Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2021 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2021 Volume 24 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide

  • Authors:
    • Haruka Mizobuchi
    • Kazushi Yamamoto
    • Masashi Yamashita
    • Hiroyuki Inagawa
    • Chie Kohchi
    • Gen-Ichiro Soma
  • View Affiliations / Copyright

    Affiliations: Control of Innate Immunity, Collaborative Innovation Partnership, Takamatsu‑shi, Kagawa 761‑0301, Japan
  • Article Number: 687
    |
    Published online on: July 30, 2021
       https://doi.org/10.3892/mmr.2021.12328
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Diabetes‑associated neuronal dysfunction (DAND) is one of the serious complications of diabetes, but there is currently no remedy for it. Streptozotocin [2‑deoxy‑2‑(3‑methy1‑3‑nitrosoureido) D‑glucopyranose; STZ] is one of the most well‑established diabetes inducers and has been used in vivo and in vitro DAND models. The aim of the present study was to demonstrate that C8‑B4 microglia transformed by the stimulus of repetitive low‑dose lipopolysaccharide (LPSx3‑microglia) prevent STZ‑induced Neuro‑2a neuronal cell death in vitro. The ELISA results showed that neurotrophin‑4/5 (NT‑4/5) secretion was promoted in LPSx3‑microglia and the cell viability assay with trypan blue staining revealed that the culture supernatant of LPSx3‑microglia prevented STZ‑induced neuronal cell death. In addition, reverse transcription‑quantitative PCR showed that neurons treated with the culture supernatant of LPSx3‑microglia promoted the gene expression of B‑cell lymphoma‑extra large and glucose‑dependent insulinotropic polypeptide receptor. Furthermore, the inhibition of tyrosine kinase receptor B, a receptor of NT‑4/5, suppressed the neuroprotective effect of LPSx3‑microglia. Taken together, the present study demonstrated that LPSx3‑microglia prevent STZ‑induced neuronal death and that NT‑4/5 may be involved in the neuroprotective mechanism of LPSx3‑microglia.

Introduction

It has been elucidated that patients with diabetes are more likely to develop nervous system disorders, such as neuropathy, cognitive decline and dementia (1,2). There are 463 million patients with diabetes worldwide and half of them have been reported to develop diabetes-associated neuronal dysfunction (DAND) (1,2). However, no prophylaxis or remedy for DAND has yet been developed.

Streptozotocin [2-deoxy-2-(3-methy1-3-nitrosoureido) D-glucopyranose; STZ] is one of the most well-established diabetes inducers. In vivo, animals administered STZ intraventricularly have been used as experimental models for DAND (3). In vitro, STZ could induce neuronal damage (4–6) and is used as a model for analyzing cellular processes and potential therapies in DAND.

Microglia, the tissue-resident macrophages in the brain, are immune cells that serve a central role in innate immunity and maintain the homeostasis of the central nervous system. Microglia contribute to preventing neuronal damage by dynamically transforming their characteristics in response to various stimuli (7,8). Therefore, it is considered that inducing the transformation to neuroprotective microglia could be a solution to DAND.

Lipopolysaccharide (LPS) is a glycolipid that constitutes the outer membrane of Gram-negative bacteria and induces microglial transformation of microglia through binding to Toll-like receptor-4. It is known that a single injection of high-dose LPS induces the transformation to inflammatory microglia and neuroinflammation (9–11). By contrast, repetitive low-dose LPS stimulation could suppress neuronal dysfunction in various neurological disease models, such as Alzheimer's disease and cerebral ischemia, by inducing transformation into neuroprotective microglia both in vivo (12–16) and in vitro (17,18). Consistent with this, our previous study showed that microglia transformed by the stimulus of repetitive low-dose LPS (LPSx3-microglia) have a neuroprotective potential with high gene expression of neurotrophin-4/5 (NT-4/5) (19). NT-4/5 is a member of a family of neurotrophic factors, neurotrophins. NT-4/5 binds to its high-affinity receptor, tyrosine receptor kinase B (TrkB) and supports neuronal survival and growth (20–23). Hence, LPSx3-microglia might have a neuroprotective effect. To analyze the effect of LPSx3-microglia on neural survival, the neuroprotective effects of LPSx3-microglia on STZ-stimulated neurons in vitro were evaluated (3,24).

Materials and methods

Microglia culture and LPS treatment

The murine microglial cell line C8-B4 was cultured and treated with LPS, as described previously (19). Briefly, C8-B4 microglia (purchased from the American Type Culture Collection; cat. no. CRL-2540) were seeded in 12-well tissue culture plates (2×105 cells/ml) and cultured in Dulbecco's modified Eagle's medium (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich; Merck KGaA), 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.) at 37°C in 5% CO2 (n=3). C8-B4 microglia were treated with LPS (purified LPS derived from Pantoea agglomerans; Macrophi, Inc.) by replacing with fresh medium containing LPS (1 ng/ml) every 24 h for a total of three times. For single treatment with LPS, cells received fresh medium without LPS for the first 48 h and then received fresh medium containing LPS once. Cell lysates and the culture supernatant were collected at 30 min and 24 h after final LPS treatment, respectively. The microglial culture supernatant (MCS) treated with LPS was filtered through a 0.22 µm polyether sulfone membrane (Sartorius AG) and frozen at −80°C until used for culture of N2a neurons.

Determination of NT-4/5 and prostaglandin E2 (PGE2) in the culture supernatant

The culture supernatants were collected 24 h after the final LPS treatment of C8-B4 microglia. The protein levels of NT-4/5 and PGE2 in LPS-treated MCS were measured using a commercial ELISA kit (Biosensis Pty. Ltd.; cat. no. BEK-2218 for NT-4/5 and Cayman Chemical Company; cat. no. 514010 for PGE2) according to the manufacturer's instructions.

