Melatonin suppresses epithelial‑to‑mesenchymal transition in the MG‑63 cell line

  • Authors:
    • Yongjun Chen
    • Tao Zhang
    • Xiongwei Liu
    • Zengyan Li
    • Dongming Zhou
    • Wensheng Xu
  • View Affiliations

  • Published online on: December 23, 2019     https://doi.org/10.3892/mmr.2019.10902
  • Pages: 1356-1364
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Epithelial‑to‑mesenchymal transition (EMT) is a major process involved in tumor progression and metastasis. Melatonin is secreted by the pineal gland and has been documented as a potential therapeutic agent for multiple tumors. However, the effects of melatonin on EMT during osteosarcoma (OA) development remain undefined. The present study explored the biological functions and effects of melatonin on EMT induced by transforming growth factor β1 (TGF‑β1) and its underlying mechanisms in MG‑63 cells. Using western‑blotting and immunofluorescence, it was found that the switch in E‑cadherin/N‑cadherin and vimentin expression was induced by TGF‑β1, which was reversed by melatonin through the suppression of Snail and matrix metalloproteinase 9 (MMP‑9), through hypoxia‑inducible factor 1α (HIF‑1α) inhibition. These findings demonstrated that the anticancer effects of melatonin against OA MG‑63 cells is through the suppression of EMT via HIF‑1α/Snail/MMP‑9 signaling.

Introduction

Osteosarcoma (OA) is a malignant and aggressive bone tumor prevalent in children and young adults, representing 60% of all bone tumors globally (1). Although OA treatment including surgery and systemic chemotherapy has progressed, local infiltration and distant metastasis are frequent. For patients lacking tumor spread and metastasis, the five-year survival rates are 60–80%. For patients with tumor metastasis, the five-year survival rates decrease to 17% (2). A deeper understanding of the key mechanisms promoting OA tumorigenesis and effective therapeutic interventions towards OA are thus essential.

Melatonin is secreted by the pineal gland and plays a cyto-protective role in the regulation of oxidative stress, apoptosis-related factors and signaling pathways (3). Melatonin is beneficial during the treatment of insomnia, obesity, type 2 diabetes and liver fibrosis (46) and can inhibit hormone-dependent or hormone-independent tumors (7). Notably, melatonin was found to exert its anticancer activity through various biological processes including chemosensitivity, reduced drug resistance and anti-proliferative effects in ovarian, breast, prostate, oral, gastric and colorectal cancers (810). The detailed mechanisms underlying these effects and its antitumor activity remain poorly defined. Epithelial-to-mesenchymal transition (EMT) leads to cytological changes whereby tumor cells become more invasive during metastasis and progression. According to Menéndez-Menéndez et al (11), the antitumor effects of melatonin on cell survival, invasion and the metastasis of breast cancer cells occur through EMT regulation, as shown by the increased levels of E-cadherin and loss of vimentin, Snail in cancer stem cells (CSCs) (12). Research has demonstrated that EMT transcription factors are key to OA development (13). Here, we used TGF-β1-induced EMT in OA cells to confirm the role of melatonin and to explore new methods for OA treatment.

Materials and methods

Reagents

Melatonin, trypsin, MTT and Triton X-100 were purchased from Sigma Chemical Co./Merck KGaA. Dulbecco's modified Eagle's medium (DMEM), penicillin-streptomycin and fetal bovine serum (FBS) were purchased from Gibco Laboratories (Thermo Fisher Scientific, Inc.); TGF-β1 was purchased from (R&D); YC-1 (cat. no. sc-202856) was purchased from Santa Cruz Biotechnology, Inc. Antibodies against MMP-9 (cat. no. sc-13520), E-cadherin (cat. no. sc-52327), N-cadherin (cat. no. sc-8424), vimentin (cat. no. sc-53464), Snail (cat. no. sc-10437), β-actin (cat. no. sc-69879) and HIF-1α (cat. no. sc-53546) were purchased from Santa Cruz Biotechnology, Inc. The ECL kit was purchased from Pierce/Thermo Fisher Scientific, Inc. RIPA buffer and the BCA protein assay kit were purchased from Beyotime. PVDF membranes were purchased from Millipore. All reagents used were trace element analysis grade. All water used was glass distilled.

