Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 22 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis

  • Authors:
    • Yucong Xue
    • Mengying Li
    • Yurun Xue
    • Weiyue Jin
    • Xue Han
    • Jianping Zhang
    • Xi Chu
    • Ziliang Li
    • Li Chu
  • View Affiliations / Copyright

    Affiliations: School of Pharmacy, Hebei University of Chinese Medicine, Shijiazhuang, Hebei 050200, P.R. China, School of Basic Medicine, Hebei University of Chinese Medicine, Shijiazhuang, Hebei 050200, P.R. China, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, P.R. China
    Copyright: © Xue et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 4663-4674
    |
    Published online on: October 11, 2020
       https://doi.org/10.3892/mmr.2020.11586
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Arsenic trioxide (ATO) is a frontline chemotherapy drug used in the therapy of acute promyelocytic leukemia. However, the clinical use of ATO is hindered by its cardiotoxicity. The present study aimed to observe the potential effects and underlying mechanisms of tannic acid (TA) against ATO‑induced cardiotoxicity. Male rats were intraperitoneally injected with ATO (5 mg/kg/day) to induce cardiotoxicity. TA (20 and 40 mg/kg/day) was administered to evaluate its cardioprotective efficacy against ATO‑induced heart injury in rats. Administration of ATO resulted in pathological damage in the heart and increased oxidative stress as well as levels of serum cardiac biomarkers creatine kinase and lactate dehydrogenase and the inflammatory marker NF‑κB (p65). Conversely, TA markedly reversed this phenomenon. Additionally, TA treatment caused a notable decrease in the expression levels of cleaved caspase‑3/caspase‑3, Bax, p53 and Bad, while increasing Bcl‑2 expression levels. Notably, the application of TA decreased the expression levels of cytochrome c, second mitochondria‑derived activator of caspases and high‑temperature requirement A2, which are apoptosis mitochondrial‑associated proteins. The present findings indicated that TA protected against ATO‑induced cardiotoxicity, which may be associated with oxidative stress, inflammation and mitochondrial apoptosis.

Introduction

Arsenic, a naturally prevalent element, is found in the environment and certain foods. Arsenic has two forms in the environment: Organic and inorganic. Inorganic arsenic has two valences: Arsenite (III) and arsenate (V) (1). Generally, inorganic arsenic is more toxic than organic arsenic, and trivalent arsenic is more toxic than pentavalent arsenic (2). Arsenic trioxide (ATO) is the primary effective ingredient of white arsenic, which is inorganic arsenic. It has been used in the therapy of acute promyelocytic leukemia since the early 1990s. ATO is a safe and effective anticancer drug and is not prone to drug resistance (3). Researchers have attempted to use ATO in the treatment of other types of tumor: ATO has also been reported to achieve a favorable therapeutic effect in the treatment of malignant tumors such as lymphoma, gastric (4), esophageal (5), liver and lung cancer, neuroblastoma (6) and breast cancer (7).

However, in the treatment of solid tumors, high concentrations of ATO can cause serious side effects, such as cardiotoxicity (8), hepatotoxicity (9), fluid retention (10), alimentary symptoms (11) and rash (12). ATO induces serious cardiotoxicity and potential cardiovascular side effects, including sudden death due to acute toxic myocardial damage (13,14). ATO also has a toxic effect on the liver, kidney and nervous system (15–17). These factors limit the clinical application of ATO. Potential mechanisms of ATO-induced cardiotoxicity include oxidative stress, mitochondrial DNA injury, apoptosis and functional disruption of ion channels (18). Several studies have indicated that mitochondrial damage, caspase activation and p53 signaling are the pathways underlying arsenic-induced apoptosis (1,18).

Mitochondria, intracellular double membrane organelles, are considered the ‘power plant’ of eukaryotic cells (19). Mitochondria are the primary site of intracellular oxidative phosphorylation and synthesis of adenosine triphosphate, which provides energy for cell activity (20). Mitochondria also participate in cell signaling, differentiation, proliferation and apoptosis (21). The heart, the most energy consuming organ, has the highest content of mitochondria of all types of tissue (22). The heart requires efficient oxidative metabolism and derives almost all of its energy from mitochondrial oxidative phosphorylation (23). Therefore, mitochondria are important for myocardial development as well as healthy function. Beyond their role as a cellular powerhouse, mitochondria produce reactive oxygen species (ROS) (24), which lead to oxidative injury and regulate cardiomyocyte apoptosis. Hence, mitochondrial dysfunction and ROS production are considered key factors in cardiac disease. Creatine kinase (CK) and lactate dehydrogenase (LDH) are vital biomarkers for the diagnosis of myocardial injury (25). Studies have shown that ATO increases LDH content and consequently results in cardiomyocyte necrosis (26,27).

There are two major antioxidant systems in the body: The enzyme antioxidant system [involving superoxide dismutase (SOD) and catalase (CAT)] and the non-enzyme antioxidant system (involving vitamins C and E, glutathione, carotenoid, copper and zinc) (28). When oxidative stress occurs, these two systems are out of balance, which leads to tissue damage (29). Studies have shown that excessive ROS during ATO treatment leads to destruction in the endogenous antioxidant system (30,31). In addition, studies have suggested that high doses of ATO can cause oxidative stress, increased ROS and inhibit enzyme and mitochondrial activity (32,33). Mitochondrial impairment leads to the release of mitochondrial-associated proteins cytochrome c, second mitochondria-derived activator of caspases (Smac) and high-temperature requirement A2 (HtrA2); the release of cytochrome c can activate caspase-3 (34). Moreover, the Bcl-2 family, which serves a crucial role in the regulation of cardiomyocyte apoptosis, is a primary regulator of cytochrome c release and caspase-3 activation (34). Arsenic exposure increases the levels of pro-apoptotic proteins Bax (35) and Bad (36) and decreases the expression levels of anti-apoptotic protein Bcl-2 (37). Furthermore, one study reported that arsenic exposure activates phosphorylation of the NF-κB pathway (36). The NF-κB pathway participates in the inflammatory response, which results in apoptosis (38). Thus, we hypothesized that the potential mechanism of ATO-induced cardiotoxicity may be associated with oxidative stress, inflammation and mitochondrial apoptosis.

Tannic acid (TA) is found in plants and foods, such as apples, pears, beans, tea and red wine. TA is a water-soluble polyphenol compound with a complex chemical structure (C76H52O46; Fig. 1), containing a glucose core covalently linked to 3–5 gallic acid residues through the hydrolysis of ester bonds (39). TA has been revealed to exert antioxidant, anti-inflammatory, anticarcinogenic, antimutagenic and antiatherogenic properties (40). It is also capable of protecting against drug toxicity (41).

Figure 1.

Structure of tannic acid.

Our previous studies have indicated that TA has beneficial effects on cardiovascular disease (42–44); moreover, we found that TA ameliorates ATO-induced nephrotoxicity (45). However, the effects of TA on ATO-induced cardiotoxicity have not yet been reported. The aim of the present study was to evaluate whether TA can protect against ATO-induced heart injury in rats.