Western blot analysis

C8-B4 microglia were lysed with sodium dodecyl sulfate (SDS) sample buffer [50 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol and 5% 2-mercaptoethanol at final concentration]. The total protein concentration in each sample was determined by Pierce 660 nm Protein Assay Reagent with Ionic Detergent Compatibility Reagent (Pierce; Thermo Fisher Scientific, Inc.). After boiling for 5 min, samples (5 µg protein/lane) were separated by electrophoresis on 15% polyacrylamide gels (ATTO Corporation), followed by transfer to polyvinylidene difluoride membrane (Cytiva). Following blocking with Tris-buffered saline (TBS) containing 5% bovine serum albumin (Nacalai Tesque, Inc.) at 4°C for 1 h, the membranes were incubated with a primary antibody against extracellular signal-regulated kinase 1/2 (ERK1/2; cat. no. 4695; 1:1,000), phosphorylated (p)-ERK1/2 (Thr202/Tyr204; cat. no. 4370; 1:1,000), p-p38 (Thr180/Tyr182; cat. no. 4511; 1:1,000), p38 (cat. no. 8690; 1:1,000), CREB (cat. no. 9197; 1:1,000), p-CREB (Ser133; cat. no. 9198; 1:1,000), c-Jun (cat. no. 9165; 1:1,000), p-c-Jun (Ser73; cat. no. 3270; 1:1,000; all from Cell Signaling Technology, Inc.), RELB Proto-Oncogene NF-κB Subunit (relB; cat. no. sc-226; 1:500), or β-actin (cat. no. sc-47778; 1:500; both from Santa Cruz Biotechnology, Inc.) at 4°C overnight. Following washing with TBS with 0.1% Tween-20, membranes were incubated with horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (IgG) antibody (cat. no. 406401; 1:3,000) or HRP-conjugated anti-mouse IgG antibody (cat. no. 405306; 1:3,000; both from BioLegend, Inc.) at 4°C for 1 h. Bound antibodies were visualized using the WesternBright ECL HRP substrate (Advansta, Inc.). Chemiluminescent signals were detected and analyzed using Amersham Imager 680 (Cytiva) according to the manufacturer's instructions. β-actin was used for normalization.

Treatment of N2a neurons with MCS and STZ

The murine neuroblastoma cell line Neuro-2a (N2a) was provided by the Japanese Collection of Research Bioresources Cell Bank. N2a neurons were seeded in 12-well tissue culture plates (4×105 cells/ml) and precultured in Eagle's minimal essential medium with non-essential amino acids (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% FBS (Sigma-Aldrich; Merck KGaA), 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.) at 37°C in 5% CO2 for 24 h (n=3). The medium was then replaced with MCS of microglia treated with LPS (LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h). After culture with LPS-treated MCS at 37°C in 5% CO2 for 24 h, 400 µM STZ (Sigma-Aldrich; Merck KGaA) was added to the culture medium and N2a neurons were cultured at 37°C in 5% CO2 for another 24 h. Finally, N2a neurons were counted after detachment by treatment with 0.25% trypsin at 37°C in 5% CO2 for 2 min. The survival rate was calculated by staining with trypan blue (Nacalai Tesque, Inc.) at room temperature for 30 sec. For TrkB inhibition, the TrkB inhibitor ANA-12 (5–30 µM; Sigma-Aldrich; Merck KGaA) was added at the same time as the replacement with LPS-treated MCS in the above procedure.

Reverse transcription-quantitative (RT-q) PCR

RT-qPCR was performed as described previously (19). Briefly, RNA was extracted from N2a neurons by the RNeasy Mini kit (Qiagen GmbH). cDNA was synthesized by reverse transcription using ReverTra Ace qPCR RT Master Mix (Toyobo Life Science) according to the manufacturer's instructions. qPCR assay was performed using 2 µl cDNA as template and 10 µl Power SYBR Green PCR Master Mix (Thermo Fisher Scientific, Inc.) on the Stratagene Mx 3005P QPCR System (Agilent Technologies, Inc.). The primers are listed in Table I. The thermocycling conditions for PCR were 95°C for 10 min for polymerase activation, followed by 45 cycles of 95°C for 15 sec for denaturation and 60°C for 1 min for extension. Data were analyzed by the 2−∆∆Cq method (25) and normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression.

Table I.

List of primers used for reverse transcription-quantitative PCR.

Table I.

List of primers used for reverse transcription-quantitative PCR.

GeneForward primer (5′→3′)Reverse primer (5′→3′)
Bcl2 TGAGTACCTGAACCGGCATCT GCATCCCAGCCTCCGTTAT
Bcl2l1 AACATCCCAGCTTCACATAACCCC GCGACCCCAGTTTACTCCATCC
Gapdh CGACTTCAACAGCAACTCCCACTCTTCC TGGGTGGTCCAGGGTTTCTTACTCCTT
Gipr CCGCGCTTTTCGTCAT CCACCAAATGGCTTTGACTT
Glp1r TCAGAGACGGTGCAGAAATG CAGCTGACATTCACGAAGGA
Glut3 TTCTGGTCGGAATGCTCTTC AATGTCCTCGAAAGTCCTGC
Igf1r GTGGGGGCTCGTGTTTCTC GATCACCGTGCAGTTTTCCA
InsR ATGGGCTTCGGGAGAGGAT GGATGTCCATACCAGGGCAC
Ptges GGATGCGCTGAAACGTGGA CAGGAATGAGTACACGAAGCC

[i] Gipr, glucose-dependent insulinotropic polypeptide receptor; Glp1r, glucagon-like peptide-1; InsR, insulin receptor; Igf1r, insulin-like growth factor-I receptor; Glut3, glucose transporter 3; Ptges, prostaglandin E synthase.

