This article is mentioned in:

Introduction

Periodontal disease is a chronic, inflammatory disease characterized by the loss of supporting bone and periodontal tissue around the teeth, and is highly prevalent and can affect up to 90% of the worldwide population (1,2). Chronic inflammation reduces the regeneration of periodontal tissues and inhibits the osteogenic differentiation of periodontal ligament stem cells (PDLSCs) (3). Human PDLSCs (hPDLSCs) are the most common cells in periodontal membranes, which constantly form new fibers and bones, resulting in remodeling of the alveolar bone (4). hPDLSCs serve a critical function in repairing periodontal tissues and are among the vital seed cells required for periodontal regeneration (5). However, inflammation can reduce the bone regeneration ability of hPDLSCs, leading to irreversible damage (6–8). Multiple factors have been reported to be involved in the osteogenic differentiation of hPDLSCs, including bone morphogenetic protein 2 (BMP2), alkaline phosphatase (ALP), microRNAs (miRNAs/miRs) and runt-related transcription factor 2 (Runx2) (9–17). In addition to miRNAs, long non-coding RNAs (lncRNAs) also display regulatory effects on hPDLSCs (1,8,11,18).

Non-coding RNAs (ncRNAs), which comprise ~98% of transcriptomes, display a variety of biological functions, including modulating gene expression and DNA synthesis (19,20). Conventionally, ncRNAs refer to ribosomal RNAs and transfer RNAs, which serve a vital role in protein synthesis (21). A number of other types of ncRNAs, including small nuclear RNAs, miRNAs and lncRNAs, have also been discovered and investigated (20). lncRNAs serve different roles in gene expression via complex molecular mechanisms (20). For example, lncRNA-POIR, maternally expressed 3, XR_111050 and H19 imprinted maternally expressed transcript regulate the osteogenic differentiation of multiple types of stem cells (18,22–24). In addition to their functions in cells, lncRNAs also act as sponges of miRNAs, displaying the hierarchical regulatory potency of one ncRNA over another (25,26). For example, lncRNA-malate dehydrogenase acts as a sponge for miR-133 and miR-135 by preventing the miRNAs from targeting mastermind like transcriptional coactivator 1 and myocyte enhancer factor 2C (27). By binding to the 3′-untranslated regions of mRNAs, miRNAs regulate their expression, whereas lncRNAs serve as sponges of miRNAs by by preventing the aforementioned process (8).

The role of Prader Willi/Angelman region RNA 6 (PWAR6) in cancer and other diseases has not yet been fully elucidated. lncRNA PWAR6 has been recognized as a potential imprinted gene (28). A previous study verified its importance in the pathogenesis of Prader-Willi syndrome (29), but it is also associated with patient survival during glioma progression (30).

The present study investigated the expression of PWAR6 in hPDLSCs and its influence on the osteogenic differentiation of hPDLSCs. The results indicated that PWAR6 could promote hPDLSC osteogenesis and suggested that the interaction between miR-106a-5p and PWAR6 affected the osteogenic differentiation of hPDLSCs.

Materials and methods

Cell culture and characterization

hPDLSCs were isolated from premolars extracted from patients (Age: 11–18 years old, four male and five female) who had not received pharmacological treatment for orthodontic treatment at Jingmen No. 1 People's Hospital (Jingmen, China) between September 2018 to May 2019. The present study was approved by the Ethics Committee of Jingmen No. 1 People's Hospital (approval no. Y20180831) and written consent was obtained from each participant.