Materials and methods

Chemicals and materials

TA (>98% purity) was acquired from Sigma-Aldrich (Merck KGaA). ATO was purchased from Beijing SL Pharmaceutical Co., Ltd. Kits for determining total CK and LDH, as well as catalase (CAT), malondialdehyde (MDA) and superoxide dismutase (SOD) activity were obtained from Nanjing Jiancheng Bioengineering Institute. All solvents were analytical grade and commercially available.

Animals and experimental protocol

A total of 50 adult male Sprague-Dawley rats (age, 6–8 weeks; weight, 180–220 g) were obtained from Hebei Medical University. Male rats were raised under standard conditions (22-25°C and 45–55% relative humidity with a 12-h light/dark cycle), with ad libitum access to pellet food and water. Animal experiments were performed in accordance with the Animal Care and Ethics Committee of Hebei University of Chinese Medicine (Shijiazhuang, China). The Animal Care and Ethics Committee of Hebei University of Chinese Medicine approved all animal protocols (approval no. DWLL2018038).

Male rats were stochastically separated into five groups: i) Control (Control, 0.1 ml/kg/day); ii) ATO-alone (ATO, 5 mg/kg/day); iii) ATO + low-dose TA (ATO + L-TA, 20 mg/kg/day); iv) ATO + high-dose TA (ATO + H-TA, 40 mg/kg/day); and v) TA-alone (TA, 40 mg/kg/day). Rats were intraperitoneally (i.p.) injected with ATO (5 mg/kg) to establish an ATO-induced cardiotoxicity model. Dose selection was determined according to previous literature (46,47). Studies have reported that the median lethal dose of ATO is 14.98 mg/kg body weight in rats (48,49). The Control group received isovolumic normal saline. The ATO + L-TA and ATO + H-TA groups underwent intragastric administration of TA (20 and 40 mg/kg/day, respectively) every morning and were intraperitoneally injected with ATO (5 mg/kg/day) every afternoon (40,42,45). After 7 days, sodium pentobarbital (40 mg/kg, i.p.; Sigma-Aldrich; Merck KGaA) was used to anesthetize rats, and the heart was removed and measured.

Histopathological examination

Cardiac specimens were fixed in 4% paraformaldehyde at room temperature for 48 h. Following fixation, all paraffin-embedded samples were sectioned at 4 µm and stained at room temperature with 0.1% hematoxylin (Hebei Bohai Biological Engineering Development Co., Ltd.) for 5 min and 0.5% eosin for 3 min (50). Finally, pathological changes in myocardial tissue structure were examined under a light microscope at ×400 magnification (Leica DM4000B; Leica Microsystems GmbH).

Measurement of cardiac marker enzymes

Rat serum was separated by centrifugation at 1,500 × g for 10 min at 4°C and the activity of CK and LDH were detected using CK (cat. no. A032) and LDH (cat. no. A020-1) assay kits (both Nanjing Jiancheng Bioengineering Institute), respectively. For CK assay, serum samples (20 µl) and mixed reagent were added into tubes according to the manufacturer's protocol, then vortex mixed and incubated at 37°C for 20 min. Then, R6 solution from the kit was added and the mixed solution was centrifuged at 3,500 × g for 10 min at room temperature. Next, the tubes were heated in a water bath at 45°C for 15 min and the absorbance was detected at 660 nm using a microplate reader (Varioskan LUX; Thermo Fisher Scientific, Inc.). The activity of CK was calculated according to the formula provided in the manufacturer's protocol.

For the LDH assay, serum samples (20 µl; 1:50), buffer solution and coenzyme I solution were added into tubes, vortex mixed and incubated at 37°C for 15 min, according to the manufacturer's protocol. Then, 2,4-dinitrophenylhydrazine solution was added before being vortex mixed and incubated at 37°C for 15 min. Next, NaOH solution was added and incubated at room temperature for 3 min, and the absorbance was detected at 440 nm using a microplate reader (as aforementioned). The amount of LDH was assessed by measuring the levels of pyruvic acid.

Measurement of ROS

The fluorescent probe dihydroethidine (DHE) was used to measure the content of ROS in fresh heart tissue samples using an ROS detection kit (cat. no. KGAF019; Nanjing KeyGen Biotech Co., Ltd.). The specimens were embedded at optimum cutting temperature and flash-frozen in liquid nitrogen and sectioned (thickness, 5 µm) using a freezing microtome (Leica CM1950; Leica Microsystems GmbH). Then, 50 µM DHE solution was added, and sections were incubated at room temperature in a darkened incubator for 30 min. Next, sections were washed three times with PBS (5 min/wash). Finally, the sections were sealed using a water-soluble encapsulant and examined using a fluorescence microscope at ×200 magnification (Leica DM4000B; Leica Microsystems GmbH). The stained area of ROS was quantitatively analyzed using Image Pro Plus 6.0 software (Media Cybernetics, Inc.).

Measurement of serum levels of SOD, CAT and MDA

Rat serum was separated by centrifugation at 1,500 × g for 10 min at 4°C and the serum levels of SOD, CAT and MDA were detected using assay kits (cat. nos. A001-3, A007-1 and A003-1, respectively; all Nanjing Jiancheng Bioengineering Institute). According to the manufacturer's instruction, serum samples and relevant solutions of the SOD assay kit were mixed and incubated at 37°C for 20 min, then the absorbance was measured at 450 nm using a microplate reader (as aforementioned). The activity of SOD was calculated as U/ml. Similarly, the activity of CAT and MDA were analyzed following the manufacturer's instructions. The absorbance of CAT at 405 nm and the absorbance of MDA at 532 nm were measured using a microplate reader (as aforementioned). The activity of CAT was calculated as U/ml and the contents of MDA were calculated as nmol/ml.

Immunohistochemistry

Tissue sections were subjected to conventional dewaxing to water, rehydrated in a descending series of ethanol (100, 95, 90 and 80%), and then incubated with 3% H2O2 for 20 min at 37°C. Sections were incubated overnight at 4°C with primary antibodies against Bax protein (1:80; cat. no. 50599-2-Ig), cytochrome c (1:70; cat. no. 10993-1-AP), HtrA2 (1:80; cat. no. 15775-1-AP) and Smac (1:70; cat. no. 10434-1-AP) (all ProteinTech Group, Inc.). Next, sections were washed three times using PBS solution. The sections were incubated with horseradish peroxidase-conjugated secondary antibody (1:2,000, cat. no. PV-6001; OriGene Technologies, Inc.) for 20 min at room temperature, and then stained using the 3,3′diaminobenzidine (DAB) substrate kit (cat. no. ZLI-9019; OriGene Technologies, Inc.). Color development was induced with 0.5% DAB for 20 min at room temperature. Lastly, the heart tissue samples were re-stained with 0.5% hematoxylin for 2 min at room temperature and observed under a light microscope (magnification, ×400). Protein expression levels were measured using Image Pro Plus 6.0 software (Media Cybernetics, Inc.).