Statistical analysis

A minimum sample size was determined using power analysis in a prior examination with the statistical analysis software R (26). Statistical analysis was performed using GraphPad Prism 6.0 software package (GraphPad Software, Inc.). Results are presented as mean ± standard error of the mean. The differences between the groups were analyzed by one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test or two-way ANOVA followed by Sidak's multiple comparison test. All experiments were conducted at least two times independently. P<0.05 was considered to indicate a statistically significant difference.

Results

Promotion of NT-4/5 expression in LPSx3-microglia

As our previous study revealed that NT-4/5 mRNA expression was promoted in LPSx3-microglia (19), the NT-4/5 protein level in the culture supernatant of LPSx3-microglia was confirmed by ELISA and compared to untreated control and microglia transformed by a stimulus of single low-dose LPS (LPSx1-microglia). The results showed that the protein level of NT-4/5 in the culture supernatant of LPSx3-microglia was promoted compared with the LPSx0 and LPSx1 groups (Fig. 1A).

Figure 1.

Promotion of NT-4/5 expression in LPSx3-microglia. (A) NT-4/5 level in the culture supernatant of C8-B4 microglia 24 h after treatment with LPS (1 ng/ml) one or three times (n=6). (B) Top, relative mRNA expression of Ptges of C8-B4 microglia 4 h after treatment with LPS; bottom, PGE2 level in the culture supernatant of C8-B4 microglia 24 h after treatment with LPS (n=3). The relative mRNA expression was measured by reverse transcription-quantitative PCR using the 2−∆∆Cq method. Data were normalized by GAPDH and expressed as the relative fold-change to unstimulated cells. (C) Signal transduction in microglia 30 min after treatment with LPS (n=3). Protein expression of p-ERK1/2, p-p38, p-c-Jun, p-CREB and RelB were assessed by western blotting and semi-quantified. Signal volume was normalized by β-actin and non-phosphorylated controls. Data were expressed as the relative fold-change to untreated cells. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. *P<0.05, one-way ANOVA with Tukey's multiple comparison test. NT-4/5, neurotrophin-4/5; LPS, lipopolysaccharide; Ptges, prostaglandin E synthase; PGE2, prostaglandin E2; p-, phosphorylated; CREB, cAMP response element-binding protein; RelB, RELB proto-oncogene NF-κB subunit; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

Since NT-4/5 production was promoted by PGE2 (27), the PGE2 level in the culture supernatant of LPSx3-microglia was measured. As shown in Fig. 1B, LPSx3-microglia promoted the mRNA expression of prostaglandin E synthase (Ptges), a gene encoding microsomal PGE2 synthase-1 and also increased PGE2 protein levels in the culture supernatants compared with the LPSx0 group.

To assess signal transduction in LPSx3-microglia, the activation of kinases and transcription factors was measured with phosphospecific antibodies (Fig. 1C). The phosphorylation levels of ERK1/2 and p38 in the LPSx3-microglia were weaker compared with those of LPSx1-microglia, although their levels were higher compared with those of untreated controls. The phosphorylation levels of CREB were promoted in LPSx1-microglia, but suppressed in LPSx3-microglia and untreated controls. By contrast, the phosphorylation of c-Jun, which forms activator protein-1 (AP-1), was promoted in LPSx3-microglia as high as in LPSx1-microglia. RelB expression was confirmed to be suppressed in LPSx3-microglia, as reported previously in LPSx3-macrophages (28). Therefore, c-Jun may be involved in signal transduction that induces the transformation to LPSx3-microglia.

Prevention of STZ-induced neuronal cell death by LPSx3-microglia

To assess the effect of LPSx3-microglia on neuroprotection, the viability of N2a neurons was evaluated after STZ stimulation in the culture supernatants of untreated microglia (control MCS), culture supernatant of LPSx1-microglia (LPSx1-MCS), or culture supernatant of LPSx3-microglia (LPSx3-MCS) as shown in Fig. 2A.

Figure 2.

Prevention of STZ-induced neuronal death by the culture supernatant of LPSx3-microglia. (A) Experimental process of the evaluation of the neuroprotective effect of LPS-treated MCS in the STZ-induced neuronal damage. N2a neurons were cultured for 24 h and then the medium was replaced with MCS of microglia treated with 1 ng/ml LPS. After culture with LPS-treated MCS for 24 h, 400 µM STZ was added to the culture medium and N2a neurons were cultured for another 24 h. N2a neurons were counted and the survival rate was calculated by staining with trypan blue dye. (B) Total cell number of N2a neurons following STZ stimulation in LPS-treated MCS (n=3). N2a neurons were detached 24 h after STZ stimulation by treatment with 0.25% trypsin and the number of total cells was counted. (C) Survival rate (left) and survival cell number (right) of N2a neurons were calculated by staining with trypan blue dye (n=3). The survival rate was calculated by staining with trypan blue dye. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. Two-way ANOVA followed by Sidak's multiple comparison test. a-dP<0.05, different letters indicate statistically significant differences between groups. STZ, Streptozotocin; LPS, lipopolysaccharide; MCS, microglial culture supernatant; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

Without STZ stimulation, both LPSx1-MCS and LPSx3-MCS had little effect on neuronal survival. By contrast, with STZ stimulation, LPSx1-MCS and LPSx3-MCS exhibited the opposite results in neuronal survival (Fig. 2B and C). As shown in Fig. 2B, STZ stimulation reduced the number of neurons when cultured in control MCS. By contrast, when cultured in LPSx3-MCS, no significant decrease in neuron number was observed even after STZ stimulation. Moreover, cellular viability analysis by staining with trypan blue revealed that LPSx1-MCS exacerbated the decrease in survival neuron number by STZ stimulation, whereas LPSx3-MCS suppressed STZ-induced neuronal cell death (Fig. 2C). The absolute number of surviving neurons calculated from the survival rate demonstrated that LPSx3-MCS significantly increased neuronal viability after STZ stimulation compared to control MCS and LPSx1-MCS. These results indicated that LPSx3-MCS prevents STZ-induced neuronal death.

