Introduction
Airway mucus is the host defense to protect the
respiratory system against invading foreign stimuli, such as
chemicals, airborne particles and pathogenic microorganisms.
However, uncontrolled mucus hypersecretion impairs mucociliary
clearance, increases airway resistance and decreases airflow
through the lungs (1–3). Airway mucus hypersecretion is an
important pathophysiological and clinical hallmark of asthma,
chronic obstructive pulmonary disease (COPD), bronchiectasis and
other chronic airway inflammatory diseases. Excessive secretion of
airway mucus irreversibly deteriorates lung function and notably
increases pathogen colonization, the frequency of acute
exacerbations, hospitalization rates and mortality (4–6).
Vestbo et al (4) found that
in patients with COPD and chronic airway mucus hypersecretion, the
risk of acute exacerbation and hospitalization increased 2.4 times
in men and 2.6 times in women. A multi-center observational study
on 433 patients with COPD shows that the acute exacerbation risk of
subjects with chronic cough and sputum production increases by 4.15
times and the following hospitalization risk increases by 4.08
times (5). In addition, a
follow-up of 14,223 patients with COPD for 10–12 years found that
chronic airway mucus hypersecretion increases risk of mortality by
3.5 times compared with non-airway mucus hypersecretion (6). Despite its effect, there remains a
lack of effective therapeutic medicines to suppress mucus
hypersecretion (7). Among the
mucin family members, mucin 5ac (MUC5AC) is a major glycoprotein in
the human airway mucus. A number of studies have indicated that
abnormal expression of MUC5AC plays an essential role in the
pathogenesis of respiratory diseases (1–3).
High levels of MUC5AC expression are often induced by various
stimuli, including lipopolysaccharide (LPS), tumor necrosis factor
(TNF)-α, epidermal growth factor (EGF), phorbol myristate acetate
(PMA) and interleukin-13. As a major component of the outer
membrane of gram–negative bacteria, LPS can cause excessive
inflammation and oxidative injury to lung epithelium and
endothelium, accompanied by airway mucus hypersecretion (8). Accumulating evidence demonstrates
that LPS is a critical factor in developing COPD, bronchiectasis
and cystic fibrosis pulmonary disease (9–12).
Therefore, it is essential to explore effective therapeutic drugs
to regulate LPS-induced MUC5AC overexpression.
Resveratrol (3,5,4′-trihydroxy-trans-stilbene) is a
natural polyphenol found in red grape skin, Polygonum
cuspidatum, peanuts, blueberries and other berries. Several
studies have reported that resveratrol exhibits various biological
effects, including anti-inflammatory, anti-oxidative, anti-aging,
immunomodulatory and tumor-preventive effects. Resveratrol has been
reported to ameliorates LPS-induced acute lung injury (13–16).
In addition, resveratrol-loaded lipid-core nanocapsules can
modulate acute lung inflammation and oxidative imbalance in an
LPS-induced lung injury model (17,18).
Resveratrol prevents inflammation and oxidative stress response in
LPS-induced human gingival fibroblasts by targeting the PI3K/AKT
and Wnt/β-catenin signaling pathways (19). Moreover, resveratrol exerts
protective effects on LPS and cigarette smoke-induced COPD in a
murine model (20). However, only
a few studies have focused on the role of resveratrol in mucus
regulation. Studies have demonstrated that resveratrol inhibits
MUC5AC synthesis induced by EGF, PMA and TNF-α in the human airway
epithelium and decreases MUC5AC expression in murine asthma models
(21–23). Nonetheless, to the best of the
authors' knowledge there is no comprehensive study on the effects
and mechanisms of resveratrol on MUC5AC expression induced by LPS
in vitro and in vivo.
Nuclear factor erythroid 2-related factor 2 (Nrf2),
an important transcription factor involved in oxidative stress and
plays a critical role in regulating cellular redox status.
Resveratrol, a potent antioxidant and Nrf2 modulator, is known to
have antioxidant and anti-inflammatory effects by activating the
Nrf2 and mitogen-activated protein kinase (MAPK) signaling pathways
(23–26). The MAPK signaling pathway has been
found to be involved in regulating LPS-induced MUC5AC
overexpression (27–31). One study demonstrates that
resveratrol decreases MUC5AC expression by inhibiting ERK and AKT
signaling in mucus-producing A549 human lung carcinoma cells
(23). Orally administered
resveratrol-loaded lipid-core nanocapsules ameliorate LPS-induced
acute lung injury via ERK and PI3K/Akt pathways (17). A previous study from our laboratory
demonstrates that Nrf2 ameliorates cigarette smoking-induced MUC5AC
overproduction in A549 cells and mouse lung (32). Another study reveals that Nrf2 is
involved in the regulatory effect of curcumin on LPS-induced MUC5AC
hypersecretion and airway inflammation (33). However, it remains uncertain
whether resveratrol inhibits LPS-induced MUC5AC production via MAPK
and Nrf2 pathways.
Therefore, the present study aimed to determine
whether resveratrol could alleviate LPS-induced MUC5AC
overexpression and inflammatory response in NCI-H292 cells and an
acute airway inflammatory murine model. Furthermore, it examined
the role of MAPK and Nrf2 signaling in the protective effects of
resveratrol against LPS-induced MUC5AC expression.
Materials and methods
Reagents and kits
Roswell Park Memorial Institute (RPMI) 1640 medium
and fetal bovine serum (FBS) were from Gibco (Thermo Fisher
Scientific, Inc.). Lipopolysaccharide, resveratrol,
PD98059/SP600125/SB203580 (inhibitors of ERK/JNK/p38, respectively)
and methyl-thiazolyl-tetrazolium (MTT) were from MilliporeSigma.
Resveratrol, PD98059, SP600125 and SB203580 were dissolved in DMSO
and lipopolysaccharide and MTT were diluted in a filtered PBS.
