This article is mentioned in:

Introduction

Epilepsy is a chronic neurological disorder characterized by recurrent spontaneous seizures. With 65 million cases worldwide, epilepsy is the third-largest contributor to the global burden of neurological diseases (1,2). According to a meta-analysis of international studies, the incidence of epilepsy is 6.1 per 10,000, with an annual incidence of 6.78 per 10,000 (3). Individuals with epilepsy often face numerous other health problems and co-morbidities are more burdensome than the seizures themselves. Seizures cause changes in the brain structure and function that manifest as cognitive and neuropsychological impairment. Frequent seizures, especially persistent epilepsy, repeatedly cause oxidative stress, loss of neurons in the hippocampus or internal olfactory cortex that are closely associated with cognition, neurogenesis, changes in growth factors such as brain-derived neurotrophic factor, and inflammation in the brain (4,5). If seizures are not properly treated and controlled, permanent cognitive impairment eventually occurs (6). Approximately 70–80% of patients with chronic epilepsy have cognitive impairment (7).

Adiponectin (ADPN) was first identified in 1995 and is one of the most widely studied adipokines to date (8). ADPN receptors (AdipoRs) are expressed in different parts of the brain, indicating its role in the central nervous system (CNS). ADPN serves important roles in a number of physiopathological processes in the CNS, including cognitive function (9,10). AdipoR1, AdipoR2 and T-cadherin are three of the known AdipoRs, and both AdipoR1 and AdipoR2 are expressed in the brain, suggesting that ADPN has physiological functions outside of peripheral metabolic homeostasis (11). Different neurological diseases have been linked to AdipoR1 and AdipoR2 signaling (12). When the blood-brain barrier is compromised due to pathology, ADPN may infiltrate the cerebrospinal fluid and brain parenchyma (13). In several CNS illness models, ADPN has been demonstrated to have a protective effect. For instance, exogenous ADPN supplementation or lipocalin overexpression lessen ischemic brain injury and enhance neurological function (14,15). ADPN may serve a role in the emergence of Alzheimer's disease (AD) because gene ablation or knockdown of lipocalin or lipocalin receptors causes severe brain alterations similar to AD, including memory loss and mood disorders (16,17). However, the effects and underlying mechanisms of lipocalin on cognitive impairment in patients with epilepsy remain to be elucidated.

The present study explored the relationship between ADPN and cognitive impairment in epilepsy using Spearman's correlation analysis in patients with epilepsy and healthy controls. It also investigated the effect of the AdipoR agonist AdipoRon on cognition in epileptic rats and its underlying molecular mechanism.

Materials and methods

Clinical sample collection

The present study was conducted in collaboration with Dr Qian Xue from The First Affiliated Hospital of Hebei North University (Zhangjiakou, China). Dr Qian Xue participated in the study design and provided clinical samples collected from The First Affiliated Hospital of Hebei North University for the current study. Clinical samples were collected from 20 patients with epilepsy treated at The First Affiliated Hospital of Hebei North University between January 2022 and September 2022, as well as 20 healthy volunteers who came to the hospital for physical examination during the same period. The inclusion criteria for the epilepsy group were: Patients with epilepsy who met the diagnosis (18) and had a typical history of seizures, age >18 years, clear mind, possessing a certain ability to understand and be able to cooperate to complete the study, and intracranial magnetic resonance imaging and computed tomography examination showing no lesions. The patients and their families consented to the present study and the study was approved by the Clinical Research Ethics Committee of The First Affiliated Hospital of Hebei North University (approval no. W2023016; Zhangjiakou, China). The inclusion criteria for the healthy control group were: Healthy volunteers were admitted for physical examinations during the same period and confirmed to be in good health, and demonstrated the ability to cooperate with examiners. They possessed sufficient understanding to complete the study and voluntarily signed the informed consent form.