Cell culture

OS MG-63 cells were purchased from the Shanghai Cell Bank (Shanghai, China). The cells were treated with DMEM containing 10% FBS and 1% penicillin/streptomycin at 37°C in 5% CO2 with 95% humidity. Cells were passaged at ~80% confluency.

Cell viability assays

MG-63 cells were seeded into 96-well plates at a density of 2×104 cells/well and exposed to 0–1,000 nmol/l) melatonin for 24 h. MTT reagent (10 µl) was added to each well and incubated for 4 h at 37°C. Reaction products were extracted with DMSO (150 µl) and absorbances were recorded at ~450 nm on a microplate reader (Bio-Rad Laboratories, Inc.).

Western blot analysis

MG-63 cells were lysed in RIPA buffer and BCA assays performed. Proteins (10 µg) were resolved by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked in 5% milk in TBS (containing 0.5% Tween-20) and probed with primary antibodies at 4°C overnight. The antibodies included: Anti-β-actin (dilution 1:400), anti-HIF-1α (dilution 1:400), anti-E-cadherin (dilution 1:400), anti-N-cadherin (dilution 1:400), anti-vimentin (dilution 1:400), anti-Snail (dilution 1:400), and anti-MMP-9 (dilution 1:400). After washing three times with TBS/0.1% Tween 20, the membranes were labeled with HRP-conjugated secondary antibodies (cat. no. sc-2030; dilution 1:1,000; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. Immunoreactive bands were visualized using ECL. The intensity of the bands was quantified using Image Lab software (version 2.1, Bio-Rad Laboratories, Inc.). All blots were representative of three independent experiments.

Immunofluorescence

MG-63 cells were fixed in 4% paraformaldehyde, permeabilized in 0.2% Triton X-100 for 5 min and blocked in 10% AB-serum in 1% bovine serum albumin (BSA) for 30 min. Cells were then washed and stained with anti-E-cadherin primary antibodies (dilution 1:400) for 2 h at 37°C and incubated with TRITC-conjugated fluorescent secondary antibodies (cat. no. BA1089; dilution 1:100) for 30 min at room temperature. Nuclei were stained with Hoechst 33342 for 10 min and cell morphology was examined under an optical microscopy (magnification, ×400; Olympus Corporation).

Transient transfections of Snail cDNA

Snail was cloned into pcDNA3.1 (Genechem Co.) and transiently transfected into MG-63 cells using Lipofectamine 2000 (Invitrogen/Thermo Fisher Scientific, Inc.). Cells were harvested 48 h post-transfection.

RT-PCR

Total RNA was extracted using TRIzol (Invitrogen/Thermo Fisher Scientific, Inc.) and reverse transcribed using SYBR PrimeScript RT-PCR kits (Takara Inc.) according to the manufacturer's protocol. cDNAs were amplified by polymerase chain reaction (PCR) using the primers shown in Table I. PCR reactions were performed using a Gene Amp PCR system 9700 (PerkinElmer). Amplified products were electrophoresed on 2% agarose gels and visualized by ethidium bromide staining. Images were quantified using FluoroImager SI (GE Healthcare). Representative results were shown (n=3).

Table I.

Primer sequences.

Table I.

Primer sequences.

GenesForward primerReverse primer
Snail AAGGCCTTCTCTAGGCCCT CGCAGGTTGGAGCGGTCAG
HIF-1α TTCCTTCTCTTCTCCGCGTG ACTTATCTTTTTCTTGTCGTTCGC
MMP-9 TTGACAGCGACAAGAAGTGG CCCTCAGTGAAGCGGTACAT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG

[i] HIF-1α, hypoxia-inducible factor 1-α; MMP-9, matrix metalloproteinase 9; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Statistical analysis

All statistical analyses were performed using SPSS (version 19.0; IBM Corp.). Data are represented as the mean ± SD. One-way ANOVA test was used for statistical comparisons. If multigroup comparisons were made, then ANOVA was used together with Scheffe post-hoc test (n=5). P<0.05 was considered to indicate a statistically significant difference.