Other reagents and kits included reactive oxygen species (ROS)
Assay Kit (Enzo Life Sciences, Inc.), Nrf2 small interfering
(si)RNA (Invitrogen; Thermo Fisher Scientific, Inc.),
TRIzol® reagent (Thermo Fisher Scientific, Inc.), total
RNA isolation and reverse transcription system (Promega
Corporation), mouse MUC5AC antibody (Thermo Fisher Scientific,
Inc.), human heme oxygenase-1 (HO-1) antibody (Enzo Life Sciences,
Inc.) and human GCLC antibody (Abnova, Inc.). Antibodies against
human MUC5AC, Nrf2, β-actin, and GAPDH were purchased from Abcam.
Antibodies against NAD(P)H: quinine oxidoreductase 1 (NQO1),
phosphorylated (p-)ERK, ERK, p-P38, P38, p-JNK and JNK were
purchased from Cell Signaling Technology, Inc.
Cell culture
NCI-H292 cells, a human airway epithelial cell line,
was obtained from the National Collection of Authenticated Cell
Cultures (Shanghai, China) and cultured in RPMI 1640 supplemented
with 10% FBS +1% penicillin/streptomycin in a 5% CO2
incubator at 37°C. When cells were ~80% confluent, varying doses of
resveratrol dissolved in DMSO were added to the culture media for
30 min and then co-incubated with or without LPS (10 µg/ml) for 24
h.
Cell viability analysis
The MTT assay was used to evaluate resveratrol
cytotoxicity. Cells (6×103 cells/well) were seeded in
96-well plates and treated with resveratrol (10–100 µM), with or
without LPS (10 µg/ml) for 24 h. The cells were then incubated with
5 mg/ml MTT solution for 4 h and the absorbance was measured at 490
nm to estimate viable cells. The relative cell viability (%) was
calculated as the ratio of the absorbance of the administered cells
to that of the untreated cells.
ROS generation assay
An ROS detection kit (Enzo Life Sciences, Inc.) was
used to measure the total ROS levels following the manufacturer's
protocol. Briefly, cells were collected, stained with a ROS
Detection Reagent and incubated in the dark at 37°C for 30 min.
Finally, the fluorescence intensity of each sample was measured
using flow cytometry.
siRNA
NFE2L2 siRNA (Invitrogen; Thermo Fisher
Scientific, Inc.) or scrambled RNA (as a negative control) was
transfected into NCI-H292 cells using Lipofectamine®
2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the
manufacturer's instructions. Briefly, 4×105 cells were
seeded and cultured in 6-well plates until they reached 50–70%
confluence and then treated with 50, 75, or 100 nM siRNA for 48 h
at room temperature. Transfection efficiency was assessed by
RT-qPCR and western blotting. The sequences were: siRNA-Nrf2
forward, 5′-AAUGAGUUCACUGUCAACUGGUUGG-3′; siRNA-Nrf2 reverse,
3′-CCAACCAGUUGACAGUGAACUCAUU-5′ and negative control (NC)-siRNA
forward, 5′-UUCUCCGAACGUGUCACGUdTdT-3′ and NC-siRNA reverse,
3′-ACGUGACACGUUCGGAGAAdTdT-5′.
NCI-H292 cells were divided into six groups:
siRNA-NC, LPS + siRNA-NC, LPS+ resveratrol + siRNA-NC, Nrf2-siRNA
control, LPS + Nrf2-siRNA and LPS + resveratrol + Nrf2-siRNA. LPS
(10 µg/ml) was added to the NCI-H292 cell culture of the LPS group
for 24 h. The cells of the LPS + resveratrol group were pretreated
with resveratrol (50 µM) for 30 min and then incubated with LPS (10
µg/ml) for 24 h. At 6 h after small interfering RNA transfection,
the cells were incubated with LPS (10 µg/ml) or resveratrol (50 µM)
+ LPS (10 µg/ml) for 24 h.
Reverse transcription-quantitative
(RT-q) PCR
Total RNA was isolated from cells (1×107
cells) and lung tissues using TRIzol Reagent (Invitrogen; Thermo
Fisher Scientific, Inc.) and reverse-transcribed using a Reverse
Transcription Reagent Kit (Takara Bio, Inc.) according to the
manufacturer's instructions. SYBR Green Premix Ex Taq II (Takara
Bio, Inc.) was used to perform real-time qPCR on an Applied
Biosystems StepOnePlus system (Applied Biosystems; Thermo Fisher
Scientific, Inc.). PCR primers used in this study are listed in
Table I. The relative mRNA
expression levels of the target genes were normalized to the CT
value of GAPDH using the 2−ΔΔCq formula (34). All the experiments were replicated
three times.
 | Table I.Primers for quantitative real-time
PCR analysis. |
Table I.
Primers for quantitative real-time
PCR analysis.
| Species | Genes | Primer sequence
(5′-3′) |
|---|
| Human | GAPDH | Forward:
CTCCTGCACCACCAACTGCTTAG |
|
|
| Reverse:
GACGCCTGCTTCACCACCTTC |
| Human | MUC5AC | Forward:
CAGCACAACCCCTGTTTCAAA |
|
|
| Reverse:
GCGCACAGAGGATGACAGT |
| Human | Nrf2 | Forward:
AAACCAGTGGATCTGCCAAC |
|
|
| Reverse:
ACGTAGCCGAAGAAACCTCA |
| Human | HO-1 | Forward:
ATGGCCTCCCTGTACCACATC |
|
|
| Reverse:
TGTTGCGCTCAATCTCCTCCT |
| Human | NQO1 | Forward:
GTTGCCTGAAAAATGGGAG |
|
|
| Reverse:
AAAAACCACCAGTGCCAGT |
| Human | GCLC | Forward:
TCTCTAATAAAGAGATGAGCAACATGC |
|
|
| Reverse:
TTGACGATAGATAAAGAGATCTACGAA |
| Mouse | β-actin | Forward:
GGCTGTATTCCCCTCCATCG |
|
|
| Reverse:
CCAGTTGGTAACAATGCCATGT |
| Mouse | MUC5AC | Forward:
CTGTGACATTATCCCATAAGCCC |
|
|
| Reverse:
AAGGGGTATAGCTGGCCTGA |
| Mouse | Nrf2 | Forward:
GGACATGGAGCAAGTTTGGC |
|
|
| Reverse:
GCTGGGAACAGCGGTAGTATC |
Protein extraction and western
blotting
Total protein was extracted using
radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime
Institute of Biotechnology) with a protease inhibitor cocktail
(Roche Diagnostics) and quantified using a BCA protein assay kit.