Promotion of B-cell lymphoma-extra large (Bcl-XL) gene expression in STZ-stimulated neurons by LPSx3-microglia

The gene expression of Bcl2 encoding B-cell leukemia/lymphoma-2 (Bcl-2) and Bcl2l1 encoding Bcl-XL was analyzed in neurons after STZ stimulation in LPS-treated MCS (Fig. 3). The results showed that LPSx1-MCS suppressed Bcl2 and Bcl2l1 expression in neurons after STZ stimulation. By contrast, LPSx3-MCS promoted Bcl2l1 expression in neurons after STZ stimulation. Bcl2 gene expression also tended to be promoted by LPSx3-MCS, although no significant difference was observed. Control MCS did not affect Bcl2 and Bcl2l1 expression following STZ stimulation. It was also confirmed that there was no significant difference in Bcl2 and Bcl2l1 expression between the groups without STZ stimulation. These results indicated that Bcl-XL might be involved in the prevention mechanism of STZ-induced neuronal cell death by LPSx3-microglia.

Figure 3.

Promotion of Bcl-XL gene expression in STZ-stimulated neurons by the culture supernatant of LPSx3-microglia. Relative mRNA expression of Bcl2 and Bcl2l1 in N2a neurons was measured by reverse transcription-quantitative PCR using the 2−∆∆Cq method 24 h after STZ stimulation in LPS-treated MCS (n=3). Data were normalized by GAPDH and expressed as the relative fold-change to unstimulated cells. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. Two-way ANOVA followed by Sidak's multiple comparison test. a-cP<0.05, different letters indicate statistically significant differences between groups. Bcl-XL, B-cell lymphoma-extra large; STZ, Streptozotocin; LPS, lipopolysaccharide; MCS, microglial culture supernatant; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

Promotion of gene expression of glucose-dependent insulinotropic polypeptide (GIP) receptor (GIPR) in STZ-stimulated neurons by LPSx3-microglia

GIP and glucagon-like peptide-1 (GLP-1), also called incretins, are gastrointestinal hormones that promote insulin secretion from pancreatic β-cells. Previous studies have also shown that GIP and GLP-1 have neuroprotective effects through GIPR or GLP-1 receptor (GLP1R) on neurons (29–31). Therefore, the gene expression of Gipr encoding GIPR and Glp1r encoding GLP1R was analyzed in neurons after STZ stimulation in LPSx3-MCS.

The results showed that the expression of Gipr, but not Glp1r, was significantly promoted by LPSx3-MCS in neurons following STZ stimulation (Fig. 4). By contrast, control MCS and LPSx1-MCS did not affect Gipr and Glp1r expression. Therefore, GIPR may also be involved in the prevention mechanism of STZ-induced neuronal cell death by LPSx3-microglia.

Figure 4.

Promotion of Gipr gene expression in STZ-stimulated neurons by the culture supernatant of LPSx3-microglia. Relative mRNA expression of incretin receptor genes in N2a neurons was measured by reverse transcription-quantitative PCR using the 2−∆∆Cq method 24 h after STZ stimulation in LPS-treated MCS (n=3). Data were normalized by GAPDH and expressed as the relative fold-change to unstimulated cells. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. Two-way ANOVA followed by Sidak's multiple comparison test. a-cP<0.05, different letters indicate statistically significant differences between groups. Gipr, glucose-dependent insulinotropic polypeptide receptor; STZ, Streptozotocin; LPS, lipopolysaccharide; MCS, microglial culture supernatant; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

Unchanging glucose metabolism regulatory gene expression in STZ-stimulated neurons by LPSx3-microglia

The expression of the following representative genes related to glucose metabolism regulation was analyzed in neurons after STZ stimulation in LPSx3-MCS: Genes encoding insulin receptor (InsR), insulin-like growth factor-I receptor (IGF1R) and glucose transporter 3 (GLUT3).

As shown in Fig. 5, LPSx1-MCS suppressed Glut3 expression after STZ stimulation. InsR gene expression also tended to be suppressed by LPSx1-MCS, although there was no significant difference. By contrast, LPSx3-MCS and control MCS did not suppress the expression of glucose metabolism regulatory genes in neurons after STZ stimulation. It was confirmed that there was almost no significant difference in the expression of the glucose metabolism regulatory genes between the groups without STZ stimulation. These results indicated that LPSx3-MCS does not affect the expression of these typical glucose metabolism genes.

Figure 5.

Unaltered glucose metabolism-regulatory gene expression in STZ-stimulated neurons by the culture supernatant of LPSx3-microglia. Relative mRNA expression of glucose metabolism regulatory genes in N2a neurons was measured by reverse transcription-quantitative PCR using the 2−∆∆Cq method 24 h after STZ stimulation in LPS-treated MCS (n=3). Data were normalized by GAPDH and expressed as the relative fold-change to unstimulated cells. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. Two-way ANOVA followed by Sidak's multiple comparison test. a-cP<0.05, different letters indicate statistically significant differences between groups. STZ, Streptozotocin; LPS, lipopolysaccharide; MCS, microglial culture supernatant; InsR, insulin receptor; Igf1r, insulin-like growth factor-I receptor; Glut3, glucose transporter 3; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

TrkB-dependent neuroprotection of LPSx3-microglia

To confirm that NT-4/5 is involved in the neuroprotective effect of LPSx3-MCS, TrkB, a receptor of NT-4/5, was inhibited by ANA-12. N2a neurons were cultured in LPS-treated MCS with the TrkB inhibitor ANA-12 (5–30 µM) followed by STZ stimulation. The total neuron number was counted 24 h after STZ stimulation.