Western blotting

Frozen samples were weighed separately and homogenized in RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.), then lysed overnight at 4°C. The heart tissue samples were centrifuged at 12,000 × g for 10 min at 4°C, then supernatant (total protein extract) was transferred to an EP tube and the protein level was quantified via the bicinchoninic acid method. Then, the protein samples (50 µg) were transferred onto PVDF membranes using 10% SDS-PAGE gels (EMD Millipore). The membranes were gently removed and placed in a TBST blocking buffer (5% skimmed milk in TBS-0.1% Tween-20) for 2 h at 37°C. Next, the proteins were incubated with anti-NF-κB (p65) (1:2,000; cat. no. 10745-1-AP; ProteinTech Group, Inc.), anti-caspase 3 (1:600; cat. no. 19677-1-AP; ProteinTech Group, Inc.), anti-cleaved caspase-3 (1:800; cat. no. AF7022; Affinity Biosciences), anti-Bcl-2 (1:600; cat. no. 26593-1-AP; ProteinTech Group, Inc.) and anti-β-actin (1:1,000; cat. no. TA-09; OriGene Technologies, Inc.) overnight at 4°C. Then, proteins were incubated with the horseradish peroxidase-labeled secondary antibody (1:3,000; cat. no. ZB-2301; OriGene Technologies, Inc.) for 90 min at room temperature. Membranes were washed three times and proteins were visualized using the ECL Detection system (TransGen Biotech Co., Ltd.). After scanning the film with a Tanon1600, the gray value of the band was measured by Tanon Gis 1D software (Tanon Science and Technology Co., Ltd.).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from heart tissue samples using TRIzol (cat. no. 15596-026; Invitrogen; Thermo Fisher Scientific, Inc.). RT was performed with TIANScript RT kit (cat. no. KR104-02; Tiangen Biotech Co., Ltd.) according to the manufacturer's instructions. The gene expression levels of p53 and Bad in heart tissue were assessed via RT-qPCR using SYBR Green (cat. no. FP205; Tiangen Biotech Co., Ltd.). β-actin was used as the internal control. The PCR thermocycling conditions were: Initial denaturation (95°C for 15 min), then 40 cycles of denaturation (95°C for 10 sec), annealing (58°C for 30 sec) and extension (72°C for 30 sec). The data was analyzed with the 2−ΔΔCq method (51). The primers used are listed in Table I.

Table I.

Primer sequences of p53, Bad and β-actin.

Table I.

Primer sequences of p53, Bad and β-actin.

GenePrimer sequence (5′→3′)Fragment size, bp
p53Forward: CCCCAGGATGTTGCAGAGTTG150
Reverse: TTGAGAAGGGACGGAAGATGAC
BadForward: GAGTCGCCACAGTTCGTACC156
Reverse: TCAAATTCATCGCTCATTCTTC
β-actinForward: CCTAGACTTCGAGCAAGAGA140
Reverse: GGAAGGAAGGCTGGAAGA
Data analysis

Data are presented as the mean ± SEM of three independent repeats. Statistical comparisons between groups were measured using one-way ANOVA followed by Bonferroni's test. The Bonferroni correction was used as a post hoc test to eliminate false positives in multiple comparisons. Origin 7.5 (OriginLab) and SPSS 15.0 (SPSS, Inc.) statistical analysis software were used. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of TA on heart histopathology

Histological changes of rat heart samples were investigated by H&E staining. Heart tissue exhibited a normal myocardium structure and regular myocardial cell distribution in the Control group (Fig. 2). However, in the ATO group, notable myocardial tissue injury, disordered arrangement of cardiomyocytes, cell nucleus pyknosis and degeneration, increased eosinophils and focal inflammatory cell infiltration were observed. The ATO + L-TA and ATO + H-TA groups retained an almost normal myocardial tissue structure (myocardial cells arranged closely, rich cytoplasm, regular nucleus and normal cardiac muscle bundles). In addition, there was no difference in myocardial structure between the TA and Control groups.

Figure 2.

Effects of TA on cardiac histopathology. Representative sections were obtained from the myocardial tissue of Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Magnification, ×400; scale bar, 50 µm. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on cardiotoxicity indices

CK and LDH levels in the ATO group were significantly improved compared with the Control group (Fig. 3), revealing that the experimental model was successfully established. The CK and LDH levels in the ATO + L-TA and ATO + H-TA groups were significantly decreased compared with the ATO group.

Figure 3.

Effects of TA on the activity of CK and LDH. Activity of (A) CK and (B) LDH was measured in serum using commercial detection kits. Serum was collected from the Control, ATO, ATO + L-TA, ATO + H-TA, and TA groups. Data are presented as the mean ± SEM (n=6). **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. CK, creatine kinase; LDH, lactate dehydrogenase; TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on oxidative stress markers

Fluorescence intensity was significantly enhanced in the ATO group, suggesting that the level of ROS was higher in the heart tissue compared with the Control group (Fig. 4). Following TA treatment, fluorescence intensity significantly weakened. These results indicated that TA protection against ATO-induced heart damage may be associated with decreasing oxidative stress and ROS production.

Figure 4.

Effects of TA on the level of ROS in myocardial tissue. Production of ROS was measured in heart tissues with a dihydroethidium probe. The fluorescence intensity and ROS levels area percentages are shown. Magnification, ×200; scale bar, 100 µm. **P<0.05 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; ROS, reactive oxygen species; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on levels of SOD, CAT, and MDA

Serum analysis revealed that SOD (Fig. 5A) and CAT (Fig. 5B) levels in the ATO group were significantly decreased compared with the Control group. Compared with the ATO group, SOD and CAT activity were increased in the ATO + L-TA and ATO + H-TA groups. Moreover, MDA (Fig. 5C) levels increased following ATO exposure compared with the Control group. Following, TA administration, the levels of MDA were lower in the ATO + L-TA and ATO + H-TA groups.

Figure 5.

Effects of TA on SOD, CAT activities and MDA content in serum. Levels of (A) SOD, (B) CAT and (C) MDA were evaluated in rat heart serum using commercial detection kits. Data are presented as the mean ± SEM (n=6). *P<0.05 and **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on cytochrome c, Smac, HtrA2 and Bax expression levels

Immunohistochemistry was used to measure the expression levels of cytochrome c, Smac, HtrA2 and Bax in the heart tissue samples. Cytochrome c, Smac, HtrA2 and Bax expression levels were significantly increased in the ATO group compared with the Control (Fig. 6). Administration of 20 or 40 mg/kg/day TA decreased the expression levels of cytochrome c, Smac, HtrA2 and Bax, indicating that the cardiac protection of TA is a result of its anti-mitochondrial apoptosis effect.

Figure 6.