Equal weights of proteins (20 µg/lane) were separated by SDS-PAGE
on 8–10% gel and electrotransferred onto polyvinylidene difluoride
membranes (MilliporeSigma). Membranes were blocked with 5% skimmed
milk in tris-buffered saline containing 0.1% Tween 20 (TBST) for 1
h at 37°C and incubated with various primary antibodies overnight
at 4°C. The following primary antibodies were used: Human MUC5AC
(1:100, ab24070, Abcam), human Nrf2 (1:1,000, ab62352; Abcam),
GAPDH (1:5,000, ab9485, Abcam), β-actin (1:5,000, ab8227, Abcam),
HO-1 (1:1,000, ADI-SPA-896, Enzo Life Sciences), NQO1 (1:1,000,
ma1-16672, cell signaling Technology), GCLC (1:1,000, H00002729,
Cell Signaling Technology), MAPK p38 (1:1,000, #9212, Cell
Signaling Technology), pp38 (1:1,000, #9215S, Cell Signaling
Technology), ERK (1:1,000, #4695, Cell Signaling Technology), p-ERK
(1:1,000, #4377S, Cell Signaling Technology), mouse MUC5AC (1:100,
MA5-12178, Thermo Fisher Scientific). The next day, the membranes
were washed in TBST and hybridized with HRP-conjugated secondary
antibodies (1:10,000, BA1050 and BA1054, Wuhan Boster Biological
Technology) at room temperature for 1 h. Immunoreactive protein
bands were visualized using enhanced chemiluminescence (cat. no.
#32109; Thermo Fisher Scientific, Inc.) on a GE ImageQuant
LAS4000mini System (Cytiva). The intensities of the relative bands
were quantified using Quantity One 1-D 4.62 software (Bio-Rad).
Animal experiments
All procedures were approved by the Ethics Committee
of the second affiliated hospital of Fujian Medical University
(approval no. 2022-FYFE-559) and all experiments were performed in
accordance with the ARRIVE guidelines for animal care (35).
A total 21 of male C57BL/6 mice (8–10 weeks old and
body weight of 18–22 g) were purchased from the Experimental Animal
Center of the Fujian Medical University (Fujian, China). Mice were
housed under standard conditions and had unlimited access to
sterilized food and distilled water. Room temperature was
maintained at 25±2°C and relative humidity at 60±10% and a 12-h
light/dark cycle was used. After 7 days of acclimation, the mice
were randomly divided into three experimental groups (n=7 per
group): i) Control group, ii) LPS exposure group and iii) LPS +
resveratrol group. Group i) mice served as the normal control group
and were challenged with an equal volume of PBS. Group ii) was the
LPS-exposed group and the mice were treated with 100 µg LPS (in 50
µl saline) by intratracheal instillation. Group iii) mice were
pretreated with an intraperitoneal injection of resveratrol (50
mg/kg) 2 h prior to intratracheal LPS instillation (100 µg/50 µl
saline). The total duration of the animal study was 7 days. The
mice were monitored daily for food and water intake, weight, body
posture, behavior, distress and response to external stimuli.
Animals were sacrificed when they reached the humane endpoints,
such as a loss of >20% body weight, severe dehydration, refusal
of food, severe pain or distress, or a moribund state. However,
none were humanely sacrificed or found dead during the present
study. All mice were anesthetized with an intraperitoneal injection
of 50 mg/kg pentobarbital sodium and 0.5–1 ml blood collected by
cardiac puncture, then sacrificed by exsanguination. Indexes such
as breathing, heartbeat, pupils and nerve reflexes were assessed to
confirm death.
Bronchoalveolar lavage fluid (BALF)
and airway inflammation analysis
The left bronchus of the mouse was ligated and
ice-cold PBS (0.4 ml) was lavaged twice into the right lung. Then,
the collected BALF was centrifuged at 400 × g for 10 min at 4°C and
the cell pellets were resuspended in cold PBS. The total count of
inflammatory cells was assessed using a chemocytometer and
neutrophil counts were determined using Wright and Giemsa staining
(BaSO Diagnostics Inc.).
Histological analysis
After BALF sample collection, left lung tissue was
fixed in 4% (v/v) paraformaldehyde at room temperature for 24 h,
dehydrated with graded ethanol, embedded in paraffin and sliced
into 4-µm sections. Hematoxylin staining was conducted at room
temperature for 10 min and eosin staining for 2 min, followed by
clearing in xylene for 5 min. Additionally, the slides were
subjected to periodic acid Schiff (PAS) stain to assess mucus
production. At room temperature, lung tissues were incubated in
0.1% periodic acid for 10 min, immersed in Schiff's reagent for 10
min, counterstained with Mayer's hematoxylin for 2 min, dehydrated
in two changes of 96% alcohol, and finally cleared in xylene.
Statistical analysis
Statistical analyses were performed using the SPSS
software (version 20.0; IBM Corp.) and GraphPad Prism 8.0
statistical software (Dotmatics). All data were presented as the
mean ± SD. An independent-sample t-test was used to compare two
groups and one-way ANOVA with Tukey's post hoc test was used to
compare three or more groups of data. P<0.05 was considered to
indicate a statistically significant difference.
Results
Effects of resveratrol on cell
viability in NCI-H292 cells
The cytotoxicity of resveratrol on NCI-H292 cell
viability was analyzed using the MTT assay at various times. As
shown in Fig. 1A, ≤90 µM
resveratrol and ≤70 µM resveratrol +LPS (10 µg/ml) showed no
obvious toxicity to NCI-H292 cells at 24 h. Thus, concentrations of
10, 25 and 50 µM were selected for further in vitro
experiments.