The results demonstrated that ANA-12 suppressed the neuroprotective effect of LPSx3-MCS in a concentration-dependent manner (Fig. 6A). By contrast, ANA-12 had little effect on the number of STZ-stimulated neurons treated with LPSx1-MCS and control MCS. As shown in Fig. 6B, this tendency was typical when stimulated with ANA-12 at a 5 µM concentration. Specifically, the number of neurons after STZ stimulation was significantly reduced by 20% by 5 µM ANA-12 treatment in LPSx3-MCS, but was not changed by 5 µM ANA-12 treatment in control MCS or LPSx1-MCS. These results indicated that the neuroprotective effect of LPSx3-MCS is TrkB dependent.

Figure 6.

TrkB-dependent neuroprotective effect of LPSx3-microglia. Inhibition of the neuroprotective effect of LPSx3 microglia by ANA-12, a TrkB inhibitor. N2a neurons were cultured in LPS-treated MCS with ANA-12 at (A) 5, 10, 20 and 30 µM or (B) 5 µM followed by STZ stimulation (n=3). N2a neurons were detached 24 h after STZ stimulation by treatment with 0.25% trypsin and the number of total cells was counted. Data are presented as the mean ± SEM of each group and are representative of two independent experiments. Two-way ANOVA followed by Sidak's multiple comparison test. *P<0.05 vs. LPSx0; #P<0.05 vs. LPSx1. a-cP<0.05, different letters indicate statistically significant differences between groups. TrkB, tyrosine receptor kinase B; LPS, lipopolysaccharide; MCS, microglial culture supernatant; STZ, Streptozotocin; LPSx0, no treatment; LPSx1, single treatment with LPS; LPSx3, treatment with LPS three times every 24 h.

Discussion

NT-4/5 is a neurotrophic factor with neuroprotective effects (20–23). In our previous study, NT-4/5 gene expression was promoted in LPSx3-microglia, suggesting that LPSx3-microglia have a neuroprotective potential (19).

First, it was confirmed that NT-4/5 production was promoted in LPSx3-microglia even at the protein level (Fig. 1A), which was consistent with the gene expression alterations reported in our previous study (19). Next, as NT-4/5 could be induced by PGE2 (27), the PGE2 level in LPSx3-microglia was analyzed. The results showed that the gene expression of Ptges (PGE2 synthase) and PGE2 production in LPSx3-microglia remained as high as that of LPSx1-microglia and were not suppressed (Fig. 1B). The promotion of PGE2 in LPSx3-microglia was consistent with a previous report (32). Therefore, PGE2 may be involved in NT-4/5 induction in LPSx3-microglia.

Furthermore, signal transduction analysis revealed that c-Jun phosphorylation in LPSx3-microglia was as high as in LPSx1-microglia (Fig. 1C). The transcription factor AP-1 composed of c-Jun is activated in both the cyclooxygenase 2-inducing signal involved in PGE2 synthesis (33,34) and the downstream signal of PGE2 (35,36). In this connection, AP-1 has also been reported to mediate the positive feedback of brain-derived neurotrophic factor (BDNF), a neurotrophin that acts as a ligand for TrkB as well as NT-4/5 (37). Hence, it can be assumed that NT-4/5 production in LPSx3-microglia may be induced by c-Jun-mediated PGE2 signaling.

Given the increased NT-4/5 secretion in LPSx3-microglia, whether LPSx3-MCS prevented STZ-induced neuronal damage was then examined. The result demonstrated that STZ-induced neuronal cell death was exacerbated by LPSx1-MCS but prevented by LPSx3-MCS (Fig. 2). Incidentally, it has been reported that there is no difference in neuronal survival between culture in MCS and culture in conditioned medium (17). Conventionally, only inflammatory microglia induced by a single stimulation of high-dose LPS have been featured and there is a deep-rooted general recognition that LPS is a substance that exacerbates neuronal damage (9–11). In contrast to single LPS stimulation, the present study demonstrated that repetitive low-dose LPS stimulation prevents STZ-induced neuronal cell death via microglia. In fact, similar to the results of the present study, the neuroprotective effects of microglia transformed by the stimulus of repetitive low-dose LPS have been reported in models of neurological disorders other than DAND, such as Alzheimer's disease and cerebral ischemia, in vitro (17) and in vivo (12–16), supporting the results of the present study.

Next, gene expression of STZ-stimulated neurons treated with LPSx3-MCS was analyzed in order to understand the mechanism by which LPSx3-microglia prevent STZ-induced neuronal cell death.

Since NT-4/5 could suppress neuronal damage (38), the gene expression of Bcl-XL and Bcl-2 was analyzed first. The results showed that Bcl-XL gene expression in neurons after STZ stimulation was suppressed by LPSx1-MCS but was promoted by LPSx3-MCS (Fig. 3). As Bcl-XL expression is induced downstream of TrkB (39), a receptor for NT-4/5, Bcl-XL may contribute to the neuroprotective effect of LPSx3-microglia.

The gene expression of the incretin receptors GIPR and GLP1R, which have been reported to have neuroprotective effects, was analyzed. The results showed that LPSx3-MCS promoted GIPR gene expression in neurons after STZ stimulation (Fig. 4). It has been reported that GIPR activation provides a neuroprotective effect through the induction of antioxidant and neurotrophic factors (8,29–31,40). It has also been reported that TrkB activation potentiates incretin receptor signals (41). Therefore, GIPR may also be involved in the neuroprotective effect of LPSx3-microglia.

