Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2015 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2015 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells

  • Authors:
    • Ping Luo
    • Jing Fei
    • Jianwei Zhou
    • Weijiang Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Fuyang People's Hospital, Hangzhou, Zhejiang 311400, P.R. China, Department of Gynecology, The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310009, P.R. China
  • Pages: 2225-2229
    |
    Published online on: March 3, 2015
       https://doi.org/10.3892/ol.2015.3012
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Primary ovarian cancer is one of the predominant causes of mortality from gynecological cancer. The suppression of serine/threonine p21‑activated kinases (PAKs), proteins involved in cell morphology and cytoskeletal reorganization, has been hypothesized to improve the survival of patients with ovarian cancer. However, the association between microRNA-126 (miR‑126) and PAK4 in the inhibition of ovarian cancer cell invasion remains to be established. The present study demonstrated changes in the level of PAK4 expression in ovarian cancer SKOV3 cells with altered miR-126 compared with normal SKOV3 cells. The SKOV3 cells that were transfected with LV3‑miR‑126 to increase miR-126 expression exhibited significantly downregulated expression levels of PAK4 (P<0.05), whilst transfection with the LV3‑hsa‑miR‑126 inhibitor increased the expression of PAK4 in these cells (P<0.05), as assessed by immunofluorescence staining. Furthermore, western blot analysis revealed a significant increase in PAK4 expression in the SKOV3 cells transfected with the LV3‑hsa‑miR‑126 inhibitor, and a decrease in those transfected with LV3‑hsa‑miR‑126. The present study provides an experimental foundation for miR‑126 as a potential tumor suppressor that may decrease PAK4 expression to inhibit ovarian cancer cells.

Introduction

Epithelial ovarian cancer is one of the most common causes of mortality among females (1). The high mortality rate of ovarian cancer patients (9.30 out of every 100,000 patients each year) is a consequence of late-stage diagnosis, and the five-year survival rate (<50% for patients >64 years) for the advanced stages is extremely poor in the USA, Europe and Japan (2). A large tumor burden and extensive metastatic lesions of the abdominal cavity also contribute to the poor prognosis and the high rate of mortality of this disease (3). Tumor cell migration/invasion is a complex process involving cytoskeletal reorganization and membrane ruffling. The suppression of cytoskeletal reorganization and the redistribution of actin fibers may lead to the formation of non-adhesive membrane protrusions and therefore, dysregulated cellular adhesion capacity; this has been hypothesized to improve the survival of patients with ovarian cancer (4).

The actin cytoskeleton is essential for cell motility and cell invasion (5,6). Serine/threonine p21-activated kinases (PAKs) are effector proteins for the Rho GTPases Cdc42 and Rac, which are important for cell morphology and cytoskeletal reorganization (7,8). PAK4 was initially identified due to its regulation of cytoskeletal reorganization (9,10). Subsequent studies indicated that PAK4 is a key integrator of cell migration, invasion and apoptosis (11,12). Furthermore, PAK4 is upregulated in the majority of cancer cell lines, while previous studies have revealed that PAK4 is strongly linked to the progression of ovarian tumors and breast cancer. Additionally, overexpression of PAK4 in mammary epithelial cells leads to tumorigenesis in mice. Therefore, this protein may be a valuable molecular prognostic marker and therapeutic target in a number of cancers (13–16).

microRNAs (miRNA/miR), are non-coding RNAs of ~22 nucleotides, and are involved in various cellular processes, including proliferation, differentiation, apoptosis and invasion (17–19). miR-126 originates from a common precursor structure located within the EGFL7 gene, and its expression levels have been reported to vary in a number of human cancers; patients with low miR-126 expression exhibit poor survival compared with patients with high miR-126 levels (20–23). It has been proposed that miR-126 is essential in the inhibition of the invasive growth of cancer cells. Thus, the current study investigated whether the up- or downregulation of miR-126 modulates PAK4 expression in human ovarian cancer cells.

Materials and methods

Cell culture

SKOV3 cells (American Type Culture Collection, Rockville, MD, USA) were used as the ovarian cancer cells in the present study. The cells were maintained and propagated in vitro by serial passage in Dulbecco's modified Eagle's medium (DMEM; Gibco, Life Technologies Corporation, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Life Technologies Corporation), 100 IU/ml penicillin and 100 µg/ml streptomycin in a humidified atmosphere of 5% CO2 at 37°C. All procedures were performed according to the internationally accepted ethical guidelines and approved by the Institutional Review Board of the Second Affiliated Hospital, School of Medicine, Zhejiang University (Hangzhou, China).