Resveratrol inhibits LPS-induced
MUC5AC overexpression in NCI-H292 cells
Previous studies, and this study, show that LPS
induced MUC5AC expression in a time-dependent manner in NCI-H292
cells and that this effect was most apparent with 10 µg/ml LPS for
24 h (Fig. 1B). Therefore, for the
subsequent experiments, the time point of 24 h was used. However,
treatment with resveratrol significantly decreased LPS-induced
MU5AC mRNA expression in a dose-dependent manner in NCI-H292 cells
(Fig. 1C). Consistent with the
RT-qPCR results, the expression of MUC5AC protein was markedly
increased in LPS-stimulated NCI-H292 cells but was obviously
suppressed in resveratrol-treated NCI-H292 cells (Fig. 1D).
Resveratrol attenuates LPS-induced ROS
production in NCI-H292 cells
To investigate the anti-oxidative effects of
resveratrol, intracellular ROS production in NCI-H292 cells was
measured. As shown in Fig. 2, LPS
greatly induced ROS production (Fig.
2B), whereas resveratrol significantly attenuated LPS-induced
ROS production (Fig. 2C).
Resveratrol inhibits LPS-induced
MUC5AC expression in NCI-H292 cells via Nrf2 pathway
To determine whether resveratrol inhibited
LPS-induced MUC5AC expression via the Nrf2 signaling pathway, the
mRNA and protein expression of Nrf2 and its downstream antioxidant
genes, such as HO-1, glutamate-cysteine ligase catalytic subunit
(GCLC) and NQO1 were analyzed by RT-qPCR and western blotting.
First, it was found that resveratrol induced the mRNA expression of
Nrf2 in a dose-dependent manner and this effect was most apparent
at 50 µM (Fig. 3A). Compared with
the LPS group, resveratrol significantly induced mRNA and protein
expression of Nrf2 (P<0.05; Fig.
3B), as well as the downstream antioxidant genes HO-1 and GCLC
(P<0.05; Fig. 3C and D).
However, there was no effect on the expression of NQO1 (Fig. 3C and D).
Furthermore, the expression of Nrf2 was knocked down
through siRNA transfection in NCI-H292 cells. Nrf2-siRNA could
effectively decrease Nrf2 expression with 100 nM for 24 h and the
mRNA and protein expression were decreased by 71.7 and 58.2%
(Fig. S1). When Nrf2 expression
was knocked down by Nrf2 siRNA, the downregulating effect of
resveratrol on LPS-induced MUC5AC expression was significantly
suppressed (P<0.05) (Fig. 3E and
F). These results indicate that resveratrol inhibited
LPS-induced MUC5AC expression via Nrf2 activation.
Involvement of MAPK pathway in the
regulatory effect of resveratrol on LPS-induced MUC5AC
expression
The MAPK pathway plays an important role in the
regulation of inflammation, oxidative stress and mucin expression.
To assess the role of the MAPK pathway in the regulatory effect of
resveratrol on LPS-induced MUC5AC expression, MAPK inhibitors,
including PD098059 (ERK inhibitor), SB203580 (p38 MAPK inhibitor)
and SP600125 (JNK inhibitor), were used. Resveratrol failed to
suppress LPS-induced MUC5AC expression in NCI-H292 cells when ERK
and p38 MAPK activation were blocked by their specific inhibitors,
PD098059 and SB203580 (P<0.05), respectively (Fig. 4A). However, SP600125 did not
inhibit this effect. Resveratrol induced the phosphorylation of ERK
and p38 MAPK (P<0.05; Fig. 4C).
Additionally, the inductive effects of resveratrol on Nrf2 were
suppressed by the MAPK inhibitors (Fig. 4B). These results suggested that
resveratrol inhibited LPS-induced MUC5AC expression via the
activation of the ERK/p38 MAPK pathway in NCI-H292 cells.
Resveratrol attenuates mucus
hypersecretion in the lung of mice induced by LPS
To confirm the mitigating effect of resveratrol on
LPS-induced mucus hypersecretion in the lungs, the mucus expression
was assessed using PAS staining, RT-qPCR and western blotting.
Consistent with the in vitro experimental results,
resveratrol significantly suppressed MUC5AC mRNA and protein
expression in mouse lung tissues (Fig.
5A and B) and LPS-induced mucus hypersecretion (Fig. 5C).
Resveratrol alleviates airway
inflammation of mice exacerbated by LPS exposure
Compared with the control group, the LPS treatment
group showed a significant increase in the total number of cells
and neutrophils in BALF (Fig. 6A and
B). However, administration of resveratrol effectively
decreased the number of inflammatory cells and neutrophils
exacerbated by LPS in BALF (Fig. 6A
and B). In addition, H&E staining of the lungs collected
from mice in each group was performed to analyze histological
changes in the lungs. Compared with LPS-challenged mice,
administration of resveratrol markedly alleviated the infiltration
of exacerbated inflammatory cells in the lung tissue (Fig. 6C).
Resveratrol induces the
phosphorylation of ERK and Nrf2 activation in the lung of mice
The present study investigated the protein
expression levels of the MAPK signaling pathway in a mouse model
using western blotting. As shown in Fig. 6D, the phosphorylation levels of ERK
and p38 in the resveratrol + LPS group were significantly higher
than those in the LPS group. Meanwhile, the mRNA and protein level
of Nrf2 were increased in the resveratrol + LPS group compared with
the LPS group (P<0.05; Fig. 5A
and 5).
Discussion
Mucus overproduction is a major pathophysiological
factor in chronic airway inflammatory diseases, contributing to
airway obstruction, atelectasis and impaired gas exchange (1,3).
However, there remains a lack of effective therapeutic drugs to
regulate the expression of mucus secretion. The present study found
that resveratrol inhibited LPS-induced MUC5AC expression via MAPK
and Nrf2 signaling cascades in airway epithelia and mice (Fig. 7), providing new insight into the
molecular mechanisms underlying the regulation of LPS-induced mucin
overproduction. Therefore, it suggested that resveratrol may be a
potential therapeutic agent for excessive mucus secretion.