As it is known that a single LPS stimulation suppresses glucose metabolism signals (42), the expression of glucose metabolism regulatory genes was analyzed. LPSx1-MCS suppressed GLUT3 gene expression in neurons after STZ stimulation (Fig. 5). By contrast, LPSx3-MCS did not induce the suppression of the typical glucose metabolism regulatory gene expression in neurons after STZ stimulation.

Finally, to verify whether the prevention of STZ-induced neuronal cell death by LPSx3-microglia depended on NT-4/5, TrkB, the receptor for NT-4/5, was inhibited. The result demonstrated that the effect of LPSx3-microglia on preventing STZ-induced neuronal cell death is TrkB dependent (Fig. 6). As BDNF, another ligand for TrkB, is not induced in LPSx3-microglia (19), it was hypothesized that the TrkB-dependent prevention of neuronal cell death by LPSx3-microglia may be mediated by NT-4/5.

The present study did not exclude the effects of neuroprotective molecules other than NT-4/5, because LPSx3-microglia also promote the expression of neuroprotective genes other than NT-4/5 (19). However, considering the current situation that the neuroprotective mechanism by LPSx3-microglia is unclear, it is an important achievement that at least NT-4/5 is likely to be a key factor in the neuroprotective mechanism of LPSx3-microglia. Although the number of repetitions of the experiment was slightly small, almost no variation between the experiments was observed, indicating the validity of these results. To elucidate the neuroprotective mechanism of LPSx3-microglia using the present study as a foothold, further research is needed, including protein expression analysis of Bcl-XL and GIPR, gene knockdown and neutralization experiments.

The current treatment for DAND is glucose control and lifestyle modifications for mild cases. In severe cases, pain remedies and blood flow improvers are prescribed, both of which are symptomatic treatments (43). In addition, an aldose reductase inhibitor for suppressing sorbitol production, which is one of the causative substances of DAND, may also be prescribed, but the problem is that it has strong side effects (44). Therefore, treatment of DAND is very difficult due to the lack of radical pathogenetic therapy. New treatments using polyphenols are expected, but they have not yet been clinically applied to the research stage (45). Given this situation, further therapeutic research is needed to resolve DAND. The present study found the neuroprotective effect of microglia transformed by the stimulus of repetitive low-dose LPS as a novel potential treatment for DAND. Considering the various characteristics of microglia as immune cells, such as phagocytic activity, inflammatory regulation and tissue repair (46), microglia transformed by the stimulus of repetitive low-dose LPS may be expected to have a multitarget therapeutic effect.

In conclusion, the results demonstrated that the culture supernatants of LPSx3-microglia prevent STZ-induced neuronal cell death. It also found that the promotion of gene expression of Bcl-XL and incretin receptor GIPR may be involved in the neuroprotective mechanism of LPSx3-microglia. Moreover, the TrkB inhibitor suppressed the neuroprotective effect of LPSx3-microglia, suggesting that NT-4/5 is involved in this mechanism. These findings may help understand the protective role of microglia in DAND, where these cells are usually regarded as inflammatory or harmful.

Acknowledgements

Not applicable.

Funding

The present study was funded by the Control of Innate Immunity, Collaborative Innovation Partnership and supported by a grant from the Cross-ministerial Strategic Innovation Promotion Program (grant no. SIP 14533073) from the Council for Science from Technology and Innovation in the Cabinet Office of the Japanese Government and the National Agriculture and Food Research Organization.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HM, HI, CK and GIS conceptualized the study and coordinated the experiments. HM, KY and MY performed the experiments. HM, KY and HI confirm the authenticity of all the raw data. HM performed data curation and formal analysis. HI, CK and GIS acquired funding and administrated the project. HM wrote the manuscript as supervised by HI, CK and GIS, with contributions from all authors. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Feldman EL, Callaghan BC, Pop-Busui R, Zochodne DW, Wright DE, Bennett DL, Bril V, Russell JW and Viswanathan V: Diabetic neuropathy. Nat Rev Dis Primers. 5:422019. View Article : Google Scholar : PubMed/NCBI

2 

Biessels GJ and Despa F: Cognitive decline and dementia in diabetes: Mechanisms and clinical implications. Nat Rev Endocrinol. 14:591–604. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Grieb P: Intracerebroventricular streptozotocin injections as a model of Alzheimer's disease: In search of a relevant mechanism. Mol Neurobiol. 53:1741–1752. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Sun P, Ortega G, Tan Y, Hua Q, Riederer PF, Deckert J and Schmitt-Böhrer AG: Streptozotocin impairs proliferation and differentiation of adult hippocampal neural stem cells in vitro-correlation with alterations in the expression of proteins associated with the insulin system. Front Aging Neurosci. 10:1452018. View Article : Google Scholar : PubMed/NCBI

5 

Isaev NK, Genrikhs EE, Voronkov DN, Kapkaeva MR and Stelmashook EV: Streptozotocin toxicity in vitro depends on maturity of neurons. Toxicol Appl Pharmacol. 348:99–104. 2018. View Article : Google Scholar : PubMed/NCBI

6 

Biswas J, Goswami P, Gupta S, Joshi N, Nath C and Singh S: Streptozotocin induced neurotoxicity involves Alzheimer's related pathological markers: A study on N2A cells. Mol Neurobiol. 53:2794–2806. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Pepe G, De Maglie M, Minoli L, Villa A, Maggi A and Vegeto E: Selective proliferative response of microglia to alternative polarization signals. J Neuroinflammation. 14:2362017. View Article : Google Scholar : PubMed/NCBI