Effects of TA on the expression levels of cytochrome c, Smac, HtrA2 and Bax. Morphological orientation of the expression levels of (A) cytochrome c, (B) Smac, (C) HtrA2 and (D) Bax in myocardial tissue, as measured by immunohistochemistry. Magnification, ×200; scale bar, 50 µm. Area percentage content of (E) cytochrome c, (F) Smac, (G) HtrA2 and (H) Bax was calculated in the Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Data are presented as the mean ± SEM (n=6). **P<0.01 vs. Control; ##P<0.01 vs. ATO. Smac, second mitochondria-derived activator of caspases; HtrA2, high-temperature requirement A2; TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on the expression levels of caspase-3, cleaved caspase-3, Bcl-2 and NF-κB (p65)

Expression levels of caspase-3, cleaved caspase-3 and NF-κB (p65) were markedly increased in the ATO group (Fig. 7A and E). However, the expression levels of Bcl-2 significantly decreased (Fig. 7C). The ratio of cleaved caspase-3/caspase-3 and NF-κB (p65) was significantly upregulated in the ATO group compared with the Control (Fig. 7B and F). However, compared with the Control group, the Bcl-2 (Fig. 7D) expression levels were significantly lower in the ATO group. Following TA treatment, the ratio of cleaved caspase-3/caspase-3 was significantly decreased, and the expression levels of NF-κB (p65) were downregulated, whereas Bcl-2 expression levels were significantly increased.

Figure 7.

Effects of TA on caspase-3, cleaved caspase-3, Bcl-2 and NF-κB (p65) expression levels in rat heart. (A) Protein expression levels of caspase-3 and cleaved caspase-3 were measured by western blot analysis and (B) intensity was normalized to β-actin. (C) Protein expression levels of Bcl-2 were measured by western blot analysis and (D) intensity was normalized to β-actin. (E) Protein expression levels of NF-κB (p65) were measured by western blot analysis and (F) intensity of was normalized to β-actin. Data are presented as the mean ± SEM (n=3). *P<0.05 and **P<0.01 vs. Control; #P<0.05 and ##P<0.01 vs. ATO. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Effects of TA on the expression levels of p53 and Bad

The expression levels of p53 and Bad in the ATO group were significantly increased compared with the Control group (Fig. 8). Subsequent TA administration caused a significant decrease in p53 and Bad expression levels.

Figure 8.

Effects of TA on p53 and Bad expression levels. Gene expression levels of (A) p53 and (B) Bad were examined by reverse transcription-quantitative PCR. Cardiac samples were obtained from the Control, ATO, ATO + L-TA, ATO + H-TA and TA groups. Data are presented as the mean ± SEM (n=3). *P<0.05 and **P<0.01 vs. Control; ##P<0.01 vs. ATO. TA, tannic acid; ATO, arsenic trioxide; L, low dose; H, high dose.

Discussion

There are an increasing number of studies on the cardiotoxicity of ATO, which limits its wide clinical application (13,14). The present study established a cardiotoxicity model in rats by intraperitoneal injection with ATO (5 mg/kg). In addition, high-dose TA-alone was administered to evaluate whether it has a toxic effect on the heart. The results demonstrated that the cardiotoxicity induced by ATO was primarily characterized by histopathological changes. In the ATO group, myocardial cells were swollen, the cytoplasm exhibited vacuolation and myocardial fiber was abnormal (swelling of myocardial fiber, interstitial oedema and myofibrillar loss. Serum increase of CK and LDH enzymes was also detected. These findings demonstrated that ATO had a toxic effect on the myocardium. Administration of TA significantly ameliorated ATO-induced pathological changes in myocardial tissue. In addition, there was no difference in myocardial structure between the TA and Control groups. Compared with the Control group, the levels of CK and LDH in the TA group were not significantly different. These results indicated that high-dose TA alone hardly induced cardiotoxicity.

Candidate mechanisms for the cardiotoxicity induced by ATO include changes of cardiac ion channels, oxidative stress injury and cardiomyocyte apoptosis (51). Compared with other cells, cardiomyocytes are more susceptible to oxidative stress due to weak antioxidant defenses (52) and enrichment of mitochondria (30).

Oxidative stress is considered to be an imbalance between generation of ROS and the activity of antioxidant defenses. Oxidative stress is a negative consequence of the in vivo production of radicals, and it is considered to be an important factor leading to apoptosis (34). Multiple studies have reported that high a concentration of arsenic can cause oxidative stress and increase ROS (53,54). Excessive ROS cause injury to numerous types of macromolecules, including DNA, lipid and protein (34,55). ROS alters cell signaling processes, such as gene expression level changes, transcription factor activation and apoptosis (56). ATO has a high affinity with sulfhydryl groups (57). ATO can penetrate the cell membrane and reach the cytoplasm via diffusion, resulting in cytotoxicity by increasing ROS (58). ROS are eliminated by the catalytic deactivation of SOD and CAT in vivo. Therefore, these enzymes can protect the body from radicals (59). In myocardial cells, the electron transport chain, situated in the internal membrane of the mitochondria, is the primary source of ROS (60). Myocardial cells provide energy essential for cellular survival and function. In addition, CK and LDH serve important roles in energy metabolism in vivo. CK and LDH are also important parameters for the diagnosis of myocardial injury (25). In the present study, following ATO administration, CAT and SOD activity markedly decreased, and the MDA levels markedly increased in serum. This result suggested that the cardiotoxicity of ATO was associated with oxidative stress injury and that TA significantly improved this phenomenon.

Mitochondria have long been considered to serve a considerable role in cell growth. However, the important function of mitochondria in programmed cell death was not recognized until the mid-1990s (61). Mitochondria are not only an important site generating cellular energy, but also the primary source of ROS and free radicals (23). Concurrently, the mitochondria are the target of multiple apoptotic signals, which contribute to apoptosis (62). Studies have shown that polyphenols affect mitochondrial function and structure by modulating biosynthesis (mitogenesis), dynamics (fission, fusion), transport and autophagic cleavage of damaged mitochondria (mitophagy) (63,64). Wang et al (65) revealed that curcumin downregulated PI3K/AKT/mTOR and mTOR/p70S6K signaling pathways and activated autophagy, thus demonstrating neuroprotection in APP/presenilin 1 double transgenic mice. Apoptosis or programmed death is the mechanism of cell evolutionary conservation, which selectively removes aged, damaged and other unnecessary cells. This is a crucial part of numerous normal physiological processes, such as embryonic development, normal tissue growth and immunoreaction (66). Apoptosis is mediated by caspase activation (67). Caspase is the effector of apoptosis; it can bind to multiple types of substrate, resulting in specific biochemical and morphological changes in apoptotic cells, including changes in mitochondrial membrane permeability, cytoskeleton reorganization, exposure of phosphatidylserine and DNA fragmentation (68). Endogenous apoptosis is caused by mitochondrial activation of oxidative stress. Certain mitochondrial proteins, such as pro-apoptotic factor, cytochrome c apoptosis-inducing factor, Smac, HtrA2 and endonuclease G, serve a regulatory role in apoptosis (63). The first released proteins are cytochrome c, Htr2A and Smac in the mitochondrial apoptosis pathway, and cytochrome c, released into the cytoplasm, is combined with apoptotic protease-activating factor to form associated apoptotic bodies. This promotes the self-activation of the caspase-9 precursor, then initiates the caspase-3 precursor and cleaves caspase-3, resulting in apoptosis (69). In the present study, the ratio of cleaved caspase-3/caspase-3 was increased, which suggested activation of the caspase apoptosis pathway. Moreover, Du et al (70) revealed that Smac/DIABLO enhances cytochrome c-mediated caspase-3 activity. The present results demonstrated an increase in expression levels of cytochrome c, Smac and Htr2A, as well as the ratio of cleaved caspase-3/caspase-3, in the ATO group, confirming that ATO induced apoptotic events. The present study showed that TA treatment markedly downregulated the expression levels of the aforementioned apoptosis-associated genes and decreased the number of apoptotic cells in the ATO + L-TA and ATO + H-TA groups. In addition, the TA group exhibited no significant difference in these protein expression levels.