Resveratrol, a natural phenol, has been reported to
possess various biological effects including anti-oxidative,
anti-aging, anti-inflammatory, anti-cancer and immunomodulatory
effects. A recent study indicates that resveratrol suppresses
MUC5AC expression induced by EGF, PMA and TNF-α in the human airway
epithelium (21), but the
underlying mechanism remains to be elucidated. Resveratrol
treatment inhibits benzo(a)pyrene-induced MUC5AC overexpression in
NCI-H292 cells (36). Several
studies have demonstrated that LPS is a potent inducer of MUC5AC
expression and hence it is widely used (8–12).
However, it is unclear whether resveratrol has a similar effect on
LPS-induced MUC5AC overexpression. The present study found that
resveratrol alleviated LPS-induced MUC5AC expression in NCI-H292
cells and reduced LPS-induced lung inflammation in mice, using
RT-qPCR, western blotting and immunohistochemistry,
respectively.
The detailed mechanisms underlying
resveratrol-regulated LPS-induced mucus production remain to be
elucidated and necessitate further investigation. Oxidative stress
plays an important role in mucin production (37,38).
ROS have been found to mediate LPS-induced MUC5AC expression in
A549 cells (39–41). ROS also play a role in MUC5AC
expression induced by neutrophil elastase and the aryl hydrocarbon
receptor in human biliary and airway epithelial cells (38,42).
Resveratrol is a polyphenol nonflavonoid compound with strong
antioxidative activity. Several studies have reported that
resveratrol alleviates hypoxic pulmonary hypertension in rats via
anti-inflammatory and antioxidative pathways (43), alleviates pulmonary inflammation
and lung injury in LPS-induced acute lung injury mice (13,15)
and prevents inflammation and oxidative stress response in
LPS-induced human gingival fibroblasts (19). The present study found that
resveratrol decreased LPS-induced ROS production in NCI-H292 cells
and confirmed the role of the antioxidative pathway in
resveratrol-mediated MUC5AC regulation. It also observed that
resveratrol alleviated mucus overexpression and airway inflammation
exacerbated by LPS exposure in mice.
It is well known that the transcription factor Nrf2
effectively reduces ROS production and helps restore redox balance
(44–46). Previous reports revealed that Nrf2
plays an important role in MUC5AC expression induced by cigarette
smoking or neutrophil elastase (32,42).
As a potent activator of Nrf2, resveratrol has been demonstrated to
exert antioxidative and anti-inflammatory effects by inducing
Nrf2-mediated protective pathways. It is reported that resveratrol
alleviates rotenone-induced inflammation and oxidative stress
through Nrf2/Keap1/SLC7A11 pathway in a microglia cell line
(26). A study found that
resveratrol protects intestinal integrity and attenuates intestinal
inflammation and oxidative stress via aryl hydrocarbon
receptor/Nrf2 pathways in weaned piglets exposed to diquat
(25). Moreover, dietary
resveratrol alleviates the LPS-induced inflammatory response in
ducks through Nrf2 signaling pathways (47,48).
However, the role of Nrf2 in resveratrol-mediated regulation of
MUC5AC expression is not well characterized. The present study
revealed that resveratrol increased the expression levels of Nrf2
in NCI-H292 cells and mice, along with its downstream antioxidant
genes, such as HO-1 and GCLC. Therefore, the biological function of
resveratrol may be associated with ROS clearance through Nrf2
signaling. To further investigate the mechanism by which
resveratrol regulates MUC5AC, Nrf2 knockdown was achieved through
transfection with Nrf2-siRNA in NCI-H292 cells, which abrogated the
downregulation of LPS-induced MUC5AC expression in these cells.
Based on previous reports and the present study, it is hypothesized
that resveratrol attenuates LPS-induced MUC5AC expression via the
Nrf2 signaling pathway.
Aside from Nrf2, it is widely recognized that the
MAPK signaling pathway plays a pivotal role in regulating
Nrf2-dependent transcription. Studies have indicated that various
compounds downregulate LPS-induced MUC5AC expression via the MAPK
signaling pathway. Ghrelin suppresses LPS/leptin-induced MUC5AC
expression in human nasal epithelial cells by modulating the ERK1/2
and p38 MAPK pathways (30).
Peroxiredoxin 6 decreases MUC5AC expression in LPS-induced airway
inflammation through the H2O2-EGFR-MAPK
signaling pathway (49).
L-Glutamine alleviates MUC5AC expression and inflammation in mice
with LPS-induced acute lung injury via the TLR4/MAPK signal pathway
(50). In addition, resveratrol
decreases MUC5AC expression by inhibiting ERK and AKT signaling in
mucus-producing A549 human lung carcinoma cells (23). However, there is no study
demonstrating the role of the MAPK pathway in LPS-induced MUC5AC
expression. Consequently, the present study investigated whether
the MAPK pathway is involved in the cytoprotective effects of
resveratrol against LPS exposure. In the in vitro
inflammation model, MAPK inhibitors were used to investigate the
role of the MAPK pathway in the effect of resveratrol on
LPS-induced MUC5AC expression in NCI-H292 cells. The findings
revealed that resveratrol significantly induced the phosphorylation
of ERK and p38, as well as the activation of Nrf2 in NCI-H292 cells
and C57BL mice. However, inhibitors of ERK (PD98059) and p38
(SB203580) all suppressed Nrf2 expression in NCI-H292 cells.
Additionally, the inhibition of ERK and p38 MAPK abolished the
resveratrol-induced downregulation of MUC5AC expression. Therefore,
these results suggested that resveratrol inhibited LPS-induced
MUC5AC expression via activating ERK/p38 MAPK and Nrf2 pathways.
The present study did not involve pharmacokinetics and
pharmacodynamics of resveratrol and clinical studies, which should
be performed in the future to guide clinical practice.