8 

Spielman LJ, Gibson DL and Klegeris A: Incretin hormones regulate microglia oxidative stress, survival and expression of trophic factors. Eur J Cell Biol. 96:240–253. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Zhan X, Stamova B and Sharp FR: Lipopolysaccharide associates with amyloid plaques, neurons and oligodendrocytes in Alzheimer's disease brain: A review. Front Aging Neurosci. 10:422018. View Article : Google Scholar : PubMed/NCBI

10 

Batista CRA, Gomes GF, Candelario-Jalil E, Fiebich BL and de Oliveira ACP: Lipopolysaccharide-induced neuroinflammation as a bridge to understand neurodegeneration. Int J Mol Sci. 20:22932019. View Article : Google Scholar : PubMed/NCBI

11 

Deng I, Corrigan F, Zhai G, Zhou XF and Bobrovskaya L: Lipopolysaccharide animal models of Parkinson's disease: Recent progress and relevance to clinical disease. Brain Behav Immun-Heal. 4:1000602020. View Article : Google Scholar

12 

Chen Z, Jalabi W, Shpargel KB, Farabaugh KT, Dutta R, Yin X, Kidd GJ, Bergmann CC, Stohlman SA and Trapp BD: Lipopolysaccharide-induced microglial activation and neuroprotection against experimental brain injury is independent of hematogenous TLR4. J Neurosci. 32:11706–11715. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Hayakawa K, Okazaki R, Morioka K, Nakamura K, Tanaka S and Ogata T: Lipopolysaccharide preconditioning facilitates M2 activation of resident microglia after spinal cord injury. J Neurosci Res. 92:1647–1658. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Wendeln AC, Degenhardt K, Kaurani L, Gertig M, Ulas T, Jain G, Wagner J, Häsler LM, Wild K, Skodras A, et al: Innate immune memory in the brain shapes neurological disease hallmarks. Nature. 556:332–338. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Ohgomori T and Jinno S: Modulation of neuropathology and cognitive deficits by lipopolysaccharide preconditioning in a mouse pilocarpine model of status epilepticus. Neuropharmacology. 176:1082272020. View Article : Google Scholar : PubMed/NCBI

16 

Mizobuchi H and Soma GI: Low-dose lipopolysaccharide as an immune regulator for homeostasis maintenance in the central nervous system through transformation to neuroprotective microglia. Neural Regen Res. 16:1928–1934. 2021. View Article : Google Scholar : PubMed/NCBI

17 

Cacci E, Ajmone-Cat MA, Anelli T, Biagioni S and Minghetti L: In Vitro neuronal and glial differentiation from embryonic or adult neural precursor cells are differently affected by chronic or acute activation of microglia. Glia. 56:412–425. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Twayana KS, Chaudhari N and Ravanan P: Prolonged lipopolysaccharide exposure induces transient immunosuppression in BV2 microglia. J Cell Physiol. 234:1889–1903. 2019. View Article : Google Scholar : PubMed/NCBI

19 

Mizobuchi H, Yamamoto K, Tsutsui S, Yamashita M, Nakata Y, Inagawa H, Kohchi C and Soma GI: A unique hybrid characteristic having both pro- and anti-inflammatory phenotype transformed by repetitive low-dose lipopolysaccharide in C8-B4 microglia. Sci Rep. 10:89452020. View Article : Google Scholar : PubMed/NCBI

20 

Royo N, Conte V, Saatman KE, Shimizu S, Belfield CM, Soltesz KM, Davis JE, Fujimoto ST and McIntosh TK: Hippocampal vulnerability following traumatic brain injury: A potential role for neurotrophin-4/5 in pyramidal cell neuroprotection. Eur J Neurosci. 23:1089–1102. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Royo NC, LeBold D, Magge SN, Chen I, Hauspurg A, Cohen AS and Watson DJ: Neurotrophin-mediated neuroprotection of hippocampal neurons following traumatic brain injury is not associated with acute recovery of hippocampal function. Neuroscience. 148:359–370. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Malik SZ, Motamedi S, Royo NC, Lebold D and Watson DJ: Identification of potentially neuroprotective genes upregulated by neurotrophin treatment of CA3 neurons in the injured brain. J Neurotrauma. 28:415–430. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Machalińska A, Kawa M, Pius-Sadowska E, Stępniewski J, Nowak W, Rogińska D, Kaczyńska K, Baumert B, Wiszniewska B, Józkowicz A, et al: Long-term neuroprotective effects of NT-4-engineered mesenchymal stem cells injected intravitreally in a mouse model of acute retinal injury. Invest Ophthalmol Vis Sci. 54:8292–8305. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Arnold SE, Arvanitakis Z, Macauley-Rambach SL, Koenig AM, Wang HY, Ahima RS, Craft S, Gandy S, Buettner C, Stoeckel LE, et al: Brain insulin resistance in type 2 diabetes and Alzheimer disease: Concepts and conundrums. Nat Rev Neurol. 14:168–181. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

R Core Team, . R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna 2019. https://www.R-project.org/