The exclusion criteria were as follows: Patients with cognitive impairment due to other reasons such as dementia or intracranial injury, patients with a history of anxiolytic, antidepressant, hormonal or immunotherapy therapy within the past 3 months, patients with other pre-existing mental disorders, patients with cerebral hemorrhage, cerebral infarction or other central system diseases, patients with hypertension, hyperlipidemia and diabetes, and patients with infectious diseases or combined liver, kidney and other organ dysfunction.

Venous blood (3 ml) was collected after >6 h of fasting. After resting at room temperature for 2 h, serum was isolated from the blood via centrifugation at 1,000 × g at 4°C for 20 min and kept at −80°C.

ELISA

The levels of ADPN in the serum were quantified using a human ADPN ELISA kit (cat. no. BMS2032-2; Thermo Fisher Scientific, Inc.). The blood was centrifuged at 20°C (1,500 × g) for 10 min. The serum was added to a microplate precoated with monoclonal antibodies specific to human serum ADPN. After washing with Tris-buffered saline, the amount of ADPN was determined by adding streptavidin-conjugated enzyme, substrate and stop solution in sequence. The optical density was measured at the specified wavelength to calculate the ADPN concentration.

Assessment of cognition

The following assessment scales were collected for all subjects: Montreal cognitive assessment (MoCA), Boston naming test (BNT), Symbol digit modalities test (SDMT) and Rey auditory verbal learning test (RAVLT) (19–22). This was performed in a quiet room to avoid external disturbances and the patients were seizure-free for 24 h before the examination. The purpose of the test was explained to the subjects before the test was performed.

Animals and grouping

A total of 45 male specific pathogen-free Sprague Dawley rats aged 6–8 weeks (200–220 g) were purchased from SPF Biotechnology Co., Ltd. [cat. no. SCXK(jing) 2019-0010; qualification certificate no. 110324220104098817]. The rats had free access to normal sterile food (complete feed included corn, soybean meal, fish meal, calcium hydrogen phosphate, multiple vitamins, multiple trace elements and amino acids) and water. The rats were housed in an SPF animal facility with a temperature range of 20–25°C, relative humidity range of 40–70% and 12-h light/dark cycle. The animals were adaptively housed in the animal room environment for 1 week before the experiment. The animal study was approved by the Research Ethics Committee of The Second Hospital of Hebei Medical University (approval no. 2023-AE075; Shijiazhuang, China).

The 45 rats were randomly divided into two groups: Epileptic group (n=35) and healthy group (n=10). After modelling, 22 rats with successful modeling from the epileptic group were selected and randomly divided into the model + AdipoRon group (n=12) and the model group (n=10).

Induced status epilepticus (SE)

The rat induced SE model was established using protocols adopted from previous studies (23,24). A total of 35 rats in the model group were injected intraperitoneally with 127 mg/kg of lithium chloride (cat. no. 310468; MilliporeSigma), followed by 1 mg/kg of atropine sulphate (cat. no. PHR1379; MilliporeSigma) 18 h later and 50 mg/kg of pilocarpine (cat. no. PHR1494; MilliporeSigma) 30 min later. If SE was not induced after 30 min, pirocarbazine could be given repeatedly for a maximum of five times. If no seizure occurred after five times, the model was considered to not have been successfully established. In 13 rats, the model was not successfully established and these rats were maintained until their end-of-life occurred naturally. A total of 22 rats were selected from the epileptic group and grouped into 10 model rats (model group) and 12 rats in the drug intervention (model + AdipoRon) group.

The drug administration started 3 days after the end of modelling: Blank control group, intraperitoneal injection of PBS containing 1% DMSO for 21 days; model group, intraperitoneal injection of PBS containing 1% DMSO for 21 days; and model + AdipoRon group, intraperitoneal injection of AdipoRon (5 mg/kg; cat. no. HY-15848; MedChemExpress) for 21 days.

Morris water maze test

The Morris water maze experiment was conducted at week 4.