In conclusion, the present study indicated that
resveratrol alleviated LPS-induced MUC5AC expression, inflammation
and oxidative stress response through the ERK/p38 MAPK and Nrf2
pathways in bronchial epithelial cells and mice. These findings
provided new perspectives on the therapeutic approaches for airway
mucus hypersecretion.
Supplementary Material
Supporting Data
Acknowledgements
Not applicable.
Funding
The present study was supported by grants from Natural Science
Foundation of Fujian Province (grant no. 2024J01687) and Science
and Technology Foundation of Quanzhou City (grant no.
2022NS087).
Availability of data and materials
The data generated in the present study may be
requested from the corresponding author.
Authors' contributions
QC, LX and JW contributed to the literature search
and study design. XL conceived and designed the study. QC, LX, JW,
XY, XS and XL drafted the manuscript. QC, LX and JW performed the
experiments. QC and LX contributed to data collection and analysis.
XS and XY provided overall guidance and helped with the
experiments. QC, LX and XL revised the manuscript. QC, LX, JW and
XL confirm the authenticity of all the raw data. All authors read
and approved the final manuscript.
Ethics approval and consent to
participate
The animal study protocol was reviewed and approved
by the Experimental Animal Ethics Committee of the second
affiliated hospital of Fujian Medical University (approval no.
2022-FYFE-559). All methods were performed in accordance with the
relevant guidelines and regulations.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Hill DB, Button B, Rubinstein M and
Boucher RC: Physiology and pathophysiology of human airway mucus.
Physiol Rev. 102:1757–1836. 2022. View Article : Google Scholar : PubMed/NCBI
|
|
2
|
Fahy JV and Dickey BF: Airway mucus
function and dysfunction. N Engl J Med. 363:2232–2247. 2010.
View Article : Google Scholar
|
|
3
|
Ma J, Rubin BK and Voynow JA: Mucins,
mucus, and goblet cells. Chest. 154:169–176. 2018. View Article : Google Scholar : PubMed/NCBI
|
|
4
|
Vestbo J, Prescott E and Lange P:
Association of chronic mucus hypersecretion with FEV1 decline and
chronic obstructive pulmonary disease morbidity. Am J Respir Crit
Care Med. 153:1530–1535. 1996. View Article : Google Scholar : PubMed/NCBI
|
|
5
|
Burgel PR, Nesme–Meyer P, Chanez P,
Caillaud D, Carré P, Perez T and Roche N: Cough and sputum
production are associated with frequent exacerbations and
hospitalizations in COPD subjects. Chest. 135:975–982. 2009.
View Article : Google Scholar : PubMed/NCBI
|
|
6
|
Prescott E, Lange P and Vestbo J: Chronic
mucus hypersecretion in COPD and death from pulmonary infection.
Eur Respir J. 8:1333–1338. 1995. View Article : Google Scholar : PubMed/NCBI
|
|
7
|
Dickey BF, Lai Y, Frick M and Brunger AT:
Discovery of a drug to treat airway mucus hypersecretion. Clin
Transl Med. 12:e9722022. View
Article : Google Scholar : PubMed/NCBI
|
|
8
|
Maldonado RF, Sá-Correia I and Valvano MA:
Lipopolysaccharide modification in Gram-negative bacteria during
chronic infection. FEMS Microbiol Rev. 40:480–493. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
9
|
Wang X, Wang Y, Zhao X, Andersson R, Song
Z and Yang D: Potential effects of peroxisome
proliferator-activated receptor activator on LPS-induced lung
injury in rats. Pulm Pharmacol Ther. 22:318–325. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
10
|
Hardaker EL, Freeman MS, Dale N, Bahra P,
Raza F, Banner KH and Poll C: Exposing rodents to a combination of
tobacco smoke and lipopolysaccharide results in an exaggerated
inflammatory response in the lung. Br J Pharmacol. 160:1985–1996.
2010. View Article : Google Scholar : PubMed/NCBI
|
|
11
|
Di Lorenzo F, Silipo A, Bianconi I, Lore
NI, Scamporrino A, Sturiale L, Garozzo D, Lanzetta R, Parrilli M,
Bragonzi A and Molinaro A: Persistent cystic fibrosis isolate
Pseudomonas aeruginosa strain RP73 exhibits an under-acylated LPS
structure responsible of its low inflammatory activity. Mol
Immunol. 63:166–175. 2015. View Article : Google Scholar : PubMed/NCBI
|
|
12
|
De Stefano D, Ungaro F, Giovino C,
Polimeno A, Quaglia F and Carnuccio R: Sustained inhibition of IL-6
and IL-8 expression by decoy ODN to NF-κB delivered through
respirable large porous particles in LPS-stimulated cystic fibrosis
bronchial cells. J Gene Med. 13:200–208. 2011. View Article : Google Scholar : PubMed/NCBI
|
|
13
|
Jiang L, Zhang L, Kang K, Fei D, Gong R,
Cao Y, Pan S and Zhao M and Zhao M: Resveratrol ameliorates
LPS-induced acute lung injury via NLRP3 inflammasome modulation.
Biomed Pharmacother. 84:130–138. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
14
|
Guo B, Peng Y, Gu Y, Zhong Y, Su C, Liu L,
Chai D, Song T, Zhao N, Yan X and Xu T: Resveratrol pretreatment
mitigates LPS-induced acute lung injury by regulating conventional
dendritic cells' maturation and function. Open Life Sci.
16:1064–1081. 2021. View Article : Google Scholar : PubMed/NCBI
|
|
15
|
Zhang Y, Wang G, Zhang D and Sun X:
Resveratrol ameliorates LPS-induced acute lung injury mouse model
via induction of tristetraprolin. Comb Chem High Throughput Screen.
26:838–847. 2023. View Article : Google Scholar : PubMed/NCBI
|
|
16
|
Wang C, Yuan J and Du J: Resveratrol
alleviates acute lung injury through regulating PLSCR-3-mediated
mitochondrial dysfunction and mitophagy in a cecal ligation and
puncture model. Eur J Pharmacol. 913:1746432021. View Article : Google Scholar : PubMed/NCBI
|
|
17
|
de Oliveira MTP, de Sá Coutinho D, de
Souza ET, Guterres SS, Pohlmann AR, Silva PMR, Martins MA and
Bernardi A: Orally delivered resveratrol-loaded lipid-core
nanocapsules ameliorate LPS-induced acute lung injury via the ERK
and PI3K/Akt pathways. Int J Nanomedicine. 14:5215–5228. 2019.