Plasmid construction, lentivirus packaging and cell infection

pGLV3/H1/green fluorescent protein (GFP)+Puro (pGLV3; Shanghai GenePhama Co., Ltd., Shanghai, China), a lentiviral vector, was used to construct the pGLV3-miR-126 plasmid. The miR-126 mimic, miR-126 inhibitor and negative control (NC) oligonucleotides were chemosynthesized by Shanghai GenePhama Co., Ltd. The oligonucleotide sequences were as follows: miR-126, 5′-TCGTACCGTGAGTAATAATGCG-3′; hsa-miR-126 inhibitor, 5′-CGCATTATTACTCACGGTACGA-3′; and microRNA NC, 5′-TTCTCCGAACGTGTCACGT-3′. The miR-126 small hairpin (sh)DNA double chain template sequence was synthesized artificially, and inserted into the pGLV3-miRNA lentivirus plasmid. The miR-126 mimic sequence was constructed as follows: (Forward) hsa-miR-126-BamHI, GATCCGTCGTACCGTGAGTAATAATGCGTTCAAGAGACGCATTATTACTCACGGTACGACTTTTTTG; (reverse) hsa-miR-126-EcoRI, AATTCAAAAAAGTCGTACCGTGAGTAATAATGCGTCTCTTGAACGCATTATTACTCACGGTACGACG. The miRNA-126 inhibitor sequence was constructed as follows: (Forward) hsa-miR-126-BamHI, GATCCGAGCATGGCACTCATTATTACGCTTCAAGAGAGCGTAATAATGAGTGCCATGCTCTTTTTTG; (reverse) hsa-miR-126-EcoRI, AATTCAAAAAAGAGCATGGCACTCATTATTACGCTCTCTTGAAGCGTAATAATGAGTGCCATGCTCG. pGLV3-shDNA-NC was used as a negative control, with the following sequence: (Forward) NC-BamHI, GATCCGTCGTACCGTGAGTAATAATGCGTTCAAGAGACGCATTATTACTCACGGTACGACTTTTTTG; (reverse) shNC-EcoRI, AATTCAAAAAAGTCGTACCGTGAGTAATAATGCGTCTCTTGAACGCATTATTACTCACGGTACGACG.

The 293T producer cell line (Cell Bank of Chinese Academy of Science, Beijing, China) was maintained in DMEM, with 10% FBS, 4.0 mM L-glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. One day prior to transfection, the cells were seeded into a 15-cm dish. pGLV3-miR-126 or pGLV3 vectors and packing plasmids, including pGag/Pol, pRev and pVSV-G (Shanghai GenePhama Co., Ltd.) were co-transfected using RNAi-mate (Shanghai GenePhama Co., Ltd.), according to the manufacturer's instruction. At 72 h post-transfection, the supernatant was harvested, cleared by centrifugation (2,200 × g at 4°C for 4 min), passed through a 0.45-µm syringe filter, and cleared by centrifugation again (20,000 rpm at 4°C for 2 h). The titer of the virus was measured according to the expression level of GFP, following the manufacturer's instructions. The packaged lentiviruses were designated LV3-hsa-miR-126, LV3-hsa-miR-126 inhibitor and LV3-NC. The sequences of the resulting vectors were verified by sequence analysis.

The SKOV3 cells were infected with LV3-hsa-miR-126, LV3-has-miR-126 inhibitor or LV3-NC, at a multiplicity of infection ratio of 15, in the presence of 5 µg/ml polybrene (Shanghai GenePhama Co., Ltd.); the infection efficiency was 80–90%, as assessed by microscopic analysis of GFP fluorescence.

Immunofluorescence staining and western blot analysis

At 48 h post-transfection, the cells were fixed in 4% paraformaldehyde, washed three times with phosphate-buffered saline (PBS), and incubated for 5 min at −20°C in 95% ethanol (vol/vol in PBS). The cells were subsequently washed three times with PBS, blocked for 1 h in 5% normal goat serum in PBS with 0.1X Triton X-100, and incubated overnight with polyclonal rabbit anti-human PAK4 antibodies (Abcam, Cambridge, MA, USA; dilution, 1:200) at 4°C. The following day, the cells were washed three times with PBS and incubated for 40 min at 37°C with the corresponding secondary antibody [polyclonal goat anti-rabbit immunoglobulin (Ig)G (H+L)-tetramethylrhodamine (TRITC); dilution 1:200; SouthernBiotech, Birmingham, AL, USA], then washed and mounted. Immunostained SKOV3 cultures were examined under a laser scanning confocal microscope (LSM 510 Meta; Carl Zeiss Microscopy GmbH, Jena, Germany) for detection of the TRITC-fluorophore. Each group was photographed at x400 magnification with the aid of a digital camera attached to the microscope, and the expression of PAK4 was assessed by calculating the percentage of positive cells and the optical density, subsequent to defining a threshold for background correction.