27 

Kanda N, Koike S and Watanabe S: Prostaglandin E2 enhances neurotrophin-4 production via EP3 receptor in human keratinocytes. J Pharmacol Exp Ther. 315:796–804. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Deng H, Maitra U, Morris M and Li L: Molecular mechanism responsible for the priming of macrophage activation. J Biol Chem. 288:3897–3906. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Ji C, Xue GF, Li G, Li D and Hölscher C: Neuroprotective effects of glucose-dependent insulinotropic polypeptide in Alzheimer's disease. Rev Neurosci. 27:61–70. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Yu YW, Hsieh TH, Chen KY, Wu JC, Hoffer BJ, Greig NH, Li Y, Lai JH, Chang CF, Lin JW, et al: Glucose-dependent insulinotropic polypeptide ameliorates mild traumatic brain injury-induced cognitive and sensorimotor deficits and neuroinflammation in rats. J Neurotrauma. 33:2044–2054. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Seino Y and Yabe D: Glucose-dependent insulinotropic polypeptide and glucagon-like peptide-1: Incretin actions beyond the pancreas. J Diabetes Investig. 4:108–130. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Ajmone-Cat MA, Nicolini A and Minghetti L: Prolonged exposure of microglia to lipopolysaccharide modifies the intracellular signaling pathways and selectively promotes prostaglandin E 2 synthesis. J Neurochem. 87:1193–1203. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Park JY, Chung TW, Jeong YJ, Kwak CH, Ha SH, Kwon KM, Abekura F, Cho SH, Lee YC, Ha KT, et al: Ascofuranone inhibits lipopolysaccharide-induced inflammatory response via NF-kappaB and AP-1, p-ERK, TNF-α, IL-6 and IL-1β in RAW 264.7 macrophages. PLoS One. 12:e01713222017. View Article : Google Scholar : PubMed/NCBI

34 

Slomiany BL and Slomiany A: Proinflammatory signaling cascades of periodontopathic oral pathogen porphyromonas gingivalis. J Biosci Med. 6:63–88. 2018.

35 

Yen JH, Kocieda VP, Jing H and Ganea D: Prostaglandin E2 induces matrix metalloproteinase 9 expression in dendritic cells through two independent signaling pathways leading to activator protein 1 (AP-1) activation. J Biol Chem. 286:38913–38923. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Ye Y, Lin P, Zhu J, Jeschke U and von Schönfeldt V: Multiple roles of prostaglandin E2 receptors in female reproduction. Endocrines. 1:22–34. 2020. View Article : Google Scholar : PubMed/NCBI

37 

Tuvikene J, Pruunsild P, Orav E, Esvald EE and Timmusk T: AP-1 transcription factors mediate BDNF-positive feedback loop in cortical neurons. J Neurosci. 36:1290–1305. 2016. View Article : Google Scholar : PubMed/NCBI

38 

da Silva Meirelles L, Simon D and Regner A: Neurotrauma: The crosstalk between neurotrophins and inflammation in the acutely injured brain. Int J Mol Sci. 18:10822017. View Article : Google Scholar : PubMed/NCBI

39 

Sakharnova TA, Vedunova MV and Mukhina IV: Brain-derived neurotrophic factor (BDNF) and its role in the functioning of the central nervous system. Neurochem J. 6:251–259. 2012. View Article : Google Scholar

40 

Faivre E, Gault VA, Thorens B and Hölscher C: Glucose-dependent insulinotropic polypeptide receptor knockout mice are impaired in learning, synaptic plasticity, and neurogenesis. J Neurophysiol. 105:1574–1580. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Kalwat MA, Huang Z, McGlynn K and Cobb M: BDNF/TrkB signaling in pancreatic islet beta cells. 4000102018.

42 

Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D, Neyrinck AM, Fava F, Tuohy KM, Chabo C, et al: Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes. 56:1761–1772. 2007. View Article : Google Scholar : PubMed/NCBI

43 

Pop-Busui R, Boulton AJ, Feldman EL, Bril V, Freeman R, Malik RA, Sosenko JM and Ziegler D: Diabetic neuropathy: A position statement by the American diabetes association. Diabetes Care. 40:136–154. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Javed S, Petropoulos IN, Alam U and Malik RA: Treatment of painful diabetic neuropathy. Ther Adv Chronic Dis. 6:15–28. 2015. View Article : Google Scholar : PubMed/NCBI

45 

Naseri R, Farzaei F, Fakhri S, El-Senduny FF, Altouhamy M, Bahramsoltani R, Ebrahimi F, Rahimi R and Farzaei MH: Polyphenols for diabetes associated neuropathy: Pharmacological targets and clinical perspective. Daru. 27:781–798. 2019. View Article : Google Scholar : PubMed/NCBI

46 

Li Q and Barres BA: Microglia and macrophages in brain homeostasis and disease. Nat Rev Immunol. 18:225–242. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mizobuchi H, Yamamoto K, Yamashita M, Inagawa H, Kohchi C and Soma G: Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide. Mol Med Rep 24: 687, 2021.
APA
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., & Soma, G. (2021). Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide. Molecular Medicine Reports, 24, 687. https://doi.org/10.3892/mmr.2021.12328
MLA
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., Soma, G."Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide". Molecular Medicine Reports 24.4 (2021): 687.
Chicago
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., Soma, G."Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide". Molecular Medicine Reports 24, no. 4 (2021): 687. https://doi.org/10.3892/mmr.2021.12328
Copy and paste a formatted citation
x
Spandidos Publications style
Mizobuchi H, Yamamoto K, Yamashita M, Inagawa H, Kohchi C and Soma G: Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide. Mol Med Rep 24: 687, 2021.
APA
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., & Soma, G. (2021). Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide. Molecular Medicine Reports, 24, 687. https://doi.org/10.3892/mmr.2021.12328
MLA
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., Soma, G."Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide". Molecular Medicine Reports 24.4 (2021): 687.
Chicago
Mizobuchi, H., Yamamoto, K., Yamashita, M., Inagawa, H., Kohchi, C., Soma, G."Prevention of streptozotocin‑induced Neuro‑2a cell death by C8‑B4 microglia transformed with repetitive low‑dose lipopolysaccharide". Molecular Medicine Reports 24, no. 4 (2021): 687. https://doi.org/10.3892/mmr.2021.12328
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team