Results

TGF-β1-mediated EMT in MG-63 cells

EMT is key to cancer progression and can be induced by TGF-β (14). MG-63 cells were cultured with TGF-β1 (20 ng/ml) to assess its ability to induce EMT in OA cells (15) through the expression of known EMT markers including E-cadherin, vimentin and N-cadherin by western blot analysis (Fig. 1A) and RT-PCR (Fig. 1B). E-cadherin was downregulated, while N-cadherin and vimentin were significantly induced by TGF-β1 in a time-dependent manner. These data suggested that TGF-β1 triggers EMT in OA cells.

Melatonin suppresses EMT in MG-63 cells

Previous studies have reported that melatonin inhibits tumor invasion through EMT inhibition (16) but its effects on OA cells are unclear. Through MTT assays, no significant changes were observed in cell survival rates for the different concentrations (0, 50, 100, 200, 500 and 1,000 nM) of melatonin (Fig. 2A). In melatonin-containing media, the morphology of the MG-63 cells was unchanged, and no apoptosis occurred (Fig. 2B). In subsequent experiments, 200 nM (intermediate concentration) of melatonin was used which had minimal effect on MG-63 cell survival. However, immunofluorescence and western blot analysis suggested that melatonin partially reversed the loss of E-cadherin expression and increase in N-cadherin and vimentin expression in response to TGF-β1 (Fig. 2C and D). These results show for the first time that melatonin can reverse EMT processes in OA cells.

Melatonin suppresses TGF-β1-mediated EMT through the downregulation of Snail/MMP-9 and HIF-1α

Extensive research indicates that the Snail/MMP-9 signaling plays a vital role in EMT and tumor metastasis (17). To further explore the underlying mechanism of the inhibitory effects of melatonin on TGF-β1-mediated EMT, Snail/MMP-9 signaling were analyzed using western blot analysis. Fig. 3A and B shows that the levels of Snail and MMP-9 were upregulated in response to TGF-β1 in a time-dependent manner. In addition, TGF-β1 activated Snail/MMP-9 signaling while melatonin alone had no effects on Snail/MMP-9 activation. The addition of melatonin to TGF-β1-stimulated cells reversed the activation of Snail/MMP-9 signaling (Fig. 3C and D). Similarly, the effects of melatonin on HIF-1α expression suggested that melatonin attenuated TGF-β1 signaling through HIF-1α (Fig. 3E and F). Snail expression in response to TGF-β1 was markedly downregulated in cells pretreated with melatonin. Taken together, these data indicate that melatonin exerts its inhibitory effects in part by antagonizing Snail/MMP-9 and HIF-1α pathways in OA cells.

Snail overexpression prevents melatonin-mediated EMT suppression in MG-63 cells

The data obtained to this point suggested that Snail/MMP-9 signaling regulates EMT. To further investigate the effects of melatonin on Snail/MMP-9 signaling, Snail was overexpressed in MG-63 cells (Fig. 4A). Snail overexpression was coupled to a marked reduction in E-cadherin and increased expression of vimentin/N-cadherin. The melatonin-mediated suppression of EMT in MG-63 cells was attenuated through Snail overexpression (Fig. 4B). These data further confirmed that melatonin suppresses Snail/MMP-9 signaling to inhibit EMT in OA cells.

HIF-1α inhibition reverses the TGF-β1-induced upregulation of Snail/MMP-9

HIF-1α can induce EMT and metastasis in cancer cells (18). Next, it was ascertained whether a loss of HIF-1α negatively affects the Snail/MMP pathways. As shown in Fig. 5, the HIF-1α inhibitor YC-1 not only downregulated HIF-1α expression, but markedly inhibited the upregulation of Snail and MMP-9 in response to TGF-β1. These data provide evidence that HIF-1α activates Snail/MMP-9 expression and that inhibition of HIF-1α attenuates EMT in MG-63 cells.

Discussion

Previous studies have confirmed that epithelial-to-mesenchymal transition (EMT) is a key stage in the transdifferentiation of epithelial cells and plays a central role in disease progression, wound healing, fibrosis and cancer (19,20). It is generally believed that the EMT phenomenon only occurs in epithelial-derived cells. However, recent studies have shown that certain mesenchymal cells can also alter EMT-related protein and enhance the metastasis process (21,22). Osteosarcoma (OA) is the most common bone malignant tumor of mesenchymal origin. In an OA cell line, the cells were found to regulate EMT-related protein expression and enhance invasion and metastasis, which suggested that EMT is not only the key step in epithelium-derived tumor cells but also in mesenchymal cell-derived OA (23,24). Thus, targeting EMT represents a key therapeutic goal for OA treatment (25). In recent years, melatonin has emerged as a key molecule for the prevention and management of cancer due to its limited cytotoxicity and/or side effects. The roles of melatonin in OA however, remain largely uncharacterized.