For the western blot analysis, proteins were extracted from the SKOV3 cells, solubilized in radioimmunoprecipitation assay buffer, separated on 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (Wuhan Boster Ltd., Wuhan, China) and electro-transferred onto polyvinylidene difluoride membranes (Invitrogen Life Technologies, Carlsbad, CA, USA). The membranes were blocked in 5% skimmed milk powder prepared in Tris-buffered saline with Triton X-100 (TBS-T) for 30 min. For PAK4 detection, the membranes were incubated at 4°C overnight with anti-PAK4 antibodies (Abcam; dilution 1:500). The membranes were washed three times for 10 min in TBS-T and incubated with a 1:5,000 dilution of horseradish peroxidase-conjugated goat anti-rabbit IgG for 2 h. Finally, the membranes were washed six times for 20 min each in TBS-T, prior to development with a standard enhanced chemiluminescence kit (KeyGEN Biotech, Nanjing, China). The densitometric analysis of the PAK4 and β-actin bands was assayed by Quantity One software (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Statistical analysis

All data are presented as the mean ± standard deviation (SD). Statistical analysis was performed using SPSS statistical software, version 17.0 (SPSS, Inc., Chicago, IL, USA) for Windows. The significance of any differences between groups was evaluated using one-way analysis of variance. P<0.05 was considered to indicate a statistically significant difference.

Results

Immunofluorescence double staining and semi-quantitative confocal laser scanning analysis detected the expression of the miRNA vectors and PAK4 in the following four groups of SKOV3 cells: Untransfected cells, LV3-NC-transfected cells, LV3-hsa-miR-126-transfected cells and LV3-hsa-miR-126 inhibitor-transfected cells. The expression of PAK4 was indicated by red immunofluorescence staining, and the GFP expressed by the miRNA vectors (green fluorescence) highlighted successfully transfected cells; green fluorescence was detected in all of the nuclei, but only in certain cytoplasmic regions of the SKOV3 cells in the NC, miR-126 inhibitor and miR-126 mimic groups. The mean immunofluorescence intensity of PAK4 in the miR-126 inhibitor group was significantly higher (Fig. 1, C2) compared with that of the untransfected SKOV3 cells (Fig. 1, A2). Furthermore, the expression level of PAK4 was effectively decreased by the overexpression of miR-126 in the LV3-hsa-miR-126-transfected cells (Fig. 1, D2) compared with that of the untransfected SKOV3 cells (Fig. 1, A2), and particularly compared with that of LV3-hsa-miR-126 inhibitor-transfected cells (Fig. 1, C2). Furthermore, as shown in Fig. 1 C3, the cells transfected with LV3-hsa-miR-126 inhibitor (green) exhibited greater expression of PAK4 (red), whilst cells transfected with LV3-hsa-miR-126 (green) exhibited reduced expression of PAK4 (red) (Fig. 1 D3).

Figure 1.

Immunofluorescence staining of PAK4 in four groups (magnification, x400): (A) Untransfected SKOV3 cells; (B) SKOV3 cells transfected by LV3 negative control; (C) SKOV3 cells transfected by LV3-hsa-miR-126 inhibitor; and (D) SKOV3 cells transfected by LV3-hsa-miR-126. (1) Green fluorescent protein-positive cells are indicated by green signals; (2) PAK4-positively stained cells are indicated by red signals; (3) merged images. The mean immunofluorescence intensities of PAK4 in the miR-126 inhibitor group were significantly higher (C2) than that of control group cells (A2), while the expression of PAK4 in the miR-126 upregulated group (D2) was significantly lower compared with that in the control group cells (P<0.05). PAK, serine/threonine p21-activated kinase.