View Article : Google Scholar : PubMed/NCBI
|
|
18
|
de Oliveira MT, de Sá Coutinho D, Guterres
SS, Pohlmann AR, Silva PMR, Martins MA and Bernardi A:
Resveratrol-loaded lipid-core nanocapsules modulate acute lung
inflammation and oxidative imbalance induced by LPS in mice.
Pharmaceutics. 13:6832021. View Article : Google Scholar : PubMed/NCBI
|
|
19
|
Li L, Li J, Wang Y, Liu X, Li S, Wu Y,
Tang W and Qiu Y: Resveratrol prevents inflammation and oxidative
stress response in LPS-induced human gingival fibroblasts by
targeting the PI3K/AKT and Wnt/β-catenin signaling pathways. Genet
Mol Biol. 44:e202003492021. View Article : Google Scholar : PubMed/NCBI
|
|
20
|
Chen J, Yang X, Zhang W, Peng D, Xia Y, Lu
Y, Han X, Song G, Zhu J and Liu R: Therapeutic effects of
resveratrol in a mouse model of LPS and cigarette smoke-induced
COPD. Inflammation. 39:1949–1959. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
21
|
Lee SY, Lee HJ, Sikder MA, Shin HD, Kim
JH, Chang GT, Seok JH and Lee CJ: Resveratrol inhibits mucin gene
expression, production and secretion from airway epithelial cells.
Phytother Res. 26:1082–1087. 2012. View
Article : Google Scholar : PubMed/NCBI
|
|
22
|
Ni ZH, Tang JH, Chen G, Lai YM, Chen QG,
Li Z, Yang W, Luo XM and Wang XB: Resveratrol inhibits mucus
overproduction and MUC5AC expression in a murine model of asthma.
Mol Med Rep. 13:287–294. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
23
|
Lin YH, Zhu LY, Yang YQ, Zhang ZH, Chen
QG, Sun YP, Bi JJ, Luo XM, Ni ZH and Wang XB: Resveratrol inhibits
MUC5AC expression by regulating SPDEF in lung cancer cells.
Phytomedicine. 89:1536012021. View Article : Google Scholar : PubMed/NCBI
|
|
24
|
Zhuang Y, Wu H, Wang X, He J, He S and Yin
Y: Resveratrol attenuates oxidative stress-induced intestinal
barrier injury through PI3K/Akt-mediated Nrf2 signaling pathway.
Oxid Med Cell Longev. 2019:75918402019. View Article : Google Scholar : PubMed/NCBI
|
|
25
|
Xun W, Fu Q, Shi L, Cao T, Jiang H and Ma
Z: Resveratrol protects intestinal integrity, alleviates intestinal
inflammation and oxidative stress by modulating AhR/Nrf2 pathways
in weaned piglets challenged with diquat. Int Immunopharmacol.
99:1079892021. View Article : Google Scholar : PubMed/NCBI
|
|
26
|
Li H, Shen Y, Xiao H and Sun W:
Resveratrol attenuates rotenone-induced inflammation and oxidative
stress via STAT1 and Nrf2/Keap1/SLC7A11 pathway in a microglia cell
line. Pathol Res Pract. 225:1535762021. View Article : Google Scholar : PubMed/NCBI
|
|
27
|
Ropert C, Almeida IC, Closel M, Travassos
LR, Ferguson MA, Cohen P and Gazzinelli RT: Requirement of
mitogen–activated protein kinases and I kappa B phosphorylation for
induction of proinflammatory cytokines synthesis by macrophages
indicates functional similarity of receptors triggered by
glycosylphosphatidylinositol anchors from parasitic protozoa and
bacterial lipopolysaccharide. J Immunol. 166:3423–3431. 2001.
View Article : Google Scholar : PubMed/NCBI
|
|
28
|
Kim H, Seo JH and Kim KH: The effect of
p38 mitogen–activated protein kinase on mucin gene expression and
apoptosis in Helicobacter pylori–infected gastric epithelial cells.
Ann N Y Acad Sci. 1010:90–94. 2014. View Article : Google Scholar
|
|
29
|
Wang P, Ma X, He Y, Sun B, Zhu C, Zhao R,
Zhang S, Huang X and Liu Y: Effect of p38 mitogen–activate protein
kinase on MUC5AC protein expression of bile duct epithelial cells
in hepatolithiasis patients. Int J Clin Exp Pathol. 8:13753–13758.
2015.PubMed/NCBI
|
|
30
|
Choi YS, Na HG, Bae CH, Song SY and Kim
YD: Ghrelin downregulates lipopolysaccharide/leptin–induced MUC5AC
expression in human nasal epithelial cells. Clin Exp
Otorhinolaryngol. 16:49–58. 2023. View Article : Google Scholar : PubMed/NCBI
|
|
31
|
Zhou M, Meng L, He Q, Ren C and Li C:
Valsartan attenuates LPS–induced ALI by modulating NF–κB and MAPK
pathways. Front Pharmacol. 15:13210952024. View Article : Google Scholar : PubMed/NCBI
|
|
32
|
Ying YH, Lin XP, Zhou HB, Wu YF, Yan FG,
Hua W, Xia LX, Qiu ZW, Chen ZH, Li W and Shen HH: Nuclear erythroid
2 p45-related factor-2 Nrf2 ameliorates cigarette smoking-induced
mucus overproduction in airway epithelium and mouse lungs. Microbes
Infect. 16:855–863. 2014. View Article : Google Scholar : PubMed/NCBI
|
|
33
|
Lin XP, Xue C, Zhang JM, Wu WJ, Chen XY
and Zeng YM: Curcumin inhibits lipopolysaccharide-induced mucin 5AC
hypersecretion and airway inflammation via nuclear factor erythroid
2-related factor 2. Chin Med J (Engl). 131:1686–1693. 2018.