Melatonin isolated from the bovine pineal has numerous physiological functions including the control of the circadian rhythm, sleep-wake rhythms, body temperature, neuronal protection and immune activation (2628). Melatonin has strong therapeutic potential for various cancers including prostate, breast and ovarian cancer (29,30). Recent studies have demonstrated that melatonin treatment increases apoptosis in breast cancer cells (31). It has also been reported that in thyroid cancer, melatonin inhibits p65 phosphorylation and subsequent redox stress (32). Melatonin also exerts anticancer effects by indirectly regulating the body's immune system (33). Although an array of mechanisms have been proposed, few studies have evaluated the role of melatonin on EMT. Similarly, the anticancer potential of melatonin on OA cells is undefined.

In the present study, the role of melatonin in inhibiting TGF-β1-mediated EMT was investigated and the signaling pathways involved in this regulation were explored. Our findings suggested that melatonin pretreatment provides effective protection against TGF-β1-mediated EMT as evidenced by the downregulation of N-cadherin and vimentin and the increased expression of E-cadherin in MG-63 cells. The mechanisms of these effects were next explored.

Snail regulates EMT and plays a crucial role in tumor invasion and metastasis (34,35). Naber et al reported that TGF-β is pro-invasive through its activation of transcriptional repressors (including Slug and Snail) thus inducing EMT (36). In this study, it was demonstrated that melatonin inhibits TGF-β1-induced Snail expression in MG-63 cells. Melatonin exerted its inhibitory effects in part by antagonizing Snail/MMP-9 signaling in OA cells. Moreover the overexpression of Snail prevented EMT suppression in response to melatonin. Thus, targeting EMT and inhibiting Snail/MMP-9 signaling represents a promising strategy to prevent metastasis and improve the survival of OA patients.

Melatonin suppresses the viability and angiogenesis of cancer cells through the downregulation of HIF-1α/ROS/VEGF in solid tumors containing abundant blood vessels (37). HIF-1α also serves an important role in EMT processes and tumor metastasis (38). Our results demonstrated that melatonin inhibits HIF-1α expression which is stimulated by TGF-β1 in MG-63 cells. We next studied the effects of HIF-1α on Snail/MMP-9 signaling. YC-1 inhibited TGF-β1-mediated EMT in MG-63 cells through its ability to inhibit HIF-1α signaling. This demonstrated that melatonin inhibits Snail/MMP-9 signaling in response to TGF-β1 via inhibiting HIF-1α expression.

In summary, the present study demonstrated that melatonin attenuates TGF-β1-mediated EMT in MG-63 cells by preventing TGF-β1-induced activation of the Snail/MMP-9 and HIF-1α signaling pathways. These findings provide new insight into the mechanisms by which melatonin prevents the development and invasion of OA. These findings also provide experimental evidence for the development of new strategies for OA treatment.

Acknowledgements

Not applicable.

Funding

The present study was supported in part by a grant from the Inner Mongolia Autonomous Region Natural Science Fund Project (grant nos. 2018MS08145 and 2014MS0812), the Baotou Medical College Natural Science Fund Sailing Project (grant nos. YF201687 and BYJJ-YF201718) and the Baotou Science and Technology Plan Project (grant no. wsjj2017027).

Availability of data and materials

The datasets used and/or anlayzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YC and TZ conceived and designed the study. XL, ZL, DZ, WX and YC performed the experiments. TZ and ZL wrote the paper. YC and WX reviewed and edited the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All experimental protocols were approved by the Institutional Review Board of the Department of Laboratory Animal Science of Baotou Medical College (Baotou, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