Positioning navigation

Each rat was subjected to a positioning navigation experiment over a total of 5 days, starting at the same time point each day, four times a day. In the experiment, the rats faced the wall of the pool and were placed in the water from each of the four quadrants. The time from when the rat entered the water to when it found the underwater platform and stood on it was recorded as the latency period (sec). After the rat found the platform, it was allowed to remain on the platform for 15 sec to reinforce its memory. If the rat failed to find the platform within 120 sec, it was guided from the water to the platform and remained there for 15 sec, with the latency period recorded as 120 sec. After the experiment in the water, the rats were kept warm and cleaned.

Spatial exploration

On day 6, the platform hidden under the water surface was removed and the midpoint of the quadrant opposite the platform, that is the northeast quadrant, was chosen as the entry point, and the number of times the rat crossed the platform within 2 min and the total time spent in the platform quadrant were recorded.

Visible platform

The platform was placed in the opposite quadrant of the original platform, with 1 cm of the platform above water and a small blue flag was placed on the platform as a marker. The rats were placed in the water with their heads facing the platform from the opposite quadrant of the platform, and the latency to evade and the average swimming speed were recorded.

Nissl staining

At the endpoint, which was the fifth week after modeling, rats were sacrificed by CO2 inhalation (60% volume displacement per min) followed by cervical dislocation, according to the American Veterinary Medical Association guidelines for the euthanasia of rodents (25). Tissues samples were then collected for Nissl staining.

The staining procedure was as follows: Brain tissue was fixed in 10% paraformaldehyde at 20°C for 8 h, embedded in paraffin and cut into 4-µm sections. Sections were degreased by immersion in 70% ethanol solution overnight at 4°C, rinsed in double-distilled water for 3 min and incubated in 1% methyl violet (cat. no. 69710; MilliporeSigma) for 5 min at 20–24°C. Color separation was controlled under the microscope with 0.05% glacial acetic acid. Tissues were dehydrated in an alcohol gradient, cleared in xylene and sealed in neutral resin. The number of intact pyramidal neurons in the dentate gyrus, CA1 and CA3 regions of the hippocampus in a 1-mm2 area was observed, and images were captured under an Olympus light microscope (BX51; Olympus Corporation) with OlyVIA software (version 4.1.1; Olympus Corporation).

Reverse transcription-quantitative PCR (RT-qPCR)

Rat brain samples were collected for RNA isolation according to the manufacturer's instructions. Total RNA was extracted using TRIzol® reagent (cat. no. 15596026; Thermo Fisher Scientific, Inc.). cDNA was generated using reverse transcriptase according to the manufacturer's instructions (cat. no. K1691; Thermo Fisher Scientific, Inc.) at 42°C for 60 min. The SYBR Premix Ex Taq kit (cat. no. YB042; Shanghai Yubo Biotechnology Co., Ltd.) was used for the qPCR assay using the Real-Time PCR Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The qPCR conditions were: Initial denaturation at 94°C for 2 min, followed by denaturation at 94°C for 40 sec, annealing at 60.5°C for 60 sec and elongation at 72°C for 40 sec for a total of 40 cycles, followed by a final elongation at 72°C for 10 min. GAPDH was used as an endogenous control. The relative expression of genes was calculated using the 2−ΔΔCq method (26). PCR primers were used as shown in Table I.

Table I. PCR primers.

Table I.

PCR primers.

Gene	Primer (5′-3′)
AdipoR1 forward	AACTGGACTATTCAGGGATTGC
AdipoR1 reverse	ACCATAGAAGTGGACGAAAGC
AdipoR2 forward	CCACCATAGGGCAGATAGG
AdipoR2 reverse	TGAACAAAGGCACCAGCAA
GAPDH forward	AAGCCCATCACCATCTTCCAG
GAPDH reverse	AGAAGACTGTGGATGGCCCCT

[i] AdipoR, adiponectin receptor.