Bcl-2 family proteins include anti-apoptotic genes Bcl-2 and apoptosis stimulating proteins, such as Bad and Bax (71). These regulate the release of cytochrome c and the activation of caspase-3, which play an essential role in the control of mitochondrial apoptosis (72). The p53 protein is a tumor suppressor and serves a crucial role in the regulation of mitochondrial apoptosis, cell cycle and senescence (69). p53 signaling activates the transcription of Bad and Bax (73,74) and suppresses the transcription of Bcl-2 (75,76). A previous study demonstrated that low levels of p53 contribute to maintaining mitochondrial activity and function (77). Additionally, studies have reported that arsenic exposure causes the phosphorylation of the NF-κB (p65) pathway (36,78). Activation of the NF-κB pathway triggers an inflammatory response, which induces apoptosis. NF-κB exhibits pro-inflammatory properties (79), and apoptosis is an indispensable mechanism that inhibits prolonged inflammation (80). In accordance with published studies, we observed that ATO exposure increased the expression levels of p53 protein, Bax, Bad and NF-κB (p65) and decreased those of Bcl-2 in rat heart. These results demonstrated that ATO induced myocardial apoptosis via mitochondria dysfunction and inflammation. Furthermore, following administration of TA, the expression levels of p53 protein, Bax, Bad and NF-κB (p65) were suppressed and Bcl-2 protein expression levels were promoted.

Based on the findings obtained from the present study, we hypothesize that the beneficial protective effect of TA may be achieved via ameliorating ATO-induced injury of cardiomyocytes and inhibiting the release of cardiac marker enzymes from the myocardium. In the present study, TA significantly improved ATO-induced oxidative stress injury and mitochondrial function due to ROS scavenging properties. As such, TA ameliorates ATO-induced cardiomyocyte apoptosis via decreasing the release of mitochondrial-associated proteins cytochrome c, Smac and Htr2A and inhibition of caspase-3 activation. In addition, the present study indicated that TA plays an anti-inflammatory role by inhibiting the activation of the NF-κB pathway; similarly, TA has a significant suppression of ATO-induced activation of the p53 pathway resulting in decreased release of Bax and increasing the release of Bcl-2. This protected the cardiomyocytes from ATO-induced cell death.

The present study investigated the potential effects and mechanisms of TA against ATO-induced cardiotoxicity. It has recently been reported that combination of TA and antitumor agent cisplatin may exert synergistic anticancer effects and may be a novel adjuvant treatment for liver cancer (81). Our next study will investigate whether TA has synergistic or antagonistic effects when combined with ATO to treat malignant tumors.

In conclusion, the present data suggested that mitochondrial dysfunction contributed to the cardiotoxicity of ATO, as well as to an oxidative stress reaction and inflammatory response. The present study demonstrated that TA administration effectively improved ATO-induced cardiotoxicity. The protective functions of TA may be associated with suppression of activation of the mitochondrial apoptosis pathway. Collectively, the present findings revealed that TA provided effective protection against ATO-induced cardiotoxicity. Based on these results, TA may have a potential defense mechanism in ATO clinical therapy and diminish its cardiotoxic effects. However, further investigation is required before its clinical application.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Research Foundation of Administration of Traditional Chinese Medicine of Hebei Province, China (grant no. 2020188).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YucX, ML, XC and LC conceived and designed the study. YucX, ML, YurX, WJ and XH performed the experiments. YucX and LC contributed to the writing of the original draft. ML contributed to data collection and interpretation. YurX and WJ provided help for analyzing the data. XH and JZ supervised the experiments and interpreted data. XC and ZL provided guidance for software and figures. YucX, ZL and LC revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Animal experiments were performed at Hebei Medical University of Chinese Medicine were in accordance with the Animal Care and Ethics Committee of Hebei Medical University of Chinese Medicine (Shijiazhuang, China) under the provisions of the UK Animals (Scientific Procedures) Act 1986. The Animal Care and Ethics Committee of Hebei Medical University of Chinese Medicine approved all animal protocols (approval no. DWLL2018038).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Alamolhodaei NS, Shirani K and Karimi G: Arsenic cardiotoxicity: An overview. Environ Toxicol Pharmacol. 40:1005–1014. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Manna P, Sinha M and Sil PC: Arsenic-induced oxidative myocardial injury: Protective role of arjunolic acid. Arch Toxicol. 82:137–149. 2008. View Article : Google Scholar : PubMed/NCBI

3 

Mathews V, Chendamarai E, George B, Viswabandya A and Srivastava A: Treatment of acute promyelocytic leukemia with single-agent arsenic trioxide. Mediterr J Hematol Infect. 3:e20110562011. View Article : Google Scholar

4 

Zhang TC, Cao EH, Li JF, Ma W and Qin JF: Induction of apoptosis and inhibition of human gastric cancer MGC-803 cell growth by arsenic trioxide. Eur J Cancer. 35:1258–1263. 1999. View Article : Google Scholar : PubMed/NCBI

5 

Shen ZY, Zhang Y, Chen JY, Chen MH, Shen J, Luo WH and Zeng Y: Intratumoral injection of arsenic to enhance antitumor efficacy in human esophageal carcinoma cell xenografts. Oncol Rep. 11:155–159. 2004.PubMed/NCBI

6 

Akao Y, Nakagawa Y and Akiyama K: Arsenic trioxide induces apoptosis in neuroblastoma cell lines through the activation of caspase 3 in vitro. FEBS Lett. 455:59–62. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Tai S, Xu LF, Xu M, Zhang LG, Zhang YY, Zhang KP, Zhang L and Liang CZ: Combination of arsenic trioxide and everolimus (Rad001) synergistically induces both autophagy and apoptosis in prostate cancer cells. Oncotarget. 8:11206–11218. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Bao ZY, Han ZB, Zhang B, Yu Y, Xu ZH, Ma WY, Ding FZ, Zhang L, Yu MX, Liu SZ, et al: Arsenic trioxide blocked proliferation and cardiomyocyte differentiation of human induced pluripotent stem cells: Implication in cardiac developmental toxicity. Toxicol Lett. 309:51–58. 2019. View Article : Google Scholar : PubMed/NCBI

9 

Liu YS, Liang YR, Zheng B, Chu L, Ma DL, Wang HF, Chu X and Zhang JP: Protective Effects of crocetin on arsenic trioxide-induced hepatic injury: Involvement of suppression in oxidative stress and inflammation through activation of Nrf2 signaling pathway in rats. Drug Des Devel Ther. 14:1921–1931. 2020. View Article : Google Scholar : PubMed/NCBI

