Identification of a peptide specifically targeting ovarian cancer by the screening of a phage display peptide library

Wang,Ledan; Hu,Yue; Li,Wenju; Wang,Fan; Lu,Xiaosheng; Han,Xueying; Lv,Jieqiang; Chen,Jie

doi:10.3892/ol.2016.4549

Identification of a peptide specifically targeting ovarian cancer by the screening of a phage display peptide library

Authors:
- Ledan Wang
- Yue Hu
- Wenju Li
- Fan Wang
- Xiaosheng Lu
- Xueying Han
- Jieqiang Lv
- Jie Chen
View Affiliations

Affiliations: Department of Gynecology and Obstetrics, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China, Department of Children's Infectious Disease, The Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China
Published online on: May 9, 2016 https://doi.org/10.3892/ol.2016.4549
Pages: 4022-4026
Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )

Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )

Cited By (CrossRef): 0 citations Loading Articles...

Abstract

Ovarian cancer is the most common cause of cancer‑associated mortality in terms of gynecological malignancies, and is difficult to diagnose due to the absence of reliable biomarkers. To identify ovarian cancer‑specific biomarkers, the present study used a Ph.D.‑7™ Phage Display Peptide Library to screen for ligands that selectively target HO‑8910 ovarian cancer cells. Following 5 rounds of biopanning, the phage clone P2 was selected by enzyme‑linked immunosorbent assay and DNA sequencing, and its characteristics were additionally validated by immunofluorescence and immunohistochemical assays. The results revealed the positive phage were enriched 92‑fold following 5 rounds of biopanning, and the DNA sequence AACCCGATGATTCGCCGCCAG (amino acid sequence, NPMIRRQ) was repeated most frequently (phage clones, P2, P3, P15, P30 and P54). Immunofluorescence and immunohistochemical assays revealed that the phage clone P2 was able to bind to ovarian cancer cells and tissues, and not those of cervical cancer. In conclusion, the peptide NPMIRRQ may be a potential agent for the diagnosis of ovarian cancer.

View Figures

View References

1	Rooth C: Ovarian cancer: Risk factors, treatment and management. Br J Nurs. 22:S23–S30. 2013. View Article : Google Scholar : PubMed/NCBI
2	Collins Y, Holcomb K, Chapman-Davis E, Khabele D and Farley JH: Gynecologic cancer disparities: A report from the Health Disparities Taskforce of the Society of Gynecologic Oncology. Gynecol Oncol. 133:353–361. 2014. View Article : Google Scholar : PubMed/NCBI
3	Siegel R, Naishadham D and Jemal A: Cancer statistics, 2013. CA Cancer J Clin. 63:11–30. 2013. View Article : Google Scholar : PubMed/NCBI
4	Bocheva Y, Bochev P and Ivanov S: Ca-125 in diagnosis and monitoring of patients with ovarian cancer. Akush Ginekol (Sofiia). 54:11–7. 2015.PubMed/NCBI
5	Cannistra SA: Cancer of the ovary. N Engl J Med. 351:2519–2529. 2004. View Article : Google Scholar : PubMed/NCBI
6	Jemal A, Siegel R, Xu J and Ward E: Cancer statistics, 2010. CA Cancer J Clin. 60:277–300. 2010. View Article : Google Scholar : PubMed/NCBI
7	Smith GP: Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virion surface. Science. 228:1315–1317. 1985. View Article : Google Scholar : PubMed/NCBI
8	Parmley SF and Smith GP: Antibody-selectable filamentous fd phage vectors: Affinity purification of target genes. Gene. 73:305–318. 1988. View Article : Google Scholar : PubMed/NCBI
9	Velasco-Velázquez M, Xolalpa W and Pestell RG: The potential to target CCL5/CCR5 in breast cancer. Expert Opin Ther Targets. 18:1265–1275. 2014. View Article : Google Scholar : PubMed/NCBI
10	Bastien JI, McNeill KA and Fine HA: Molecular characterizations of glioblastoma, targeted therapy, and clinical results to date. Cancer. 121:502–516. 2015. View Article : Google Scholar : PubMed/NCBI
11	Henry KA, Arbabi-Ghahroudi M and Scott JK: Beyond phage display: Non-traditional applications of the filamentous bacteriophage as a vaccine carrier, therapeutic biologic, and bioconjugation scaffold. Front Microbiol. 6:7552015. View Article : Google Scholar : PubMed/NCBI
12	Kaplan G and Gershoni JM: A general insert label for peptide display on chimeric filamentous bacteriophages. Anal Biochem. 420:68–72. 2012. View Article : Google Scholar : PubMed/NCBI
13	Silacci M, Brack S, Schirru G, Mårlind J, Ettorre A, Merlo A, Viti F and Neri D: Design, construction, and characterization of a large synthetic human antibody phage display library. Proteomics. 5:2340–2350. 2005. View Article : Google Scholar : PubMed/NCBI
14	Lee KJ, Lee JH, Chung HK, Ju EJ, Song SY, Jeong SY and Choi EK: Application of peptide displaying phage as a novel diagnostic probe for human lung adenocarcinoma. Amino Acids. 48:1079–1086. 2016. View Article : Google Scholar : PubMed/NCBI
15	Che YJ, Wu HW, Hung LY, Liu CA, Chang HY, Wang K and Lee GB: An integrated microfluidic system for screening of phage-displayed peptides specific to colon cancer cells and colon cancer stem cells. Biomicrofluidics. 9:0541212015. View Article : Google Scholar : PubMed/NCBI
16	Ma CI, Yin G, Yan D, He X, Zhang L, Wei Y and Huang Z: A novel peptide specifically targeting ovarian cancer identified by in vivo phage display. J Pept Sci. 19:730–736. 2013. View Article : Google Scholar : PubMed/NCBI
17	Zhang L, Yin G, Yan D, Wei Y, Ma C, Huang Z, Liao X, Yao Y, Chen X and Hao B: In vitro screening of ovarian tumor specific peptides from a phage display peptide library. Biotechnol Lett. 33:1729–1735. 2011. View Article : Google Scholar : PubMed/NCBI