Western blotting

According to the manufacturer's instructions, total proteins from rat brain tissues were extracted using RIPA buffer (cat. no. P0013B; Beyotime Institute of Biotechnology). The Enhanced BCA Protein Assay Kit (cat. no. P0010S; Beyotime Institute of Biotechnology) was used to measure protein concentrations. Subsequently, 10% SDS-PAGE was used to separate a total of 8 µg of protein per lane. The samples were transferred to a polyvinylidene fluoride membrane. After transfer, the membrane was blocked with 5% skim milk for 1 h at 22°C to prevent non-specific binding. Membranes were incubated with primary antibody overnight at 4°C, followed by incubation with HRP-conjugated secondary antibody (1:4,000; cat. no. ZB-2301 or ZB-2305; Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) for 1 h at room temperature, after being washed four times with 0.05% Tween-20/Tris-buffered saline. The blots were developed using an enhanced chemiluminescence substrate kit (cat. no. GS009; Beyotime Institute of Biotechnology) and visualized using the ChemiDoc system (Bio-Rad Laboratories, Inc.). The primary antibodies used in the present study were: Anti-GAPDH (1:5,000; cat. no. AG019; Beyotime Institute of Biotechnology), anti-ADPN (1:500; cat. no. sc-390251; Santa Cruz Biotechnology, Inc.), anti-postsynaptic density protein 95 (PSD95; 1:250; cat. no. sc-71933; Santa Cruz Biotechnology, Inc.), anti-synaptosomal associated protein 25 (SNAP25; 1:1,000; cat. no. ab41455; Abcam), anti-synaptophysin (SYP; 1:500; cat. no. 100298-T40; Sino Biological), anti-AMP-activated protein kinase (AMPK; 1:1,000; cat. no. 2532; Cell Signaling Technology, Inc.), anti-phosphorylated (p-)AMPK (1:1,000; cat. no. 2535; Cell Signaling Technology, Inc.), anti-regulatory-associated protein of mTOR (RAPTOR; 1:1,000; cat. no. 2280; Cell Signaling Technology, Inc.), anti-p-RAPTOR (1:1,000; cat. no. 2083; Cell Signaling Technology, Inc.), anti-mTOR (1:1,000; cat. no. 2983; Cell Signaling Technology, Inc.), anti-p-mTOR (1:500; cat. no. 2971; Cell Signaling Technology, Inc.), anti-S6 kinase (S6K; 1:1,000; cat. no. 34475; Cell Signaling Technology, Inc.) and anti-p-S6K (1:1,000; cat. no. 9234; Cell Signaling Technology, Inc.). ImageJ software (V1.8.0; National Institutes of Health) was used for densitometry.

Statistical analysis

SPSS 22.0 statistical software (IBM Corp.) was used for data analysis and the data are presented as the mean ± SEM. Each test was repeated three times. An independent samples unpaired t-test was used for comparison between groups when the data were normally distributed. The χ2 test was used for sex comparisons. Two-way mixed ANOVA was performed for multiple group comparisons at different timepoints, followed by the Bonferroni post hoc test. One-way ANOVA was performed for multiple group comparisons, followed by Tukey's post hoc test. The relationship between serum ADPN levels and MoCA scores was analyzed by Spearman's correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Serum ADPN levels are positively correlated with MoCA in patients with epilepsy

The age, sex and BMI of the two groups did not differ significantly (P>0.05), while the RAVLT immediate memory score (P=0.0162), SDMT score (P<0.001), MoCA score (P<0.001) and BNT score (P=0.0037) were significantly lower in the epilepsy group than in the healthy control group, indicating a reduction in cognitive function in the epileptic patients (Table II).

Table II. Analysis of demographic and cognitive functioning assessments.

Table II.

Analysis of demographic and cognitive functioning assessments.