10 

Unnikrishnan D, Dutcher JP, Garl S, Varshneya N, Lucariello R and Wiernik PH: Cardiac monitoring of patients receiving arsenic trioxide therapy. Br J Haematol. 124:610–617. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Mu MY, Zhao HJ, Wang Y, Liu JJ, Fei DX and Xing MW: Arsenic trioxide or/and copper sulfate co-exposure induce glandular stomach of chicken injury via destruction of the mitochondrial dynamics and activation of apoptosis as well as autophagy. Ecotoxicol Environ Saf. 185:1096782019. View Article : Google Scholar : PubMed/NCBI

12 

Badarkhe GV, Sil A, Bhattacharya S, Nath UK and Das NK: Erythema multiforme due to arsenic trioxide in a case of acute promyelocytic leukemia: A diagnostic challenge. Indian J Pharmacol. 48:216–218. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Roboz GJ, Ritchie EK, Carlin RF, Samuel M, Gale L, Provenzano-Gober JL, Curcio TJ, Feldman EJ and Kligfield PD: Prevalence, management, and clinical consequences of QT interval prolongation during treatment with arsenic trioxide. J Clin Oncol. 32:3723–3728. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Hai JJ, Gill H, Tse HF, Kumana CR, Kwong YL and Siu CW: Torsade de pointes during oral arsenic trioxide therapy for acute promyelocytic leukemia in a patient with heart failure. Ann Hematol. 94:501–503. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Zhang Y, Wei ZK, Liu WJ, Wang JJ, He XX, Huang HL, Zhang JL and Yang ZT: Melatonin protects against arsenic trioxide-induced liver injury by the upregulation of Nrf2 expression through the activation of PI3K/AKT pathway. Oncotarget. 8:3773–3780. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Wang XN, Zhao HY, Shao YL, Wang P, Wei YR, Zhang WQ, Jiang J, Chen Y and Zhang Z: Nephroprotective effect of astaxanthin against trivalent inorganic arsenic-induced renal injury in wistar rats. Nutr Res Pract. 8:46–53. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Cheng Y, Xue J, Jiang H, Wang M, Gao L, Ma D and Zhang Z: Neuroprotective effect of resveratrol on arsenic trioxide-induced oxidative stress in feline brain. Hum Exp Toxicol. 33:737–747. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Ahamed M, Akhtar MJ and Alhadlaq HA: Co-exposure to SiO2 nanoparticles and arsenic induced augmentation of oxidative stress and mitochondria-dependent apoptosis in human cells. Int J Environ Res Public Health. 16:31992019. View Article : Google Scholar

19 

Sabbah HN: Targeting the mitochondria in heart failure: A translational perspective. JACC Basic Transl Sci. 5:88–106. 2020. View Article : Google Scholar : PubMed/NCBI

20 

Chistiakov DA, Shkurat TP, Melnichenko AA, Grechko AV and Orekhov AN: The role of mitochondrial dysfunction in cardiovascular disease: A brief review. Ann Med. 50:121–127. 2018. View Article : Google Scholar : PubMed/NCBI

21 

Roy D, Felty Q, Narayan S and Jayakar P: Signature of mitochondria of steroidal hormones-dependent normal and cancer cells: Potential molecular targets for cancer therapy. Front Biosci. 12:154–173. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Brown DA, Perry JB, Allen ME, Sabbah HN, Stauffer BL, Shaikh SR, Cleland JG, Colucci WS, Butler J, Voors AA, et al: Expert consensus document: Mitochondrial function as a therapeutic target in heart failure. Nat Rev Cardiol. 14:238–250. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Pohjoismäki JL and Goffart S: The role of mitochondria in cardiac development and protection. Free Radic Biol Med. 106:345–354. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Peoples JN, Saraf A, Ghazal N, Pham TT and Kwong JQ: Mitochondrial dysfunction and oxidative stress in heart disease. Exp Mol Med. 51:1–13. 2019. View Article : Google Scholar : PubMed/NCBI

25 

Abdelrahman RS, El-Awady MS, Nader MA and Ammar EM: Hydrogen sulfide ameliorates cardiovascular dysfunction induced by cecal ligation and puncture in rats. Hum Exp Toxicol. 34:953–964. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Gill C, Mestril R and Samali A: Losing heart: The role of apoptosis in heart disease-a novel therapeutic target? FASEB J. 16:135–146. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Yu XJ, Wang ZY, Shu ZP, Li ZQ, Ning Y, Yun KL, Bai HN, Liu RH and Liu WL: Effect and mechanism of Sorbus pohuashanensis (Hante) Hedl. Flavonoids protect against arsenic trioxide-induced cardiotoxicity. Biomed Pharmacother. 88:1–10. 2017. View Article : Google Scholar : PubMed/NCBI

28 

McDonough KH: The role of alcohol in the oxidant antioxidant balance in heart. Front Biosci. 4:D601–D606. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Wang Y, Wu YP, Wang YY, Xu H, Mei XQ, Yu DY, Wang YB and Li WF: Antioxidant properties of probiotic bacteria. Nutrients. 9:5212017. View Article : Google Scholar

30 

Vineetha VP, Soumya RS and Raghu KG: Phloretin ameliorates arsenic trioxide induced mitochondrial dysfunction in H9c2 cardiomyoblasts mediated via alterations in membrane permeability and ETC complexes. Eur J Pharmacol. 754:162–172. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Lindskog M, Gleissman H, Ponthan F, Castro J, Kogner P and Johnsen JI: Neuroblastoma cell death in response to docosahexaenoic acid: Sensitization to chemotherapy and arsenic-induced oxidative stress. Int J Cancer. 118:2584–2593. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Chen H, Liu G, Qiao N, Kang Z, Hu L, Liao J, Yang F, Pang C, Liu B, Zeng Q, et al: Toxic effects of arsenic trioxide on spermatogonia are associated with oxidative stress, mitochondrial dysfunction, autophagy and metabolomic alterations. Ecotoxicol Environ Saf. 190:1100632020. View Article : Google Scholar : PubMed/NCBI

33 

Patlolla AK and Tchounwou PB: Serum acetyl cholinesterase as a biomarker of arsenic induced neurotoxicity in sprague-dawley rats. Int J Environ Res Public Health. 2:80–83. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Vineetha VP and Raghu KG: An overview on arsenic trioxide-induced cardiotoxicity. Cardiovasc Toxicol. 19:105–119. 2019. View Article : Google Scholar : PubMed/NCBI