OA

osteosarcoma

HIF-1α

hypoxia-inducible factor 1α

MMP-9

matrix metalloproteinase 9

DMEM

Dulbecco's modified Eagle's medium

EMT

epithelial-to-mesenchymal transition

PBS

phosphate-buffered saline

TBS

Tris-buffered saline

TGF

transforming growth factor

FBS

fetal bovine serum

PVDF

polyvinylidene fluoride

DMSO

dimethyl sulfoxide

MTT

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

References

1 

Basu-Roy U, Basilico C and Mansukhani A: Perspectives on cancer stem cells in osteosarcoma. Cancer Lett. 338:158–167. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Marina N, Gebhardt M, Teot L and Gorlick R: Biology and therapeutic advances for pediatric osteosarcoma. Oncologist. 9:422–441. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Hardeland R, Cardinali DP, Srinivasan V, Spence DW, Brown GM and Pandi-Perumal SR: Melatonin-a pleiotropic, orchestrating regulator molecule. Prog Neurobiol. 93:350–384. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Fernández Vázquez G, Reiter RJ and Agil A: Melatonin increases brown adipose tissue mass and function in Zücker diabetic fatty rats: Implications for obesity control. J Pineal Res. 64:e124722018. View Article : Google Scholar : PubMed/NCBI

5 

Karamitri A and Jockers R: Melatonin in type 2 diabetes mellitus and obesity. Nat Rev Endocrinol. 15:105–125. 2019. View Article : Google Scholar : PubMed/NCBI

6 

Haeger P, Bouchet A, Ossandon C and Bresky G: Treatment with melatonin improves cognitive behavior and motor skills in a rat model of liver fibrosis. Ann Hepatol. 18:101–108. 2019. View Article : Google Scholar : PubMed/NCBI

7 

Li Y, Li S, Zhou Y, Meng X, Zhang JJ, Xu DP and Li HB: Melatonin for the prevention and treatment of cancer. Oncotarget. 8:39896–39921. 2017.PubMed/NCBI

8 

Parkin DM: International variation. Oncogene. 23:6329–6340. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Jablonska K, Pula B, Zemla A, Kobierzycki C, Kedzia W, Nowak-Markwitz E, Spaczynski M, Zabel M, Podhorska-Okolow M and Dziegiel P: Expression of the MT1 melatonin receptor in ovarian cancer cells. Int J Mol Sci. 15:23074–23089. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Reiter RJ, Rosales-Corral SA, Tan DX, Acuna-Castroviejo D, Qin L, Yang SF and Xu K: Melatonin, a full service anti-cancer agent: Inhibition of initiation, progression and metastasis. Int J Mol Sci. 18(pii): E8432017. View Article : Google Scholar : PubMed/NCBI

11 

Menéndez-Menéndez J, Hermida-Prado F, Granda-Díaz R, González A, García-Pedrero JM, Del-Río-Ibisate N, González-González A, Cos S, Alonso-González C and Martínez-Campa C: Deciphering the molecular basis of melatonin protective effects on breast cells treated with doxorubicin: TWIST1 a transcription factor involved in EMT and metastasis, a novel target of melatonin. Cancers (Basel). 11(pii): E10112019. View Article : Google Scholar : PubMed/NCBI

12 

Mao L, Dauchy RT, Blask DE, Slakey LM, Xiang S, Yuan L, Dauchy EM, Shan B, Brainard GC, Hanifin JP, et al: Circadian gating of epithelial-to-mesenchymal transition in breast cancer cells via melatonin-regulation of GSK3β. Mol Endocrinol. 26:1808–1820. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Seba V, Silva G, Santos MBD, Baek SJ, França SC, Fachin AL, Regasini LO and Marins M: Chalcone derivatives 4′-amino-1-naphthyl-chalcone (D14) and 4′-amino-4-methyl-1-naphthyl-chalcone (D15) suppress migration and invasion of osteosarcoma cells mediated by p53 regulating EMT-related genes. Int J Mol Sci. 19(pii): E28382018. View Article : Google Scholar : PubMed/NCBI

14 

Suzuki S, Toyoma S, Tsuji T, Kawasaki Y and Yamada T: CD147 mediates transforming growth factor-β1-induced epithelial-mesenchymal transition and cell invasion in squamous cell carcinoma of the tongue. Exp Ther Med. 17:2855–2860. 2019.PubMed/NCBI