Demographic feature	Epilepsy group (n=20)	Healthy group (n=20)	P-value
Age, years (mean ± SD)	40.25±16.51	50.20±14.67	0.0511
Sex, n (male/female)	10/10	13/7	>0.9999
BMI, kg/m2	23.15±1.89	22.45±1.94	0.2569
Rey auditory verbal learning test
Immediate	41.70±10.18	48.20±5.46	0.0162
Delay	6.45±1.76	7.50±1.79	0.0694
Symbol digit modalities test	47.90±5.02	57.25±4.97	<0.001
Montreal cognitive assessment	24.00±2.43	27.80±1.28	<0.001
Boston naming test	24.65±3.36	27.40±2.11	0.0037

Serum ADPN levels were significantly lower in patients with epilepsy (Fig. 1A). Spearman correlation analysis was used to explore the relationship between serum ADPN levels and MoCA scores in epileptic patients and healthy volunteers. The results revealed that serum ADPN levels were positively associated with cognitive function (Spearman correlation, 0.894; P<0.001; Fig. 1B).

Figure 1. Serum ADPN is positively correlated with cognitive function. (A) ELISA of serum ADPN levels in epileptic patients (n=20) and the healthy population (n=20). ***P<0.001. (B) Spearman's correlation analysis of serum ADPN levels and MoCA scores. P=4.28×10−14. ADPN, adiponectin; MoCA, Montreal cognitive assessment.

AdipoRon improves cognitive impairment in epileptic rats

The cognitive differences among the three groups were explored using the Morris water maze experiment (Fig. 2). The latency to evade and the distance travelled in the first 5 days of the positioning navigation experiment are shown in Fig. 2A and B. The latency to evade and distance traveled decreased with more training time. Two-way mixed ANOVA with Bonferroni post hoc analysis indicated that both time (F=38.14; P<0.001) and group (F=10.99; P<0.001) significantly impacted escape latency. For distance, significant effects were also observed for both group (F=7.794; P<0.001) and time (F=36.54; P<0.001). The post hoc test revealed that, starting from day 3, there was no marked difference between the model + AdipoRon group and the control group in terms of latency to evade, whereas there was a significant difference between the model group and the other two groups (P<0.05) (Fig. 2A and B). The results showed that there was no difference in the time in target quadrant (Fig. 2C) and number of platform crossings (Fig. 2D) between the AdipoRon group and the control group, while there was a significant difference in the time in target quadrant and number of platform crossings between the model group and the other two groups (Fig. 2C and D). These results showed that AdipoRon treatment did improve the cognitive level of epileptic rats, including memory and learning ability.

Figure 2. AdipoRon improves cognitive impairment in epileptic rats. The cognitive differences among the control (n=10), model (n=10) and model + AdipoRon (n=12) groups were explored using the Morris water maze experiment. (A) Escape latency on day 1–5. (B) Distance travelled on day 1–5. (C) Time in target quadrant. (D) Number of platform crossings in 2 min. (E) Escape latency in visual platform test. (A and B) *P<0.05, ***P<0.001 vs. control group. #P<0.05, ###P<0.001 vs. model + AdipoRon group. (C-E) *P<0.05, **P<0.01. ns, not significant.

There was no significant difference in the escape latency among the groups (P>0.05), indicating that the visual and locomotor abilities of the rats were not affected (Fig. 2E).

AdipoRon effectively protects against hippocampal neuronal damage caused by epilepsy

The effect of AdipoRon treatment on pathological changes in the damaged hippocampus of epileptic rats was observed using Nissl staining. In the control group, a large number of well-arranged pyramidal cells with normal cell morphology were seen in the hippocampal region, while in the model group, the number of neurons was significantly reduced and some neurons in the CA1 region of the hippocampus were lost, with abnormal cell morphology and reduced volume (Fig. 3A-D). The difference in the CA3 region was also significant in the model group compared with the control group (Fig. 3E-H). Following AdipoRon treatment, hippocampal neuronal tissue staining showed a similar cell morphology compared with the control group and an increased number of neurons compared with the model group, with a significant difference compared with the model group (Fig. 3I-L).