PAK4 protein expression in the four groups of cells was also evaluated by western blotting. PAK4 was visible as bands of ~64 kDa. A densitometric analysis of the PAK4/β-actin bands revealed a significant increase in PAK4 expression in the SKOV3 cells transfected with LV3-hsa-miR-126 inhibitor (mean ± SD, 215.1±10.5 vs. 128.6±8.2%; P=0.001) and a decrease in PAK4 expression in the SKOV3 cells transfected with LV3-hsa-miR-126 (mean ± SD, 91.6±7.7 vs. 128.6±8.2%; P=0.002), compared with the untransfected SKOV3 cells (Fig. 2). No significant difference was observed between the expression in the SKOV3 cells in the NC group and those that were untransfected (mean ± SD, 130.9±9.1 vs. 128.6±8.2%; P=0.706; Fig. 2). Therefore, it is proposed that LV3-has-miR-126 inhibitor increases the expression of PAK4, whereas LV3-hsa-miR-126 attenuates this expression.

Figure 2.

Western blot analysis of PAK4 expression in four groups. Data are presented as the mean ± standard deviation. Normal, the group of untransfected SKOV3 cells; negative control, the group of SKOV3 cells transfected by LV3 negative control; miR-126 inhibitor, the group of SKOV3 cells transfected with LV3-hsa-miR-126 inhibitor; miR-126, the group of SKOV3 cells transfected by LV3-hsa-miR-126. *P>0.05, vs. normal group, #P<0.05, vs. normal group. miR/miRNA, microRNA; PAK, serine/threonine p21-activated kinase.

Discussion

In the present study, changes in PAK4 expression were demonstrated in ovarian cancer cells with up- or downregulated miR-126 (induced by the transfection of LV-miR-126 or LV-has-miR-126 inhibitor) when compared with normal ovarian cancer cells. The SKOV3 cells transfected with LV-hsa-miR-126 exhibited reduced expression of PAK4, while the cells transfected with LV-hsa-miR-126 inhibitor exhibited increased expression. These findings suggest that miR-126 is a potential tumor suppressor, with the ability to decrease the level of PAK4 in ovarian cancer SKOV3 cells.

The invasive ability of malignant cancer cells depends upon the altered regulation of cell migration by the membrane protrusion formation in response to chemotactic and migratory stimuli (6). Membrane protrusions are formed by polymerization of submembrane actin filaments. The PAK family comprises important signaling proteins that are indicated to be involved in a variety of cellular functions, including cell proliferation, migration and cytoskeletal organization (7,24). The family consists of six members, categorized into two groups: Group A, PAKs 1, 2 and 3; and group B, PAKs 4, 5 and 6 (7,25). PAK4 has been indicated to be involved in several types of cancer, and strong links have been observed between PAK4 and ovarian cancer (26). Analysis of cell migration and invasion in in vitro and in vivo studies has highlighted the contribution of PAK4 to the progression and metastasis of ovarian cancer; this is consistent with the role of PAK4 in the reorganization of the cytoskeleton and the migration of cells, which is at least in part executed in the cytoplasm (26). PAK4 expression and activation are important in cancer progression, and increased PAK4 expression has been shown to be associated with metastasis, progression to late stages of the disease, reduced patient survival and increased resistance to chemotherapy (13,14,27). The mechanisms by which PAK4 affects ovarian cancer cell progression include the control of cell migration, invasion and proliferation. PAK4 may act via the regulation of c-Src, mitogen-activated protein kinase kinase/extracellular signal-regulated kinases 1/2, matrix metalloproteinase-2, and c-Src/epidermal growth factor receptor. Inhibition of PAK4 may therefore be a potentially valuable therapeutic target (16,28).

miR-126 is a non-coding RNA that is involved in various cellular processes, including proliferation, differentiation, apoptosis and invasion (17,21,29). miRNAs that are upregulated in cancer may function as oncogenes through the negative regulation of tumor suppressor genes, whilst miRNAs that are downregulated may function as tumor suppressor genes and inhibit cancer by regulating oncogenes (30,31). miR-126 acts as a metastatic suppressor in a number of human cancers (21,23). However, the expression and function of miR-126 in ovarian cancer remains unclear. In the present study, the association between miR-126 and PAK4 was investigated in ovarian cancer cells. The results demonstrated that transfection with LV3-miR-126 may efficiently reduce the expression of PAK4 in SKOV3 cells. Furthermore, the LV-miR-126 inhibitor was observed to upregulate the expression of PAK4 in these cells.

In conclusion, as PAK4 is essential for ovarian cancer cell invasion, the present study provides an experimental foundation for the use of miR-126 as a potential tumor suppressor; this miRNA may potentially be used to decrease expression levels of PAK4, leading to the inhibition of ovarian cancer cell invasion. However, further studies are required to elucidate the mechanisms involved in the suppression of PAK4 by miR-126.