15 

Li L, Qi L, Liang Z, Song W, Liu Y, Wang Y, Sun B, Zhang B and Cao W: Transforming growth factor-β1 induces EMT by the transactivation of epidermal growth factor signaling through HA/CD44 in lung and breast cancer cells. Int J Mol Med. 36:113–122. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Gonçalves Ndo N, Colombo J, Lopes JR, Gelaleti GB, Moschetta MG, Sonehara NM, Hellmén E, Zanon Cde F, Oliani SM and Zuccari DA: Effect of melatonin in epithelial mesenchymal transition markers and invasive properties of breast cancer stem cells of canine and human cell lines. PLoS One. 11:e01504072016. View Article : Google Scholar : PubMed/NCBI

17 

Moirangthem A, Bondhopadhyay B, Mukherjee M, Bandyopadhyay A, Mukherjee N, Konar K, Bhattacharya S and Basu A: Simultaneous knockdown of uPA and MMP9 can reduce breast cancer progression by increasing cell-cell adhesion and modulating EMT genes. Sci Rep. 6:219032016. View Article : Google Scholar : PubMed/NCBI

18 

Ha JH, Ward JD, Radhakrishnan R, Jayaraman M, Song YS and Dhanasekaran DN: Lysophosphatidic acid stimulates epithelial to mesenchymal transition marker Slug/Snail2 in ovarian cancer cells via Gαi2, Src, and HIF1α signaling nexus. Oncotarget. 7:37664–37679. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Park JH and Yoon J: Schizandrin inhibits fibrosis and epithelial-mesenchymal transition in transforming growth factor-β1-stimulated AML12 cells. Int Immunopharmacol. 25:276–284. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Amaar YG and Reeves ME: RASSF1C regulates miR-33a and EMT marker gene expression in lung cancer cells. Oncotarget. 10:123–132. 2019. View Article : Google Scholar : PubMed/NCBI

21 

Rubina KA, Surkova EI, Semina EV, Sysoeva VY, Kalinina NI, Poliakov AA, Treshalina HM and Tkachuk VA: T-Cadherin expression in melanoma cells stimulates stromal cell recruitment and invasion by regulating the expression of chemokines, integrins and adhesion molecules. Cancers (Basel). 7:1349–1370. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Huang H, Nie C, Qin X, Zhou J and Zhang L: Diosgenin inhibits the epithelial-mesenchymal transition initiation in osteosarcoma cells via the p38MAPK signaling pathway. Oncol Lett. 18:4278–4287. 2019.PubMed/NCBI

23 

Fan S, Gao X, Chen P and Li X: Carboxypeptidase E-ΔN promotes migration, invasiveness, and epithelial-mesenchymal transition of human osteosarcoma cells via the Wnt-β-catenin pathway. Biochem Cell Biol. 97:446–453. 2019. View Article : Google Scholar : PubMed/NCBI

24 

Zhao H, Peng C, Lu X, Guo M, Yang T, Zhou J and Hai Y: PDCD5 inhibits osteosarcoma cell metastasis via targeting TGF-β1/Smad signaling pathway and is associated with good prognosis. Am J Transl Res. 11:1116–1128. 2019.PubMed/NCBI

25 

Sung JY, Park SY, Kim JH, Kang HG, Yoon JH, Na YS, Kim YN and Park BK: Interferon consensus sequence-binding protein (ICSBP) promotes epithelial-to-mesenchymal transition (EMT)-like phenomena, cell-motility, and invasion via TGF-β signaling in U2OS cells. Cell Death Dis. 5:e12242014. View Article : Google Scholar : PubMed/NCBI

26 

Baba K, Davidson AJ and Tosini G: Melatonin entrains PER2:LUC bioluminescence circadian rhythm in the mouse cornea. Invest Ophthalmol Vis Sci. 56:4753–4758. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Dijk DJ, Duffy JF, Riel E, Shanahan TL and Czeisler CA: Ageing and the circadian and homeostatic regulation of human sleep during forced desynchrony of rest, melatonin and temperature rhythms. J Physiol. 516:611–627. 1999. View Article : Google Scholar : PubMed/NCBI

28 

Jenwitheesuk A, Nopparat C, Mukda S, Wongchitrat P and Govitrapong P: Melatonin regulates aging and neurodegeneration through energy metabolism, epigenetics, autophagy and circadian rhythm pathways. Int J Mol Sci. 15:16848–16884. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Mao L, Summers W, Xiang S, Yuan L, Dauchy RT, Reynolds A, Wren-Dail MA, Pointer D, Frasch T, Blask DE and Hill SM: Melatonin represses metastasis in Her2-postive human breast cancer cells by suppressing RSK2 expression. Mol Cancer Res. 14:1159–1169. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Tai SY, Huang SP, Bao BY and Wu MT: Urinary melatonin-sulfate/cortisol ratio and the presence of prostate cancer: A case-control study. Sci Rep. 6:296062016. View Article : Google Scholar : PubMed/NCBI