Figure 3. Nissl staining of rat hippocampus. The effect of AdipoRon treatment on pathological changes in the damaged hippocampus of epileptic rats in the control (n=10), model (n=10) and model + AdipoRon (n=12) groups was evaluated using Nissl staining. (A-C) Nissl staining of the CA1 region of the hippocampus (magnification, ×200) in the (A) control, (B) model and (C) model + AdipoRon groups. (D) Quantification of the CA1 region in the control, model and model + AdipoRon groups. (E-G) Nissl staining of the CA3 region of the hippocampus (magnification, ×200) in the (E) control, (F) model and (G) model + AdipoRon groups. (H) Quantification of the CA3 region in the control, model and model + AdipoRon groups. (I-K) Nissl staining of the DG region of the hippocampus (magnification, ×200) in the (I) control, (J) model and (K) model + AdipoRon groups. (L) Quantification of the DG region in the control, model and model + AdipoRon groups. ***P<0.001. DG, dentate gyrus.

AdipoRon increases AdipoR1 and AdipoR2 expression in the brain

AdipoR1 and AdipoR2 expression in the rat brain of the model group was considerably lower than that of the control group and the model + AdipoRon group, whereas no significant difference was observed between the control and model + AdipoRon groups (Fig. 4). These results demonstrated that the expression of AdipoRs was downregulated in epileptic rats, while treatment with AdipoRon rescued their expression in the brain.

Figure 4. AdipoRon modulates the expression of AdipoRs in epileptic rats. The expression levels of (A) AdipoR1 and (B) AdipoR2 in hippocampal tissues from the control (n=10), model (n=10) and model + AdipoRon (n=12) groups were determined by reverse transcription-quantitative PCR. *P<0.05, **P<0.01. AdipoR, adiponectin receptor; ns, not significant.

AdipoRon improves cognition in epileptic rats by targeting the AMPK/mTOR signaling pathway

The specific mechanisms underlying the cognitive effects of AdipoRon in epileptic rats were further investigated. Compared with that in the control group, ADPN expression was considerably reduced in the epilepsy model animals but AdipoRON enhanced ADPN expression (Fig. 5A and B). The expression of the synapse-associated proteins PSD95, SNAP25 and SYP was significantly reduced in the model group and was recovered following treatment with AdipoRon (Fig. 5C-E). This suggested that AdipoRon ameliorated cognitive dysfunction in epileptic rats by modulating the expression of synapse-associated proteins. In addition, the levels of p-AMPK and phosphorylation of its target RAPTOR (pRAPTOR) were lower, while the levels of p-mTOR and phosphorylation of its downstream target S6K1 (pS6K1) were higher in the model group compared with the control group (Fig. 5F-I). Increased p-AMPK levels and reduced p-mTOR levels were observed following AdipoRon treatment, indicating that AdipoRon may affect the cognitive level of epileptic rats via the AMPK/mTOR signaling pathway.

Figure 5. AdipoRon regulates the activation of the AMPK/mTOR pathway in the hippocampus of pilocarpine-treated rats. The expression and phosphorylation of key proteins in the AMPK/mTOR signaling pathway in the control (n=10), model (n=10) and model + AdipoRon (n=12) groups were determined by western blotting. (A) Representative results of western blotting. (B) Relative expression of ADPN. (C) Relative expression of PSD95. (D) Relative expression of SNAP25. (E) Relative expression of SYP. (F) Relative expression of p-AMPK/AMPK. (G) Relative expression of p-mTOR/mTOR. (H) Relative expression of p-RAPTOR/RAPTOR. (I) Relative expression of p-S6K/S6K. The expression levels were normalized to GAPDH expression. Data are presented as the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001. ADPN, adiponectin; AMPK, AMP-activated protein kinase; p-, phosphorylated; PSD95, postsynaptic density protein 95; RAPTOR, anti-regulatory-associated protein of mTOR; S6K, S6 kinase; SNAP25, synaptosomal associated protein 25; SYP, synaptophysin.