35 

Amini-Khoei H, Hosseini MJ, Momeny M, Rahimi-Balaei M, Amiri S, Haj-Mirzaian A, Khedri M, Jahanabadi S, Mohammadi-Asl A, Mehr SE and Dehpour AR: Morphine attenuated the cytotoxicity induced by arsenic trioxide in H9c2 cardiomyocytes. Biol Trace Elem Res. 173:132–139. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Ghosh J, Das J, Manna P and Sil PC: Taurine prevents arsenic-induced cardiac oxidative stress and apoptotic damage: Role of NF-kappa B, p38 and JNK MAPK pathway. Toxicol Appl Pharmacol. 240:73–87. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Zhang JY, Sun GB, Luo Y, Wang M, Wang W, Du YY, Yu YL and Sun XB: Salvianolic acid a protects H9c2 cells from arsenic trioxide-induced injury via inhibition of the MAPK signaling pathway. Cell Physiol Biochem. 41:1957–1969. 2017. View Article : Google Scholar : PubMed/NCBI

38 

Zhu S, Wang Y, Liu H, Wei W, Tu Y, Chen C, Song J, Xu Z, Li J, Wang C and Sun S: Thyroxine affects lipopolysaccharide-induced macrophage differentiation and myocardial cell apoptosis via the NF-κB p65 pathway both in vitro and in vivo. Mediators Inflamm. 2019:20989722019. View Article : Google Scholar : PubMed/NCBI

39 

Liu X, Kim J, Li Y, Li J, Liu F and Chen X: Tannic acid stimulates glucose transport and inhibits adipocyte differentiation in 3T3-L1 cells. J Nutr. 135:165–171. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Hemmati AA, Olapour S, Varzi HN, Khodayar MJ, Dianat M, Mohammadian B and Yaghooti H: Ellagic acid protects against arsenic trioxide-induced cardiotoxicity in rat. Hum Exp Toxicol. 37:412–419. 2018. View Article : Google Scholar : PubMed/NCBI

41 

Ashafaq M, Sharma P, Khatoon S, Haque D, Tabassum H and Parvez S: Heavy metal-induced systemic dysfunction attenuated by tannic acid. J Environ Pathol Toxicol Oncol. 35:109–120. 2016. View Article : Google Scholar : PubMed/NCBI

42 

Zhang JP, Cui LJ, Han X, Zhang YY, Zhang X, Chu X, Zhang FH, Zhang Y and Chu L: Protective effects of tannic acid on acute doxorubicin-induced cardiotoxicity: Involvement of suppression in oxidative stress, inflammation, and apoptosis. Biomed Pharmacother. 93:1253–1260. 2017. View Article : Google Scholar : PubMed/NCBI

43 

Chu L, Li PY, Song T, Han X, Zhang X, Song QT, Liu T, Zhang YY and Zhang JP: Protective effects of tannic acid on pressure overload-induced cardiac hypertrophy and underlying mechanisms in rats. J Pharm Pharmacol. 69:1191–1207. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Zhu FL, Chu X, Wang H, Zhang X, Zhang YY, Liu ZY, Guo H, Liu HY, Liu Y, Chu L and Zhang JP: New Findings on the effects of tannic acid: Inhibition of L-Type calcium channels, Calcium transient and contractility in rat ventricular myocytes. Phytother Res. 30:510–516. 2016. View Article : Google Scholar : PubMed/NCBI

45 

Jin WY, Xue YR, Xue YC, Han X, Song QT, Zhang JP, Li ZL, Cheng J, Guan SJ, Sun SJ and Chu L: Tannic acid ameliorates arsenic trioxide-induced nephrotoxicity, contribution of NF-κB and Nrf2 pathways. Biomed Pharmacother. 126:1100472020. View Article : Google Scholar : PubMed/NCBI

46 

Kumazaki M, Ando H, Sasaki A, Koshimizu TA, Ushijima K, Hosohata K, Oshima Y and Fujimura A: Protective effect of α-lipoic acid against arsenic trioxide-induced acute cardiac toxicity in rats. J Pharmacol Sci. 115:244–248. 2011. View Article : Google Scholar

47 

Miao X, Tang ZF, Wang YG, Su GF, Sun WX, Wei W, Li W, Miao LN, Cai L, Tan Y and Liu QJ: Metallothionein prevention of arsenic trioxide-induced cardiac cell death is associated with its inhibition of mitogen-activated protein kinases activation in vitro and in vivo. Toxicol Lett. 220:277–285. 2013. View Article : Google Scholar : PubMed/NCBI

48 

Saxena PN, Anand S, Saxena N and Bajaj P: Effect of arsenic trioxide on renal functions and its modulation by curcuma aromatica leaf extract in albino rat. J Environ Biol. 30:527–531. 2009.PubMed/NCBI

49 

Liu J, Lu Y, Wu Q, Goyer RA and Waalkes MP: Mineral arsenicals in traditional medicines: Orpiment, realgar, and arsenolite. J Pharmacol Exp Ther. 326:363–368. 2008. View Article : Google Scholar : PubMed/NCBI

50 

Song J, Ding WB, Liu BJ, Liu D, Xia Z, Zhang L, Cui L, Luo Y, Jia XB and Feng L: Anticancer effect of caudatin in diethylnitrosamine-induced hepatocarcinogenesis in rats. Mol Med Rep. 22:697–706. 2020. View Article : Google Scholar : PubMed/NCBI

51 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

52 

Costa VM, Carvalho F, Duarte JA, Bastos Mde L and Remiao F: The heart as a target for xenobiotic toxicity: The cardiac susceptibility to oxidative stress. Chem Res Toxicol. 26:1285–1311. 2013. View Article : Google Scholar : PubMed/NCBI

53 

James TN: Long reflections on the QT interval: The sixth annual Gordon K. Moe Lecture. J Cardiovasc Electrophysiol. 7:738–759. 1996. View Article : Google Scholar : PubMed/NCBI

54 

Best PJ, Hasdai D, Sangiorgi G, Schwartz RS, Holmes DR Jr, Simari RD and Lerman A: Apoptosis. Basic concepts and implications in coronary artery disease. Arterioscler Thromb Vasc Biol. 19:14–22. 1999. View Article : Google Scholar : PubMed/NCBI

55 

Matsui M, Nishigori C, Toyokuni S, Takada J, Akaboshi M, Ishikawa M, Imamura S and Miyachi Y: The role of oxidative DNA damage in human arsenic carcinogenesis: Detection of 8-hydroxy-2′-deoxyguanosine in arsenic-related Bowen's disease. J Invest Dermatol. 113:26–31. 1999. View Article : Google Scholar : PubMed/NCBI

56 

Berridge MJ, Lipp P and Bootman MD: The versatility and universality of calcium signalling. Nat Rev Mol Cell Biol. 1:11–21. 2000. View Article : Google Scholar : PubMed/NCBI

57 

Pulido MD and Parrish AR: Metal-induced apoptosis: Mechanisms. Mutat Res. 533:227–241. 2003. View Article : Google Scholar : PubMed/NCBI

58 

Torka P, Al Ustwani O, Wetzler M, Wang ES and Griffiths EA: Swallowing a bitter pill-oral arsenic trioxide for acute promyelocytic leukemia. Blood Rev. 30:201–211. 2016. View Article : Google Scholar : PubMed/NCBI

59 

Sugden PH and Clerk A: Oxidative stress and growth-regulating intracellular signaling pathways in cardiac myocytes. Antioxid Redox Signal. 8:2111–2124. 2006. View Article : Google Scholar : PubMed/NCBI