Premolars were washed with PBS (cat. no. 10010023; Thermo Fisher Scientific, Inc.) supplemented with 1% penicillin-streptomycin (100 U/ml penicillin; 100 µg/ml streptomycin; cat. no. 15140122; Thermo Fisher Scientific, Inc.). Periodontal ligament tissues were scraped, cut into small pieces and digested using collagenase I (3 mg/ml; Sigma-Aldrich; Merck KGaA) and dispase II (4 mg/ml; Sigma-Aldrich; Merck KGaA) for 1 h at 37°C. To further isolate and purify the stem cells, single-cell suspensions of primary cells were cloned using the limiting-dilution method, as previously described (31,32). Following digestion, the single-cell suspension was filtered through a 70 µm strainer. Subsequently, half of the single-cell suspension was seeded (60 cells/cm2) into 10-cm tissue culture dishes in DMEM supplemented with 10% FBS (cat. no. 10100147; Thermo Fisher Scientific, Inc.), 50 mg/ml streptomycin and 50 U/ml penicillin at 37°C with 5% CO2. The non-adherent cells were removed 3 days later, and the culture medium was changed three times per week. When cells reached 80% confluency, the supernatant was removed, the cells were washed twice using PBS twice and 0.5% 10X Trypsin-EDTA (cat. no. 15400054; Thermo Fisher Scientific, Inc.) was added to the cells for 2 min at room temperature. 2 ml DMEM/F12 with 10% FBS was added to terminate dissociation. After centrifugation at 1,500 × g for 3 min at room temperature, 2–3 ml DMEM/F12 supplemented with 1% penicillin-streptomycin and 10% FBS was added to the cells for subculture. P3 cells were used for subsequent experiments. Cell morphology was observed using an inverted phase contrast light microscope (DSZ2000X; Chongqing UOP Photoelectric Technology, Co., Ltd.).

For osteogenic induction, hPDLSCs were cultured in osteogenic medium (OM) consisting of 10 mmol/l β-glycerophosphate sodium (cat. no. 50020; Sigma-Aldrich; Merck KGaA), 50 µg/ml L-ascorbic acid (cat. no. 795437; Sigma-Aldrich; Merck KGaA) and 100 mmol/l dexamethasone (Sigma-Aldrich; Merck KGaA) at 37°C with 5% CO2. For the control group, hPDLSCs were cultured in growth medium (GM; cat. no. 112-500, Sigma-Aldrich; Merck KGaA). The medium was changed every two days and osteogenic induction duration was 21 days.

The cells were fixed with 4% paraformaldehyde (10 min) at 4°C and blocked in 1X PBS containing 10% normal goat serum (Thermo Fisher Scientific, Inc.) and 0.3 M glycine for 1 h at room temperature. To analyze mesenchymal stem cell marker expression, passage 3 cells were incubated at room temperature for 45 min with the following FITC or PE-conjugated monoclonal antibodies: Anti-Cluster of differentiation (CD)73 (Clone AD2, cat. no. 561254, 1:60), anti-CD90 (Clone 5E10, cat. no. 555595, 1:50), anti-CD105 (Clone 266, cat. no. 561443, 1:1,000), anti-CD34 (Clone 581, cat. no. 560710, 1:50) and anti-CD45 (Clone HI30, cat. no. 562312, 1:50, all BD Biosciences). Subsequently, the cells were examined using a FACS Canto II flow cytometer (BD Biosciences) and analyzed using BD CellQuest Pro Software V1.2 (BD Biosciences).

Immunohistochemical staining

hPDLSCs were cultured in a 24-well plate. At 60% confluence, 0.5 ml 4% paraformaldehyde (cat. no. MFCD00133991; Thermo Fisher Scientific, Inc.) was added into each well for 20 min at room temperature. After washing the cells with PBS (cat. no. 10010031; Thermo Fisher Scientific, Inc.) three times, 0.2% Triton X-100 (cat. no. HFH10; Thermo Fisher Scientific, Inc.) was added to the cells for 30 min, and subsequently, the cells were incubated with 3% H2O2 for 10 min at room temperature. Cells were blocked in 10% normal serum (Thermo Fisher Scientific, Inc.) with 1% BSA (Thermo Fisher Scientific, Inc.) in TBS for 2 h at room temperature. Each well was incubated with 50 µl anti-vimentin (cat. no. ab193555; 1:200; Abcam) antibody for 2 h at 37°C. After washing with PBS three times for 2 min each time, 50 µl goat anti-rabbit IgG H&L preadsorption secondary antibody (cat. no. ab96899; Abcam, 1:20,000) was added to each well for 20 min at 37°C. The cells were then washed with PBS three times. Subsequently, a DAB Reagent kit (cat. no. PW017; Shanghai Sangong Pharmaceutical Co., Ltd.) was used and the cells were observed under a fluorescence microscope at ×400 magnification).