Discussion

As one of the most prevalent neurological conditions, epilepsy affects >65 million individuals worldwide (27). Daily activities are limited for individuals with epilepsy and they also have cognitive impairment, social dysfunction and family problems (28). Verbal memory, language, executive function and attention are among the cognitive domains where the impacts of epilepsy are frequently discussed (29–31). Focal and generalized seizures are both associated with cognitive deficits (32). Long-term situational and semantic memory problems, executive dysfunction, attention issues, language abnormalities and other cognitive impairments are also present in patients with focal epilepsy (33,34). In addition to short- and long-term information processing and retrieval problems, patients with generalized epilepsy also show cognitive impairments (33,35). The present study revealed that cognitive impairment in individuals with epilepsy compared with the non-affected population was associated with reduced serum ADPN levels. Furthermore, administration of AdipoRon in epileptic rats alleviated cognitive dysfunction via the AMPK/mTOR pathway, providing novel insights regarding the pathogenesis and treatment of epilepsy.

ADPN is the most prevalent adipokine in human plasma (36). AdipoR1 and AdipoR2 are critical regulators of inflammation, oxidative stress, glucose and lipid metabolism in vivo (37,38). Activation of AdipoR1 with recombinant C1q/TNF-related protein 9, a homologue of adiponectin, exerts neuroprotective effects through the APPL1/AMPK/nuclear factor erythroid 2-related factor 2 signaling pathway (39). A previous study has indicated that ADPN activated the AdipoR1/APPL1/LKB1/AMPK pathway in newborn rats to reduce the effects of hypoxia-ischemia-induced neuronal apoptosis (40). In addition, ADPN directly affects synaptic function via AdipoR2, and lipocalin knockout mice exhibit cognitive and synaptic deficits (41). Deficiency in ADPN increases fat storage, poor glucose tolerance, hyperlipidemia, seizure severity and hippocampus damage in mice with a high-fat diet (42). The findings of the present study demonstrated that serum levels of ADPN were positively associated with MoCA scores, and that serum ADPN levels were lower in patients with epilepsy than in the general population.

AdipoRon, the first reported agonist of AdipoRs identified by Okada-Iwabu et al (43) in 2013, acts on AdipoR1 and AdipoR2 in liver and skeletal muscle in an experimental mouse model of diabetes mellitus (44). AdipoRon reduces brain hemorrhage-induced injury by promoting microglia polarization to the M2 type and reducing neuronal apoptosis via the AdipoR1-AMPK signaling pathway (45). AdipoRon also induces AMPK activation, increases insulin sensitivity, reduces amyloid β plaque deposition and improves cognitive dysfunction in mice with Alzheimer's disease (46). Yu et al (47) revealed that AdipoRon prevented secondary brain injury following cerebral hemorrhage by reducing mitochondrial dysfunction through the AdipoR1-AMPK-peroxisome proliferator-activated receptor-γ coactivator 1α signaling pathway. In addition, Yan et al (48) demonstrated that AdipoRon inhibited deep hypothermic arrest cycle-induced neuroinflammation by activating the AMPK/NF-κB signaling pathway in the hippocampus. In the present study, AMPK was activated by AdipoRon in epileptic rats and it was further demonstrated that the downstream mTOR was activated.