60 

Vineetha RC, Binu P, Arathi P and Nair RH: L-ascorbic acid and alpha-tocopherol attenuate arsenic trioxide-induced toxicity in H9c2 cardiomyocytes by the activation of Nrf2 and Bcl2 transcription factors. Toxicol Mech Methods. 28:353–360. 2018. View Article : Google Scholar : PubMed/NCBI

61 

Petit PX, Susin SA, Zamzami N, Mignotte B and Kroemer G: Mitochondria and programmed cell death: Back to the future. FEBS Lett. 396:7–13. 1996. View Article : Google Scholar : PubMed/NCBI

62 

Lopez J and Tait SW: Mitochondrial apoptosis: Killing cancer using the enemy within. Br J Cancer. 112:957–962. 2015. View Article : Google Scholar : PubMed/NCBI

63 

Naoi M, Wu Y, Shamoto-Nagai M and Maruyama W: Mitochondria in neuroprotection by phytochemicals: Bioactive polyphenols modulate mitochondrial apoptosis system, function and structure. Int J Mol Sci. 20:24512019. View Article : Google Scholar

64 

Teixeira J, Deus CM, Borges F and Oliveira PJ: Mitochondria: Targeting mitochondrial reactive oxygen species with mitochondriotropic polyphenolic-based antioxidants. Int J Biochem Cell Biol. 97:98–103. 2018. View Article : Google Scholar : PubMed/NCBI

65 

Wang C, Zhang X, Teng ZP, Zhang T and Li Y: Downregulation of PI3K/Akt/mTOR signaling pathway in curcumin-induced autophagy in APP/PS1 double transgenic mice. Eur J Pharmacol. 740:312–320. 2014. View Article : Google Scholar : PubMed/NCBI

66 

Tower J: Programmed cell death in aging. Ageing Res Rev. 23:90–100. 2015. View Article : Google Scholar : PubMed/NCBI

67 

Moloudi K, Neshasteriz A, Hosseini A, Eyvazzadeh N, Shomali M, Eynali S, Mirzaei E and Azarnezhad A: Synergistic Effects of arsenic trioxide and radiation: Triggering the intrinsic pathway of apoptosis. Iran Biomed J. 21:330–337. 2017. View Article : Google Scholar : PubMed/NCBI

68 

Adil M, Kandhare AD, Ghosh P and Bodhankar SL: Sodium arsenite-induced myocardial bruise in rats: Ameliorative effect of naringin via TGF-β/Smad and Nrf/HO pathways. Chem Biol Interact. 253:66–77. 2016. View Article : Google Scholar : PubMed/NCBI

69 

Estaquier J, Vallette F, Vayssiere JL and Mignotte B: The mitochondrial pathways of apoptosis. Adv Exp Med Biol. 942:157–183. 2012. View Article : Google Scholar : PubMed/NCBI

70 

Du CY, Fang M, Li YC, Lily L and Wang XD: Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell. 102:33–42. 2000. View Article : Google Scholar : PubMed/NCBI

71 

Boise LH, Gottschalk AR, Quintáns J and Thompson CB: Bcl-2 and Bcl-2-related proteins in apoptosis regulation. Curr Top Microbiol Immunol. 200:107–121. 1995.PubMed/NCBI

72 

Tischner D, Woess C, Ottina E and Villunger A: Bcl-2-regulated cell death signalling in the prevention of autoimmunity. Cell Death Dis. 1:e482010. View Article : Google Scholar : PubMed/NCBI

73 

Miyashita T and Reed JC: Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell. 80:293–299. 1995. View Article : Google Scholar : PubMed/NCBI

74 

Oda E, Ohki R, Murasawa H, Nemoto J, Shibue T, Yamashita T, Tokino T, Taniguchi T and Tanaka N: Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science. 288:1053–1058. 2000. View Article : Google Scholar : PubMed/NCBI

75 

Shen Y and Shenk T: Relief of p53-mediated transcriptional repression by the adenovirus E1B 19-kDa protein or the cellular Bcl-2 protein. Proc Natl Acad Sci USA. 91:8940–8944. 1994. View Article : Google Scholar : PubMed/NCBI

76 

Hoffman WH, Biade S, Zilfou JT, Chen J and Murphy M: Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J Biol Chem. 277:3247–3257. 2002. View Article : Google Scholar : PubMed/NCBI

77 

Bensaad K and Vousden KH: p53: New roles in metabolism. Trends Cell Biol. 17:286–291. 2007. View Article : Google Scholar : PubMed/NCBI

78 

Mathas S, Lietz A, Janz M, Hinz M, Jundt F, Scheidereit C, Bommert K and Dorken B: Inhibition of NF-kappaB essentially contributes to arsenic-induced apoptosis. Blood. 102:1028–1034. 2003. View Article : Google Scholar : PubMed/NCBI

79 

Pahl HL: Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 18:6853–6866. 1999. View Article : Google Scholar : PubMed/NCBI

80 

Pace C, Dagda R and Angermann J: Antioxidants protect against arsenic induced mitochondrial cardio-toxicity. Toxics. 5:382017. View Article : Google Scholar

81 

Geng NN, Zheng X, Wu MS, Yang L, Li XY and Chen JD: Tannic acid synergistically enhances the anticancer efficacy of cisplatin on liver cancer cells through mitochondria-mediated apoptosis. Oncol Rep. 42:2108–2116. 2019.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xue Y, Li M, Xue Y, Jin W, Han X, Zhang J, Chu X, Li Z and Chu L: Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis. Mol Med Rep 22: 4663-4674, 2020.
APA
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J. ... Chu, L. (2020). Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis. Molecular Medicine Reports, 22, 4663-4674. https://doi.org/10.3892/mmr.2020.11586
MLA
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J., Chu, X., Li, Z., Chu, L."Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis". Molecular Medicine Reports 22.6 (2020): 4663-4674.
Chicago
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J., Chu, X., Li, Z., Chu, L."Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis". Molecular Medicine Reports 22, no. 6 (2020): 4663-4674. https://doi.org/10.3892/mmr.2020.11586
Copy and paste a formatted citation
x
Spandidos Publications style
Xue Y, Li M, Xue Y, Jin W, Han X, Zhang J, Chu X, Li Z and Chu L: Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis. Mol Med Rep 22: 4663-4674, 2020.
APA
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J. ... Chu, L. (2020). Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis. Molecular Medicine Reports, 22, 4663-4674. https://doi.org/10.3892/mmr.2020.11586
MLA
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J., Chu, X., Li, Z., Chu, L."Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis". Molecular Medicine Reports 22.6 (2020): 4663-4674.
Chicago
Xue, Y., Li, M., Xue, Y., Jin, W., Han, X., Zhang, J., Chu, X., Li, Z., Chu, L."Mechanisms underlying the protective effect of tannic acid against arsenic trioxide‑induced cardiotoxicity in rats: Potential involvement of mitochondrial apoptosis". Molecular Medicine Reports 22, no. 6 (2020): 4663-4674. https://doi.org/10.3892/mmr.2020.11586
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team