Cell transfection

hPDLSCs (4×105) were transfected with 50 nmol of PWAR6 overexpression vector (PWAR6-OE), empty negative vector control (NC) (pCMV6-XL4-PWAR6, cat. no. SC127195 and its empty control vector were purchased from OriGene Technologies, Inc.), short hairpin (sh)RNA negative control (cat. no. C03002, shNC, Suzhou GenePharma Co., Ltd.), shPWAR6 (TGCTATCCTATTCATTTAGTATA, Suzhou GenePharma Co., Ltd.), miR-106a-5p mimic (GAUGGACGUGACAUUCGUGAAAA, cat. no. miR10000103-1-5, Guangzhou RiboBio Co., Ltd.) or mimic control (MC, 5′-UUCUCCGAACGUGUCACGUTT-3′, Guangzhou RiboBio Co., Ltd.) using Lipofectamine® 2000 transfection reagent (cat. no. 11668019; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Briefly, 0.8–1.0 µg of overexpression vectors, shRNAs miRNA mimics or their respective controls were diluted in 50 µl DMEM medium (cat. no. 12491015; Thermo Fisher Scientific, Inc.). Similarly, 1–3 µl Lipofectamine® 2000 reagent was diluted in 50 µl DMEM medium and maintained at room temperature for 5 min. Subsequently, the diluted DNA and Lipofectamine 2000® reagent were mixed together and incubated at room temperature for 20 min. The mixed solution was added to the cells for 2 h. Following a further incubation in DMEM at 37°C with 5% CO2 for 24 or 48 h, transfection efficiency was assessed.

ALP activity assay

ALP activity was detected using the Alkaline Phosphatase Assay kit (cat. no. ab83369; Abcam). hPDLSCs (1×105) were incubated with OM in 24-well plates for 7 days at room temperature. According to the manufacturer's protocol, 10 µl ALP enzyme solution and 50 µl 5 mM para-nitrophenyl phosphate solution were added into each well and incubated at 25°C for 60 min in the dark. The reaction was terminated by adding 20 µl stop solution. The absorbance of each well was measured at a wavelength of 405 nm using a microplate reader (cat. no. 11-120-533; Thermo Fisher Scientific, Inc.).

Alizarin red staining

Alizarin red staining was performed using the Alizarin Red S Staining kit (cat. no. 0223; ScienCell Research Laboratories, Inc.). According to the manufacturer's protocol, following aspiration of the culture medium, 1×105 cells were washed twice with 1 ml PBS and fixed in 4% paraformaldehyde for 15 min at room temperature. Before cell staining, the fixative was removed, and cells were washed three times with diH2O. After removing diH2O, 1 ml 2% Alizarin Red S Stain solution was added to each well and incubated for 20–30 min at room temperature. Subsequently, the solution was removed, and cells were washed three to five times using diH2O. To prevent the cells from drying out, 1 ml diH2O was added to each well. The samples were observed under a light microscope at ×400 magnification. Quantification of mineralization indicated by Alizarin red staining was performed using Image-Pro Plus (version 6.0; Media Cybernetics, Inc.).

Bioinformatics and dual-luciferase reporter assay

StarBase V2.0 (starbase.sysu.edu.cn) (33) was used to predict the target gene of PWAR6 and the dual-luciferase reporter assay was performed to investigate the findings. To assess whether miR-106a-5p targets PWAR6 and BMP2, this was examined using the luciferase pGL3-Basic vector (Promega Corporation). miR-106a-5p binding sites in wild-type (WT) and mutant (Mut) PWAR6 and BMP2 were analyzed by performing a dual-luciferase reporter assay using the Dual-Luciferase Reporter assay system (cat. no. E1910; Promega Corporation). Briefly, after aspirating the culture medium, 2×105 cells were washed two to three times using 1X PBS. Subsequently, 100–150 µl 1X passive lysis buffer (PLB) was added to the cells to ensure complete and even coverage of the cell monolayer. The plates were incubated for 15 min at room temperature with gentle agitation. After 24 h, the cells were added to the luminometer tubes. Then, to each luminometer tube, 100 µl Luciferase Assay Reagent II was added and 20 µl PLB was carefully transferred. The tube was placed in the luminometer (cat. no. E5311; Promega Corporation) and the reading was initiated. Finally, 100 µl Stop & Glo® Reagent was added to measure the activities. miR-106a-5p mimic was co-transfected with WT or MUT luciferase vector into 293T cells (American Type Culture Collection) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Renilla luciferase activity was detected in the same method described above. After 48 h of transfection, activity was measured.