The synapse-associated protein PSD95 is a scaffolding protein located primarily in the excitatory glutamatergic postsynaptic membrane (49). A previous study has shown that PSD95 is a key protein in promoting synaptic maturation and maintaining dendritic spine stability (50). The synaptic vesicle-associated protein SNAP25 is also a synapse-associated protein involved in the regulation of synaptic vesicle cytokinesis (51). It has been found that a reduction in postsynaptic SNAP25 leads to a decrease in learning and memory capacity (52). Furthermore, SYP expression in the hippocampus is closely associated with learning memory (53). The SYP levels in the hippocampus and cortex of mice exhibit age-dependent alterations, and these changes are associated with cognitive function (54). A study has shown that higher SYP expression is linked to improved long-term memory due to enhanced synaptic plasticity (55). In the present study, synapse-associated proteins PSD95, SNAP25 and SYP were expressed from high to low in the normal control group, AdipoRon intervention group and the epileptic group, respectively. PSD95, SNAP25 and SYP were all expressed at lower levels in the model group compared with the normal control and AdipoRon intervention groups, and the expression differed between the model group and the other two groups, suggesting that AdipoRon may improve cognitive impairment in epileptic rats by regulating the expression of synapse-associated proteins.

AMPK was originally found to act as a regulator of acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl coenzyme A reductase, which regulate the synthesis of fatty acids and sterols, respectively (56). It has been shown that AMPK activated by energy changes inhibited neuronal developmental growth at multiple stages, including axonal growth, dendritic growth and bifurcation (57). Mice with knockout of AMPK have reduced intracerebral lactate, are seizure-prone and develop cortical lesions as evidenced by thinning of cortical thickness, neuronal damage and reactive proliferation of glial cells (58,59).

Initially identified as a target of rapamycin, mTOR serves a key role in neurophysiological processes such as neurodevelopment and the formation of intracerebral pathways as a key regulator of protein synthesis and autophagy (60,61). mTOR signaling dysregulation is involved in the development of infection and inflammation, and is also part of the complex mechanism of epilepsy-associated neuroinflammation (62). In epilepsy-associated neuroinflammation, mTOR hyperactivation leads to disruption of the blood-brain barrier, which promotes infiltration of peripheral immune cells (63). In experimental models, rapamycin and other mTOR inhibitors reduce seizures and delay the progression of epilepsy (64). Abnormalities in the mTOR signaling pathway may be a key condition for the onset and progression of epilepsy. The results of the present study showed that the p-AMPK/AMPK ratio was reduced and the p-mTOR/mTOR ratio was increased in the hippocampal tissue of epileptic rats compared with normal controls, that AdipoRon intervention activated the AMPK/mTOR pathway in the hippocampal tissue of epileptic rats, and that AdipoRon intervention treatment improved spatial learning memory capacity, hippocampal neuronal survival and synapse-associated protein expression. This suggested that AdipoRon protected hippocampal neurons by activating the AMPK/mTOR signaling pathway, increased the expression of synapse-associated proteins and improved cognitive function in epileptic rats.

The present study revealed that cognitive function reduction in patients with epilepsy was positively associated with decreased serum ADPN levels. AdipoRon may protect neurons, regulate the expression of synapse-associated proteins and improve cognitive function in epileptic rats by targeting the AMPK/mTOR signaling pathway.

Acknowledgements

The authors would like to thank Professor Qian Xue (Department of Neurology, Hebei North University Affiliated First Hospital, Zhangjiakou, Hebei, China) for their support in the collection of samples and securing ethical approval for the study.

Funding

Funding: No funding was received.

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

YZ was responsible for the study conception and design, literature research, clinical studies, data analysis, statistical analysis, manuscript preparation and editing. ZQ was involved in the study conception, design and drafting the manuscript, and was responsible for the definition of intellectual content. ZM was responsible for the experimental studies. HL was responsible for data acquisition. WW and LJ were involved in the study conception, design and drafting the manuscript, and were responsible for the guarantee of integrity of the entire study and manuscript revision. WW and LJ confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The participants provided written informed consent. The human study was approved by the Ethical Committee of The First Affiliated Hospital of Hebei North University (grant no. W2023016; Zhangjiakou, China). The animal study was approved by Ethical Committee of The Second Hospital of Hebei Medical University (grant no. 2023-AE075; Shijiazhuang, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

References