patients with advanced melanoma. JAMA. 315:1600–1609. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Bandarchi B, Jabbari CA, Vedadi A and Navab R: Molecular biology of normal melanocytes and melanoma cells. J Clin Pathol. 66:644–648. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Croce CM: Oncogenes and cancer. N Engl J Med. 358:502–511. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Zhao H, Tang W, Chen X, Wang S, Wang X, Xu H and Li L: The NAMPT/E2F2/SIRT1 axis promotes proliferation and inhibits p53-dependent apoptosis in human melanoma cells. Biochem Biophys Res Commun. 493:77–84. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Takahashi K and Yamanaka S: Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126:663–676. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Levings PP, McGarry SV, Currie TP, Nickerson DM, McClellan S, Ghivizzani SC, Steindler DA and Gibbs CP: Expression of an exogenous human Oct-4 promoter identifies tumor-initiating cells in osteosarcoma. Cancer Res. 69:5648–5655. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Beltran AS, Rivenbark AG, Richardson BT, Yuan X, Quian H, Hunt JP, Zimmerman E, Graves LM and Blancafort P: Generation of tumor-initiating cells by exogenous delivery of OCT4 transcription factor. Breast Cancer Res. 13:942011. View Article : Google Scholar

11 

Corominas-Faja B, Cufi S, Oliveras-Ferraros C, Cuyàs E, López-Bonet E, Lupu R, Alarcón T, Vellon L, Iglesias JM, Leis O, et al: Nuclear reprogramming of luminal-like breast cancer cells generates Sox2-overexpressing cancer stem-like cellular states harboring transcriptional activation of the mTOR pathway. Cell cycle. 12:3109–31024. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Wang Y, Mou Y, Zhang H, Wang X, Li R, Cheng Z and Liu X: Reprogramming factors remodel melanoma cell phenotype by changing Stat3 expression. Int J Med Sci. 14:1402–1409. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Wang Y, Wei Y, Zhang H, Shi Y, Li Y and Li R: Arsenic trioxide induces apoptosis of p53 null osteosarcoma MG63 cells through the inhibition of catalase. Med Oncol. 29:1328–1334. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Sherr CJ: Principles of tumor suppression. Cell. 116:235–246. 2004. View Article : Google Scholar : PubMed/NCBI

15 

Pan XW, Chen L, Hong Y, Xu DF, Liu X, Li L, Huang Y, Cui LM, Gan SS, Yang QW, et al: EIF3D silencing suppresses renal cell carcinoma tumorigenesis via inducing G2/M arrest through downregulation of Cyclin B1/CDK1 signaling. Int J Oncol. 48:2580–2590. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M and Skoda RC: A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 352:1779–1790. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Xu J, Zhou W, Yang F, Chen G, Li H, Zhao Y, Liu P, Li H, Tan M, Xiong X and Sun Y: The beta-TrCP-FBXW2-SKP2 axis regulates lung cancer cell growth with FBXW2 acting as a tumour suppressor. Nat commun. 8:140022017. View Article : Google Scholar : PubMed/NCBI

18 

Ashkenazi A, Fairbrother WJ, Leverson JD and Souers AJ: From basic apoptosis discoveries to advanced selective BCL-2 family inhibitors. Nat Rev Drug Discov. 16:273–284. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Carrington EM, Tarlinton DM, Gray DH, Huntington ND, Zhan Y and Lew AM: The life and death of immune cell types: The role of BCL-2 anti-apoptotic molecules. Immunol Cell Biol. 95:870–877. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Herr I and Debatin KM: Cellular stress response and apoptosis in cancer therapy. Blood. 98:2603–2614. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Ferraz da Costa DC, Fialho E and Silva JL: Cancer chemoprevention by resveratrol: The p53 tumor suppressor protein as a promising molecular target. Molecules. 22:2017. View Article : Google Scholar : PubMed/NCBI

22 

Hainaut P and Plymoth A: Targeting the hallmarks of cancer: Towards a rational approach to next-generation cancer therapy. Curr Opin Oncol. 25:50–51. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Hockemeyer D, Soldner F, Cook EG, Gao Q, Mitalipova M and Jaenisch R: A drug-inducible system for direct reprogramming of human somatic cells to pluripotency. Cell Stem Cell. 3:346–353. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Carey BW, Markoulaki S, Hanna J, Saha K, Gao Q, Mitalipova M and Jaenisch R: Reprogramming of murine and human somatic cells using a single polycistronic vector. Proc Nati Acad Sci USA. 106:157–162. 2009. View Article : Google Scholar

25 

Imran A, Qamar HY, Ali Q, Naeem H, Riaz M, Amin S, Kanwal N, Ali F, Sabar MF and Nasir IA: Role of molecular biology in cancer treatment: A review article. Iran J Public Health. 46:1475–1485. 2017.PubMed/NCBI

26 

Celia-Terrassa T and Kang Y: Distinctive properties of metastasis-initiating cells. Genes Dev. 30:892–908. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Guo L, Karoubi G, Duchesneau P, Shutova MV, Sung HK, Tonge P, Bear C, Rogers I, Nagy A and Waddell TK: Generation of induced progenitor-like cells from mature epithelial cells using interrupted reprogramming. Stem Cell Reports. 9:1780–1795. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Gramolelli S and Ojala PM: Kaposi's sarcoma herpesvirus-induced endothelial cell reprogramming supports viral persistence and contributes to Kaposi's sarcoma tumorigenesis. Curr Opin Virol. 26:156–162. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Qian X, Tan C, Yang B, Wang F, Ge Y, Guan Z and Cai J: Astaxanthin increases radiosensitivity in esophageal squamous cell carcinoma through inducing apoptosis and G2/M arrest. Dis Esophagus. 30:1–7. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Toyoshima-Morimoto F, Taniguchi E, Shinya N, Iwamatsu A and Nishida E: Polo-like kinase 1 phosphorylates cyclin B1 and targets it to the nucleus during prophase. Nature. 410:215–220. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang Y, Sun HJ, Li RG, Wang XM, Cheng ZQ and Lou N: Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes. Mol Med Rep 19: 967-973, 2019.
APA
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., & Lou, N. (2019). Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes. Molecular Medicine Reports, 19, 967-973. https://doi.org/10.3892/mmr.2018.9753
MLA
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., Lou, N."Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes". Molecular Medicine Reports 19.2 (2019): 967-973.
Chicago
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., Lou, N."Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes". Molecular Medicine Reports 19, no. 2 (2019): 967-973. https://doi.org/10.3892/mmr.2018.9753
Copy and paste a formatted citation
x
Spandidos Publications style
Wang Y, Sun HJ, Li RG, Wang XM, Cheng ZQ and Lou N: Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes. Mol Med Rep 19: 967-973, 2019.
APA
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., & Lou, N. (2019). Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes. Molecular Medicine Reports, 19, 967-973. https://doi.org/10.3892/mmr.2018.9753
MLA
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., Lou, N."Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes". Molecular Medicine Reports 19.2 (2019): 967-973.
Chicago
Wang, Y., Sun, H., Li, R., Wang, X., Cheng, Z., Lou, N."Reprogramming factors induce proliferation and inhibit apoptosis of melanoma cells by changing the expression of particular genes". Molecular Medicine Reports 19, no. 2 (2019): 967-973. https://doi.org/10.3892/mmr.2018.9753
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team