Western blotting

Following cell culture in OM for 7 days, hPDLSCs were assessed by western blotting. Total protein (20 µg/lane) was extracted from hPDLSCs (4×105) using Mammalian Protein Extraction Reagent (cat. no. 78501; Thermo Fisher Scientific, Inc.). The protein concentration was determined using a BCA Protein Assay kit (cat. no. 23225; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Subsequently, 20 µg protein lysate was separated via 12% SDS-PAGE (cat. no. P0012A; Beyotime Institute of Biotechnology) and transferred to PVDF membranes (cat. no. FFP28; Beyotime Institute of Biotechnology). The membranes were blocked using 5% bovine serum albumin (cat. no. A1933; Sigma-Aldrich; Merck KGaA) for 2 h at room temperature. Subsequently, the membranes were incubated at 4°C overnight with the following primary antibodies: Anti-Osteocalcin (OCN; cat. no. ab93876; 1:500; Abcam), anti-Runx2 (cat. no. ab23981; 1:1,000; Abcam), anti-BMP2 (cat. no. ab214821; 1:1,000; Abcam) and anti-GADPH (cat. no. ab8245 or ab205719; 1:1,000; Abcam). Following primary incubation, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-rabbit (cat. no. ab6721; 1:2,000; Abcam) or goat anti-mouse IgG H&L (cat. no. ab150113, 1:200, Abcam) secondary antibody at room temperature for 1 h. Protein bands were visualized using enhanced chemiluminescence reagent (cat. no. FD8000; Fdbio Science). Protein expression levels were quantified using ImageJ software (Version 1.8.0; National Institutes of Health) with GAPDH as the loading control.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from the nuclei and cytoplasm of hPDLSCs using the Cytoplasmic and Nuclear RNA Purification kit (cat. no. 21000; Norgen Biotek Corp.). Total RNA was extracted from hPDLSCs using TRIzol® reagent (cat. no. 15596018; Thermo Fisher Scientific, Inc.). RNA concentration and optical density (1.8–2.1) were detected using a Nanodrop 8000 spectrophotometer (cat. no. ND-8000-GL; Thermo Fisher Scientific, Inc.) and RNA integrity was assessed via 1% agarose gel electrophoresis (cat. no. G442001; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent kit with gDNA Eraser (cat. no. RR047B; Takara Biotechnology Co., Ltd.). Briefly, 2 µl 5X gDNA Eraser Buffer, 1 µl gDNA Eraser, 1 µg total RNA and 10 µl RNase-free dH20 were mixed together and incubated using an Applied Biosystems Veriti PCR system (cat. no. 4484073; Thermo Fisher Scientific, Inc.) for 2 min at 42°C. Subsequently, 1 µl PrimeScript RT Enzyme Mix I, 4 µl RT primer Mix, 4 µl 5X PrimeScript Buffer 2 and 1 µl RNase Free dH20 were added to 10 µl sample and incubated at 37°C for 15 min, followed by incubation at 85°C for 5 sec. qPCR was performed using the 7500 Real-Time PCR system (cat. no. 4351105; Thermo Fisher Scientific, Inc.) using SYBR green (Invitrogen; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 95°C for 1 min, 95°C for 5 sec and 60°C for 30 sec, for a total of 40 cycles, 72°C for 30 sec, with a final extension at 72°C for 90 sec. Primers used were purchased from Guangzhou RiboBio Co., Ltd. and are listed in Table I. Expression levels were quantified using the 2−ΔΔCq method (34) and normalized to the internal reference genes U6 and GAPDH.

Table I. Primer sequences used for reverse transcription-quantitative PCR.

Table I.

Primer sequences used for reverse transcription-quantitative PCR.