Acknowledgements

The authors would like to thank Dr Li Yu and Dr Hongya Wang for their excellent assistance. This study was supported by the National Natural Science Foundation of China (grant no. 81371881) and the Science and Technology Department of Zhejiang Province, China (grant no. 2011C23093).

References

1 

Buys SS, Partridge E, Black A, et al: PLCO Project Team: Effect of screening on ovarian cancer mortality: The Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Randomized Controlled Trial. JAMA. 305:2295–2303. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Matsuda A and Katanoda K: Five-year relative survival rate of ovarian cancer in the USA, Europe and Japan. Jpn J Clin Oncol. 44:1962014. View Article : Google Scholar : PubMed/NCBI

3 

Malek JA, Mery E, Mahmoud YA, et al: Copy number variation analysis of matched ovarian primary tumors and peritoneal metastasis. PLoS ONE. 6:e285612011. View Article : Google Scholar : PubMed/NCBI

4 

Brandhagen BN, Tieszen CR, Ulmer TM, Tracy MS, Goyeneche AA and Telleria CM: Cytostasis and morphological changes induced by mifepristone in human metastatic cancer cells involve cytoskeletal filamentous actin reorganization and impairment of cell adhesion dynamics. BMC Cancer. 13:352013. View Article : Google Scholar : PubMed/NCBI

5 

von Nandelstadh P, Gucciardo E, Lohi J, Li R, Sugiyama N, Carpen O and Lehti K: Actin-associated protein palladin promotes tumor cell invasion by linking extracellular matrix degradation to cell cytoskeleton. Mol Biol Cell. 25:2556–2570. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Yamaguchi H and Condeelis J: Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochim Biophys Acta. 1773:642–652. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Rane CK and Minden A: P21 activated kinases: Structure, regulation, and functions. Small GTPases. 5:52014. View Article : Google Scholar

8 

Zhu J, Attias O, Aoudjit L, Jiang R, Kawachi H and Takano T: p21-activated kinases regulate actin remodeling in glomerular podocytes. Am J Physiol Renal Physiol. 298:F951–F961. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Abo A, Qu J, Cammarano MS, Dan C, Fritsch A, Baud V, Belisle B and Minden A: PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia. EMBO J. 17:6527–6540. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Bompard G, Rabeharivelo G, Cau J, Abrieu A, Delsert C and Morin N: P21-activated kinase 4 (PAK4) is required for metaphase spindle positioning and anchoring. Oncogene. 32:910–919. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Paliouras GN, Naujokas MA and Park M: PAK4, a novel Gab1 binding partner, modulates cell migration and invasion by the Met receptor. Mol Cell Biol. 29:3018–3032. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Dart AE and Wells CM: P21-activated kinase 4 - not just one of the PAK. Eur J Cell Biol. 92:129–138. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Wells CM, Whale AD, Parsons M, Masters JR and Jones GE: PAK4: A pluripotent kinase that regulates prostate cancer cell adhesion. J Cell Sci. 123:1663–1673. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Minden A: The pak4 protein kinase in breast cancer. ISRN Oncol. 2012:6942012012.PubMed/NCBI

15 

Guo Q, Su N, Zhang J, Li X, Miao Z, Wang G, Cheng M, Xu H, Cao L and Li F: PAK4 kinase-mediated SCG10 phosphorylation involved in gastric cancer metastasis. Oncogene. 33:3277–3287. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Siu MK, Chan HY, Kong DS, et al: p21-activated kinase 4 regulates ovarian cancer cell proliferation, migration, and invasion and contributes to poor prognosis in patients. Proc Natl Acad Sci USA. 107:18622–18627. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Tokarz P and Blasiak J: The role of microRNA in metastatic colorectal cancer and its significance in cancer prognosis and treatment. Acta Biochim Pol. 59:467–474. 2012.PubMed/NCBI

18 

Zaman MS, Maher DM, Khan S, Jaggi M and Chauhan SC: Current status and implications of microRNAs in ovarian cancer diagnosis and therapy. J Ovarian Res. 5:442012. View Article : Google Scholar : PubMed/NCBI

19 

Luo J, Zhou J, Cheng Q, Zhou C and Ding Z: Role of microRNA-133a in epithelial ovarian cancer pathogenesis and progression. Oncol Lett. 7:1043–1048. 2014.PubMed/NCBI