View Article : Google Scholar : PubMed/NCBI
|
|
34
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001.
View Article : Google Scholar : PubMed/NCBI
|
|
35
|
du Sert NP, Hurst V, Ahluwalia A, Alam S,
Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, et al:
The ARRIVE guidelines 2.0: Updated guidelines for reporting animal
research. PLoS Biol. 18:e30004102020. View Article : Google Scholar : PubMed/NCBI
|
|
36
|
Sun Y, Shi Z, Lin Y, Zhang M, Liu J, Zhu
L, Chen Q, Bi J, Li S, Ni Z and Wang X: Benzo(a)pyrene induces
MUC5AC expression through the AhR/mitochondrial ROS/ERK pathway in
airway epithelial cells. Ecotoxicol Environ Saf. 210:1118572021.
View Article : Google Scholar : PubMed/NCBI
|
|
37
|
Yan F, Li W, Jono H, Li Q, Zhang S, Li JD
and Shen H: Reactive oxygen species regulate Pseudomonas aeruginosa
lipopolysaccharide-induced MUC5AC mucin expression via PKC-NADPH
oxidase-ROS-TGF-alpha signaling pathways in human airway epithelial
cells. Biochem Biophys Res Commun. 366:513–519. 2017. View Article : Google Scholar : PubMed/NCBI
|
|
38
|
Chiba T, Uchi H, Tsuji G, Gondo H, Moroi Y
and Furue M: Arylhydrocarbon receptor (AhR) activation in airway
epithelial cells induces MUC5AC via reactive oxygen species (ROS)
production. Pulm Pharmacol Ther. 24:133–140. 2011. View Article : Google Scholar : PubMed/NCBI
|
|
39
|
Binker MG, Binker-Cosen AA, Richards D,
Oliver B and Cosen-Binker LI: LPS-stimulated MUC5AC production
involves Rac1-dependent MMP-9 secretion and activation in NCI-H292
cells. Biochem Biophys Res Commun. 386:124–129. 2009. View Article : Google Scholar : PubMed/NCBI
|
|
40
|
Li W, Yan F, Zhou H, Lin X, Wu Y, Chen C,
Zhou N, Chen Z, Li JD and Shen H: P. aeruginosa
lipopolysaccharide-induced MUC5AC and CLCA3 expression is partly
through Duox1 in vitro and in vivo. PLoS One. 8:e639452013.
View Article : Google Scholar : PubMed/NCBI
|
|
41
|
Li M, Tian Y, Wu S, Yu H and Li Y: LPS
stimulates MUC5AC expression in human biliary epithelial cells:
Whether there exists a possible pathway of PKC/NADPH/ROS? Mol Cell
Biochem. 385:87–93. 2014. View Article : Google Scholar : PubMed/NCBI
|
|
42
|
Qi L, Xiangdong Z, Hongmei Y, Xiaohong N
and Xiaoyan X: Regulation of neutrophil elastase-induced MUC5AC
expression by nuclear factor erythroid-2 related factor 2 in human
airway epithelial cells. J Investig Med. 58:730–736. 2010.
View Article : Google Scholar : PubMed/NCBI
|
|
43
|
Xu D, Li Y, Zhang B, Wang Y, Liu Y, Luo Y,
Niu W, Dong M, Liu M, Dong H, et al: Resveratrol alleviate hypoxic
pulmonary hypertension via anti-inflammation and anti-oxidant
pathways in rats. Int J Med Sci. 13:942–954. 2016. View Article : Google Scholar : PubMed/NCBI
|
|
44
|
Ma Q: Role of nrf2 in oxidative stress and
toxicity. Annu Rev Pharmacol Toxicol. 53:401–26. 2013. View Article : Google Scholar : PubMed/NCBI
|
|
45
|
Hybertson BM, Gao B, Bose SK and McCord
JM: Oxidative stress in health and disease: The therapeutic
potential of Nrf2 activation. Mol Aspects Med. 32:234–246. 2011.
View Article : Google Scholar : PubMed/NCBI
|
|
46
|
Singh S, Vrishni S, Singh BK, Rahman I and
Kakkar P: Nrf2-ARE stress response mechanism: A control point in
oxidative stress-mediated dysfunctions and chronic inflammatory
diseases. Free Radic Res. 44:1267–1288. 2010. View Article : Google Scholar : PubMed/NCBI
|
|
47
|
Yang H, Wang Y, Liu M, Liu X, Jiao Y, Jin
S, Shan A and Feng X: Effects of dietary resveratrol
supplementation on growth performance and anti-inflammatory ability
in ducks (Anas platyrhynchos) through the Nrf2/HO-1 and TLR4/NF-κB
signaling pathways. Animals (Basel). 11:35882021. View Article : Google Scholar : PubMed/NCBI
|
|
48
|
Yang H, Wang Y, Jin S, Pang Q, Shan A and
Feng X: Dietary resveratrol alleviated lipopolysaccharide-induced
ileitis through Nrf2 and NF-κB signalling pathways in ducks (Anas
platyrhynchos). J Anim Physiol Anim Nutr (Berl). 106:1306–1320.
2022. View Article : Google Scholar : PubMed/NCBI
|
|
49
|
Yang D, Jin M, Bai C, Zhou J and Shen Y:
Peroxiredoxin 6 suppresses Muc5ac overproduction in LPS-induced
airway inflammation through H2O2-EGFR-MAPK
signaling pathway. Respir Physiol Neurobiol. 236:84–90. 2017.
View Article : Google Scholar : PubMed/NCBI
|
|
50
|
Huang J, Liu J, Chang G, Wang Y, Ma N, Roy
AC and Shen X: Glutamine supplementation attenuates the
inflammation caused by LPS-induced acute lung injury in mice by
regulating the TLR4/MAPK signaling pathway. Inflamation.
44:2180–2192. 2021. View Article : Google Scholar
|