Gene	Sequence (5′-3′)
PWAR6	F: GCCTACATGATGGGCAGTTT
	R: ACAACCAAAAGCAAGCCAAC
RUNX2	F: AGTAGCCAGGTTCAACGATCTGA
	R: GACTGTTATGGTCAAGGTGAAACTCTT
OCN	F: CGCTACCTGTATCAATGGCTGG
	R: ATGTGGTCAGCCAACTCGTCA
BMP2	F: GCCTGCTTCGCCATCT
	R: TGCCTCCTCCTTCTCCC
GAPDH	F: TGGATTTGGACGCATTGGTC
	R: TTTGCACTGGTACGTGTTGAT
ALP	F: AACACCAATGTAGCCAAG
	R: TCGGGCAGCGGTTACTGT
U6	F: GCTTCGGCAGCACATATACTAAAAT
	R: CGCTTCACGAATTTGCGTGTCAT
microRNA-	F: GATGCTCAAAAAGTGCTTACAGTGCA
106a-5p	R: TATGGTTGTTCTGCTCTCTGTCTC

[i] PWAR6, Prader Willi/Angelman region RNA 6; RUNX2, runt-related transcription factor 2; OCN, osteocalcin; BMP2, bone morphogenetic protein 2; ALP, alkaline phosphatase.

Statistical analysis

Statistical analyses were performed using SPSS software (version 16.0; SPSS, Inc.). Data are presented as the mean ± SEM. All experiments were performed in triplicate. Comparisons among multiple groups were analyzed using one-way ANOVA followed by Tukey's post hoc test. The unpaired Student's t test was used for comparisons between two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Cellular morphology and identification of hPDLSCs

hPDLSC cellular morphology was observed using P3 cells. Growing adherent cells were long and spindle-shaped and appeared in a radial or vortex-shaped close arrangement. Immunohistochemical staining results indicated that vimentin was expressed, which indicated that hPDLSCs were vimentin positive (Fig. 1A). hPDLSCs were CD73 (99.34%), CD90 (99.88%) and CD105 (99.67%) positive, but CD34 (0.41%) and CD45 (0.58%) negative (Fig. 1B).

Figure 1. PWAR6 is upregulated during the osteogenic induction of hPDLSCs. (A) hPDLSC cell morphology was detected by microscopy (left:light microscopy, right: Immunohistochemical staining observed using fluorescence microscopy). (B) Flow cytometric analysis indicated that hPDLSCs were CD73+, CD90+, CD105+, CD34- and CD45-. Reverse transcription-quantitative PCR was performed to detect the expression levels of (C) PWAR6, (D) RUNX2, (E) OCN, (F) BMP2 and (G) ALP in hPDLSCs cultured in OM or GM for 0–21 days. *P<0.05 and ***P<0.001 vs. GM. hPDLSCs, human periodontal ligament stem cells; CD, cluster of differentiation; GM, growth medium; OM, osteogenic medium.

PWAR6 expression during the osteogenic induction and differentiation of hPDLSCs

hPDLSCs were cultured with OM to induce osteogenic differentiation. The expression levels of PWAR6 and osteogenic markers, including RUNX2, OCN, BMP2 and ALP, in hPDLSCs were measured at 0, 3, 7, 14 and 21 days following osteogenic induction. The expression levels of PWAR6 and the osteogenic markers gradually increased in a time-dependent manner in the OM-incubated group. By contrast, following treatment with GM, the expression levels of PWAR6 and the osteogenic markers were not significantly altered among hPDLSCs incubated for different periods of time (Fig. 1C-G).

PWAR6 promotes the osteogenic differentiation of hPDLSCs

Based on the observation that the expression levels of PWAR6 and the osteogenic markers displayed a similar trend during hPDLSC osteogenic induction, the possible role of PWAR6 in hPDLSC osteogenic differentiation was investigated. A PWAR6 overexpression lentiviral plasmid (PWAR6-OE) and a PWAR6 knockdown lentiviral plasmid (shPWAR6) were constructed. Transfection efficiency was assessed by performing RT-qPCR, which indicated that PWAR6-OE significantly increased PWAR6 expression, whereas shPWAR6 significantly reduced PWAR6 expression in hPDLSCs compared with the corresponding negative control groups (Fig. 2A). Based on the finding that significant differences in gene expression were observed at 7 days post-osteogenic induction, the expression levels of RUNX2, OCN and BMP2 in the transfected hPDLSCs were detected after 7 days of culture in OM. The results indicated that PWAR6-OE significantly upregulated RUNX2, OCN and BMP2 expression levels in hPDLSCs, whereas PWAR6 knockdown significantly downregulated the mRNA expression levels of osteogenic marker genes compared with the corresponding negative control groups (Fig. 2B). Similar but less significant regulatory effects of PWAR6 on Runx2, OCN and BMP2 expression levels were observed at the protein level (Fig. 2C). The effect of PWAR6 on hPDLSC osteogenic differentiation was investigated by performing Alizarin red staining and ALP activity assays. The PWAR6-OE group displayed significantly increased mineralization and ALP activity compared with the negative control group. By contrast, mineralization and ALP activity were significantly decreased in the PWAR6 knockdown group compared with the shNC group (Fig. 2D-F).