20 

Frampton AE, Krell J, Jacob J, Stebbing J, Castellano L and Jiao LR: Loss of miR-126 is crucial to pancreatic cancer progression. Expert Rev Anticancer Ther. 12:881–884. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Feng R, Chen X, Yu Y, Su L, Yu B, Li J, Cai Q, Yan M, Liu B and Zhu Z: miR-126 functions as a tumour suppressor in human gastric cancer. Cancer Lett. 298:50–63. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Cristóbal I, Aguilera O, García-Foncillas J, Zazo S, Madoz-Gúrpide J and Rojo F: Clinical significance of miR-126 in colorectal cancer. Genes Chromosomes Cancer. 53:8812014. View Article : Google Scholar : PubMed/NCBI

23 

Sun Y, Bai Y, Zhang F, Wang Y, Guo Y and Guo L: miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem Biophys Res Commun. 391:1483–1489. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Menges CW, Sementino E, Talarchek J, Xu J, Chernoff J, Peterson JR and Testa JR: Group I p21-activated kinases (PAKs) promote tumor cell proliferation and survival through the AKT1 and Raf-MAPK pathways. Mol Cancer Res. 10:1178–1188. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Kumar R, Gururaj AE and Barnes CJ: p21-activated kinases in cancer. Nat Rev Cancer. 6:459–471. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Siu MK, Chan HY, Kong DS, et al: p21-activated kinase 4 regulates ovarian cancer cell proliferation, migration, and invasion and contributes to poor prognosis in patients. Proc Natl Acad Sci USA. 107:18622–18627. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Fu X, Feng J, Zeng D, Ding Y, Yu C and Yang B: PAK4 confers cisplatin resistance in gastric cancer cells via PI3K/Akt- and MEK/Erk-dependent pathways. Biosci Rep. 34:59–67. 2014. View Article : Google Scholar

28 

Zhang J, Wang J, Guo Q, Wang Y, Zhou Y, Peng H, Cheng M, Zhao D and Li F: LCH-7749944, a novel and potent p21-activated kinase 4 inhibitor, suppresses proliferation and invasion in human gastric cancer cells. Cancer Lett. 317:24–32. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Huang F, Zhu X, Hu XQ, Fang ZF, Tang L, Lu XL and Zhou SH: Mesenchymal stem cells modified with miR-126 release angiogenic factors and activate Notch ligand Delta-like-4, enhancing ischemic angiogenesis and cell survival. Int J Mol Med. 31:484–492. 2013.PubMed/NCBI

30 

Li L, Huang K, You Y, Fu X, Hu L, Song L and Meng Y: Hypoxia-induced miR-210 in epithelial ovarian cancer enhances cancer cell viability via promoting proliferation and inhibiting apoptosis. Int J Oncol. 44:2111–2120. 2014.PubMed/NCBI

31 

Zhang Y, Wang X, Xu B, Wang B, Wang Z, Liang Y, Zhou J, Hu J and Jiang B: Epigenetic silencing of miR-126 contributes to tumor invasion and angiogenesis in colorectal cancer. Oncol Rep. 30:1976–1984. 2013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Luo P, Fei J, Zhou J and Zhang W: microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells. Oncol Lett 9: 2225-2229, 2015.
APA
Luo, P., Fei, J., Zhou, J., & Zhang, W. (2015). microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells. Oncology Letters, 9, 2225-2229. https://doi.org/10.3892/ol.2015.3012
MLA
Luo, P., Fei, J., Zhou, J., Zhang, W."microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells". Oncology Letters 9.5 (2015): 2225-2229.
Chicago
Luo, P., Fei, J., Zhou, J., Zhang, W."microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells". Oncology Letters 9, no. 5 (2015): 2225-2229. https://doi.org/10.3892/ol.2015.3012
Copy and paste a formatted citation
x
Spandidos Publications style
Luo P, Fei J, Zhou J and Zhang W: microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells. Oncol Lett 9: 2225-2229, 2015.
APA
Luo, P., Fei, J., Zhou, J., & Zhang, W. (2015). microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells. Oncology Letters, 9, 2225-2229. https://doi.org/10.3892/ol.2015.3012
MLA
Luo, P., Fei, J., Zhou, J., Zhang, W."microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells". Oncology Letters 9.5 (2015): 2225-2229.
Chicago
Luo, P., Fei, J., Zhou, J., Zhang, W."microRNA‑126 suppresses PAK4 expression in ovarian cancer SKOV3 cells". Oncology Letters 9, no. 5 (2015): 2225-2229. https://doi.org/10.3892/ol.2015.3012
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team