31 

Sonehara NM, Lacerda JZ, Jardim-Perassi BV, de Paula Jr R Jr, Moschetta-Pinheiro MG, Souza YST, de Andrade JCJ and De Campos Zuccari DAP: Melatonin regulates tumor aggressiveness under acidosis condition in breast cancer cell lines. Oncol Lett. 17:1635–1645. 2019.PubMed/NCBI

32 

Zou ZW, Liu T, Li Y, Chen P, Peng X, Ma C, Zhang WJ and Li PD: Melatonin suppresses thyroid cancer growth and overcomes radioresistance via inhibition of p65 phosphorylation and induction of ROS. Redox Biol. 16:226–236. 2018. View Article : Google Scholar : PubMed/NCBI

33 

Fic M, Gomulkiewicz A, Grzegrzolka J, Podhorska-Okolow M, Zabel M, Dziegiel P and Jablonska K: The impact of melatonin on colon cancer cells' resistance to doxorubicin in an in vitro study. Int J Mol Sci. 18(pii): E13962017. View Article : Google Scholar : PubMed/NCBI

34 

Kaufhold S and Bonavida B: Central role of Snail1 in the regulation of EMT and resistance in cancer: A target for therapeutic intervention. J Exp Clin Cancer Res. 33:622014. View Article : Google Scholar : PubMed/NCBI

35 

Guo L, Sun C, Xu S, Xu Y, Dong Q, Zhang L, Li W, Wang X, Ying G and Guo F: Knockdown of long non-coding RNA linc-ITGB1 inhibits cancer stemness and epithelial-mesenchymal transition by reducing the expression of Snail in non-small cell lung cancer. Thorac Cancer. 10:128–136. 2019. View Article : Google Scholar : PubMed/NCBI

36 

Naber HP, Drabsch Y, Snaar-Jagalska BE, ten Dijke P and van Laar T: Snail and Slug, key regulators of TGF-β-induced EMT, are sufficient for the induction of single-cell invasion. Biochem Biophys Res Commun. 435:58–63. 2013. View Article : Google Scholar : PubMed/NCBI

37 

Cheng J, Yang HL, Gu CJ, Liu YK, Shao J, Zhu R, He YY, Zhu XY and Li MQ: Melatonin restricts the viability and angiogenesis of vascular endothelial cells by suppressing HIF-1α/ROS/VEGF. Int J Mol Med. 43:945–955. 2019.PubMed/NCBI

38 

Singh SK, Mishra MK and Singh R: Hypoxia-inducible factor-1α induces CX3CR1 expression and promotes the epithelial to mesenchymal transition (EMT) in ovarian cancer cells. J Ovarian Res. 12:422019. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

March-2020
Volume 21 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Chen Y, Zhang T, Liu X, Li Z, Zhou D and Xu W: Melatonin suppresses epithelial‑to‑mesenchymal transition in the MG‑63 cell line. Mol Med Rep 21: 1356-1364, 2020.
APA
Chen, Y., Zhang, T., Liu, X., Li, Z., Zhou, D., & Xu, W. (2020). Melatonin suppresses epithelial‑to‑mesenchymal transition in the MG‑63 cell line. Molecular Medicine Reports, 21, 1356-1364. https://doi.org/10.3892/mmr.2019.10902
MLA
Chen, Y., Zhang, T., Liu, X., Li, Z., Zhou, D., Xu, W."Melatonin suppresses epithelial‑to‑mesenchymal transition in the MG‑63 cell line". Molecular Medicine Reports 21.3 (2020): 1356-1364.
Chicago
Chen, Y., Zhang, T., Liu, X., Li, Z., Zhou, D., Xu, W."Melatonin suppresses epithelial‑to‑mesenchymal transition in the MG‑63 cell line". Molecular Medicine Reports 21, no. 3 (2020): 1356-1364. https://doi.org/10.3892/mmr.2019.10902