Figure 2. PWAR6 overexpression increases the osteogenic differentiation and mineralization of human periodontal ligament stem cells. (A) RT-qPCR was performed to detect PWAR6 expression level following transfection with PWAR6-OE, shPWAR6, NC or shNC (^^P<0.01 vs. NC; ###P<0.001 vs. shNC). (B) RT-qPCR was performed to detect RUNX2, OCN and BMP2 mRNA expression levels following transfection. (C) Following transfection, protein expression levels were determined by western blotting for Runx2, OCN and BMP2 (^P<0.05, ^^P<0.01 and ^^^P<0.001 vs. NC; #P<0.05, ##P<0.01 and ###P<0.001 vs. shNC). Osteogenesis was (D) determined by Alizarin red staining and (E) quantified. (F) Mineralization was assessed by performing an ALP activity assay. (^^^P<0.001 vs. NC; ##P<0.01 and ###P<0.01 vs. shNC). PWAR6-OE, PWAR6 overexpression vector; NC, negative control; sh, short hairpin RNA; RT-qPCR, reverse transcription-quantitative PCR; Runx2, runt-related transcription factor 2; OCN, osteocalcin; BMP2, bone morphogenetic protein 2; ALP, alkaline phosphatase.

PWAR6 acts as a sponge of miR-106a-5p

To determine whether PWAR6 acted as a sponge of miR-106a-5p, StarBase was used to predict the binding sites between miR-106a-5p and PWAR6 (Fig. 3A). Subsequently, the expression of PWAR6 in the cytoplasm and nuclei of hPDLSCs was detected, and the results indicated that PWAR6 expression was significantly higher in the cytoplasm compared with the nucleus (Fig. 3B). A dual-luciferase reporter assay was performed, which suggested that miR-106a-5p mimic significantly inhibited the luciferase activity of the PWAR6-WT reporter, but displayed a limited effect on the PWAR6-Mut reporter compared with the negative control group (Fig. 3C). Furthermore, PWAR6 expression was negatively associated with miR-106a-5p expression in hPDLSCs, as indicated by PWAR6 overexpression reducing miR-106a-5p expression levels and PWAR6 knockdown increasing miR-105a-5p expression levels in hPDLSCs compared with the corresponding negative control groups (Fig. 3D). In addition, miR-106a-5p expression levels were significantly downregulated in hPDLSCs on days 7–21 of osteogenic induction compared with the GM-incubated group (Fig. 3E).

Figure 3. PWAR6 serves as a sponge of miR-106a-5p. (A) StarBase was used to predict the binding site between miR-106a-5p and PWAR6. (B) RT-qPCR was performed to detect PWAR6 expression levels in the cytoplasm and nuclei of hPDLSCs (*P<0.05 and ***P<0.01 vs. cytoplasm). (C) A dual-luciferase reporter assay was performed to detect luciferase activities of PWAR6-WT and PWAR6-Mut in miR-106a-5p mimic- and mimic control-transfected cells (^^P<0.01 vs. NC). (D) RT-qPCR was performed to detect miR-106a-5p expression levels in PWAR6-OE-, shPWAR6-, NC- and shNC- transfected hPDLSCs (^^^P<0.001 vs. NC; ###P<0.001 vs. shNC). (E) RT-qPCR was performed to detect miR-106a-5p expression levels in hPDLSCs cultured in GM or OM for 0–21 days (ΔP<0.05 and ΔΔΔP<0.001 vs. GM). miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; hPDLSCs, human periodontal ligament stem cells; PWAR6-OE, PWAR6 overexpression vector; sh, short hairpin RNA; NC, negative control; GM, growth medium; OM, osteogenic medium; WT, wild-type; Mut, mutant.

PWAR6 negatively regulates miR-106a-5p during osteogenic differentiation

Based on the finding that PWAR6 sponged miR-106a-5p, the present study further analyzed how the relationship between PWAR6 and miR-106a-5p altered hPDLSCs osteogenesis. The results demonstrated that miR-106a-5p expression was significantly increased in miR-106a-5p mimic-transfected cells compared with control and mimic control-transfected cells (Fig. 4A). In addition, the results indicated that miR-106a-5p mimic significantly increased the expression level of miR-106a-5p compared with the corresponding control group, but PWAR6-OE attenuated the effect of miR-106a-5p mimic on miR-106a-5p expression levels (Fig. 4B). Similarly, at day 7 of osteogenic induction, miR-106a-5p mimic significantly downregulated PWAR6-OE-induced RUNX2, OCN and BMP2 mRNA expression levels in hPDLSCs compared with the MC + PWAR6-OE group (Fig. 4C). Similar effects of miR-106a-5p mimic and PWAR6-OE on Runx2, OCN and BMP2 expression were also observed at the protein level; however, the effects of PWAR6-OE on OCN expression were significantly altered by miR-106a-5p mimic (Fig. 4D). In addition, hPDLSCs were analyzed by Alizarin red staining and ALP activity assays. The results indicated that miR-106a-5p mimic attenuated PWAR6-OE-induced mineralization and ALP activity in hPDLSCs (Fig. 4E-G).

Figure 4. PWAR6 negatively regulates miR-106a-5p. BMP2 was identified as a target gene of miR-106a-5p. (A) RT-qPCR was performed to detect miR-106a-5p expression levels in transfected hPDLSCs (†††P<0.001 vs. MC). (B) RT-qPCR was performed to detect miR-106a-5p expression levels in co-transfected hPDLSCs (***P<0.001 vs. MC + NC; ###P<0.001, vs. MC + PWAR6-OE; ^^^P<0.001 vs. M + NC). (C) RT-qPCR was performed to detect RUNX2, OCN and BMP2 expression levels in hPDLSCs following transfection (**P<0.01 and ***P<0.001 vs. MC + NC; ###P<0.001 vs. MC + PWAR6-OE; ^^^P<0.001 vs. M + NC). Protein expression levels were (D) determined by western blotting and (E) semi-quantified for Runx2, OCN and BMP2 in hPDLSCs following transfection (*P<0.05, **P<0.01 and ***P<0.001 vs. MC + NC; ##P<0.01 and ###P<0.001 vs. MC + PWAR6-OE; ^^P<0.01 and ^^^P<0.001 vs. M + NC). Osteogenesis was (E) determined by Alizarin red staining and (F) quantified. (G) Mineralization was determined by performing an ALP activity assay (**P<0.01 and ***P<0.001 vs. MC + NC; ##P<0.01 vs. MC + PWAR6-OE; ^^^P<0.001 vs. M + NC). (H) StarBase was used to predict the binding site between BMP2 and miR-106a-5p. (I) A dual-luciferase reporter assay was performed to detect the luciferase activities of BMP2-WT and BMP2-Mut in miR-106a-5p mimic- and mimic control-transfected cells (ΔΔP<0.01 vs. NC). miR, microRNA; RT-qPCR, Reverse transcription-quantitative PCR; hPDLSCs, human periodontal ligament stem cells; MC, miR-106a-5p mimic control; NC, negative control; M, miR-106a-5p mimic; Runx2, runt-related transcription factor 2; OCN, osteocalcin; BMP2, bone morphogenetic protein 2; ALP, alkaline phosphatase; WT, wild-type; Mut, mutant; 3′UTR, 3′-untranslated region; PWAR6-OE, PWAR6 overexpression vector.

BMP2 is the target gene of miR-106a-5p

The downstream target of miR-106a-5p was predicted using StarBase, and the binding site between BMP2 and miR-106a-5p was predicted (Fig. 4H). A dual-luciferase reporter assay was conducted to verify the interaction between BMP2 and miR-106a-5p, which indicated that miR-106a-5p mimic significantly inhibited the luciferase activity of the BMP2-WT reporter, but displayed a limited effect on the luciferase activity of the BMP2-Mut reporter compared with the negative control group (Fig. 4I).

Discussion

Inhibition of hPDLSC osteogenic differentiation under stimuli such as inflammation and hypoxia may result in the loss of periodontal connective tissues (35). The present study aimed to improve the current understanding of the regulation of hPDLSC osteogenesis and the mechanism underlying periodontal tissue loss. The results indicated that in OM-incubated cells, the expression levels of PWAR6 and four osteogenic-related proteins (Runx2, OCN, BMP2 and ALP) were increased compared with GM-incubated cells. Secondly, compared with the corresponding control groups, PWAR6 overexpression significantly increased osteogenesis, whereas PWAR6 knockdown led to the opposite result, which indicated that PWAR6 may serve a potential regulatory role during the osteogenesis of hPDLSCs.

Previous studies have investigated the role of PWAR6 in cancer and other diseases (29,30). Lei et al (29) demonstrated that gene telomeric expression of the PWAR6 breakpoint significantly affects the pathogenesis of Prader-Willi syndrome. In addition, PWAR6 has a notable influence on the survival of patients with glioma and is involved in the immune response, DNA repair and epithelial-mesenchymal transition (30). However, the effects of PWAR6 on the osteogenesis of hPDLSCs have not been previously reported; therefore, to the best of our knowledge, the present study indicated for the first time that PWAR6 may positively regulate the osteogenic differentiation of hPDLSCs and their ALP activity by regulating osteogenic factors, such as Runx2, OCN and BMP2.

It has been reported that multiple lncRNAs serve as miRNAs sponges (36–41). Wu et al (36) revealed that lncRNA PAGBC displays a sponge effect on miR-133b and miR-511, which promotes metastasis and tumor growth of gallbladder cancer. Previous studies have demonstrated that the differentiation of mesenchymal stem cells into osteoblasts is regulated by miRNAs (42–44). The expression levels of miR-42, miR-106a, miR-148a, let-7i and miR-99a are specific in human mesenchymal stem cells, whereas the expression levels of miR-15b, miR-24, miR-130b, miR-30c and miR-130a are specific in differentiated osteoblasts (45). Vimalraj and Selvamurugan (45) indicated that miR-15b promotes adipogenesis and myogenesis lineages. By considering the sponging effect of lncRNAs, the present study further investigated the relationship between PWAR6 and miRNAs. The small non-coding RNA miR-106a-5p is involved in colorectal cancer, osteosarcoma and astrocytoma (46). Regarding the association of miR-106a-5p with osteogenesis, miR-106a-5p promotes apoptosis and suppresses cell proliferation (47). In the present study, miR-106a-5p expression was decreased in OM-incubated cells compared with GM-incubated cells. Furthermore, the results indicated that PWAR6 may serve as a sponge of miR-106a-5p to promote osteogenesis via upregulating osteogenic markers. Although other miRNAs, such as miR-1827, miR-145 and miR-5100, and their association with osteogenic differentiation have been previously reported (48–50), at present, little is known about the association between miR-106a-5p and osteogenesis. Based on the results of the present study, it was hypothesized that PWAR6 may regulate the osteogenesis of hPDLSCs by serving as a sponge of miR-106a-5p.

BMP2 induces chondrogenic differentiation, osteogenic differentiation and endochondral ossification of stem cells (51). BMP2 can influence the osteogenic differentiation of mesenchymal stem cells (52). BMP2-modified injectable hydrogel can be used for the osteogenic differentiation of human periodontal ligament stem cells (53). The results of the present study suggested that BMP2 was a target gene of miR-106a-5p, which was supported by Li et al (54), who demonstrated that miR-106a regulates osteogenesis and adipogenic lineage commitment of human mesenchymal stem cells by directly targeting BMP2. BMP2 is a vital differentiation-related factor that belongs to the transforming growth factor β family, and can promote bone healing and induce bone growth (55,56). The effect of PWAR6 on the osteogenic differentiation of hPDLSCs was preliminarily investigated in the present study, but the effects of proinflammatory factors on PWAR6 and miR-106a require further investigation.

In conclusion, the present study identified a possible interaction network between lncRNA PWAR6 and miR-106a-5p. PWAR6 may promote the osteogenic differentiation and mineralization of hPDLSCs and serve as a sponge of miR-106a-5p. The present study indicated that modulating the osteogenic differentiation of hPDLSCs may serve as a potential therapeutic strategy for periodontal disease.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JX and YB made substantial contributions to the conception and design of the study, acquired, analyzed and interpreted the data, and drafted or critically revised the article for important intellectual content. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Jingmen No. 1 People's Hospital (approval no. Y20180831) and written consent was obtained from each participant.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References