Open Access

ATP‑binding cassette transporter A7 accelerates epithelial‑to‑mesenchymal transition in ovarian cancer cells by upregulating the transforming growth factor‑β signaling pathway

Retraction in: /10.3892/ol.2024.14483

  • Authors:
    • Xia Liu
    • Qing Li
    • Jing Zhou
    • Su Zhang
  • View Affiliations

  • Published online on: August 24, 2018     https://doi.org/10.3892/ol.2018.9366
  • Pages: 5868-5874
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Ovarian cancer (OC) has the highest fatality rates of all gynecological malignancies worldwide. The epithelial‑to‑mesenchymal transition (EMT) serves an essential role in the progression of OC. An improved understanding of the molecular mechanism underlying EMT in OC may increase the survival rate. ATP‑binding cassette transporter A7 (ABCA7) is a candidate regulator of OC progression. However, the role of ABCA7 in OC is unclear. Using the PROGgeneV2 platform, the present study revealed that increased expression of ABCA7 is associated with poor outcomes in OC. The expression of ABCA7 was higher in OC tissues than in adjacent noncancerous tissues. ABCA7‑knockdown decreased the migration of OC cells and the activation of mothers against decapentaplegic homolog 4 (SMAD4). Notably, downregulation of ABCA7 also increased the expression of an epithelial marker (E‑cadherin) and decreased that of a mesenchymal marker (N‑cadherin). In addition, the decreased expression of SMAD4 and EMT markers induced by ABCA7 depletion could be rescued by transforming growth factor β1 (TGF‑β1) stimulation. Overall, these findings suggested that ABCA7 accelerates EMT in OC by upregulating the TGF‑β signaling pathway.

Introduction

Ovarian cancer (OC) is a leading cause of gynecological malignancy-associated mortality worldwide (1). The vast majority of patients with OC are diagnosed at a late stage with peritoneal dissemination, resulting in a 30% survival rate (2). The epithelial-to-mesenchymal transition (EMT) is a reversible and dynamic process hypothesized to occur during invasion and metastasis of several types of carcinoma (3).

The ATP-binding cassette (ABC) transporter superfamily includes seven subfamilies (ABCA to ABCG) comprising 48 transmembrane proteins. ABC transporters undertake the transport of various inflammatory mediators and lipids directly relevant to tumor progression in OC (4). Elsnerova et al (5) reported that the expression of ABCA7 was significantly higher in OC than in control ovarian tissue, and ABCA7 was upregulated in metastatic tumor tissue compared with primary OC. Additionally, increased expression of ABCA7 was significantly associated with poor outcomes in patients with OC (5,6). ABCA7 expression was also associated with poor disease-free survival and an elevated risk of colorectal carcinoma progression (6). Therefore, ABCA7 may be involved in the regulation of OC progression.

Transforming growth factor-β (TGF-β) is a key regulator of EMT; extracellular TGF-β signal is transduced through the activation of TGF-β receptors and subsequent phosphorylation of receptor-activated mothers against decapentaplegic homolog (SMAD), which form a heterotrimeric complex with SMAD4. Therefore, SMAD4 is a central transcription factor in TGF-β signaling (7). The TGF-β signaling pathway is reportedly involved in EMT in OC (8,9).

Patients and methods

Bioinformatics analysis

The ProgeneV2 prognostic database (http://www.abren.net/PrognoScan/) was used to collect information for analysis of the effect of ABCA7 on survival in patients with OC (10,11). Kaplan-Meier curve was applied for analyzing survival rate of patients with OC.

Patients

This study was approved by the Medical Ethics Committee of the Jining No. 1 People's Hospital (Shandong, China). Written informed consent was obtained from all participants. A total of 11 females with an average age of 45.7 years (range, 38–58 years) were enrolled in this study from May 2013 to June 2017. Peritoneal cytology was positive in six participants. Cancer tissues and corresponding adjacent ovarian non-cancerous tissues were obtained during oophorosalpingectomy or surgical debulking. Cancerous and adjacent ovarian non-cancerous tissues were confirmed histologically by hematoxylin and eosin staining as described in previous studies (12,13).

Immunohistochemistry (IHC)

IHC staining was performed by pathologists who were blind to the original hypothesis. IHC staining was performed manually using a IHC kit (cat. no. 25229-1; Wuhan Sanying Biotechnology Co., Ltd., Wuhan, China) accordingly to the manufacturer's protocol. Specimens were fixed in 10% formalin for 48 h at room temperature. Paraffin-embedded tumor specimens were sliced into serial sections of 5-µm thickness. ABCA7 expression was detected by IHC in paraffin-embedded specimens. All slides were dewaxed in xylene and dehydrated in an alcohol gradient (50, 75, 90 and 100%) (included in IHC kit), and then endogenous peroxidase activity was quenched with 3% hydrogen peroxide for 10 min at 37°C. Antigen retrieval was achieved by heating slides covered with citrate buffer (cat. no. 25229-1; Wuhan Sanying Biotechnology, Wuhan, China; pH 6.0) at 95°C for 10 min. Following this, 10% goat serum albumin (cat. no. 253441; Wuhan Sanying Biotechnology, Wuhan, China) was used to block nonspecific binding by incubating sections for 2 h at room temperature. Subsequently, the slides were incubated overnight with rabbit anti-ABCA7 monoclonal antibody (1:50; cat. no. 25339-1-AP; Wuhan Sanying Biotechnology) at 4°C. Slides were then incubated with a secondary antibody (1:200; cat. no. BA1039; Boster Biological Technology, Pleasanton, CA, USA) for 30 min at 37°C. For hematoxylin and eosin staining tissue sections after deparaffinization were rehydrated with 50% dimethylbenzene (cat. no. 253441; Wuhan Sanying Biotechnology) as the previously stated, and stained with 0.1% hematoxylin for 30 sec at 37°C, rinsed in water for 1 min, 0.1% eosin for 10–30 sec at 37°C, and dehydrated with 75% absolute alcohol (cat. no. 197543, Wuhan Sanying Biotechnology) at 37°C. All sections were observed under a light microscope (magnification, ×100 and ×200; Olympus Corporation, Tokyo, Japan). These expression levels were confirmed by semi-quantitative analyses using ImageJ software 1.46r (National Institutes of Health, Bethesda, MD, USA).

Cell culture and stimulation

The immortalized human ovarian surface epithelial HOSE 6–3 cell line and the ovarian cancer SKOV-3, Caov-3, A2780, OVCA433 and OVC429 cell lines were purchased commercially from the American Type Culture Collection (Manassas, VA, USA). The cell lines were cultured in RPMI-1640 medium (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 37°C and 5% CO2. TGF-β1 (Abcam, Cambridge, MA, USA) was dissolved in PBS to make a 10 mg/ml stock solution and then added in the medium to reach 10 ng/ml solution.

Lentiviral infection

A lentiviral short hairpin RNA (shRNA) construct targeting ABCA7 (cat. no. SHCLNV-NM_019112; shRNA Product kit) was purchased commercially from Sigma-Aldrich; Merck KGaA. Two shRNA sequences targeting ABCA7 were designed (Table I). The oligonucleotides were phosphorylated, annealed and cloned into thepLKO.1 vector (Sigma-Aldrich; Merck KGaA). Lentiviral infection was performed according to the manufacturer's protocols. The concentration of shRNA were 2×108/ml. Briefly, the cells were seeded at 2×105 cells/well in a 6-well plate prior to lentiviral particle infection and incubated with 2 ml RPMI-1640 medium supplemented with 10% FBS for 24 h. Subsequently, cells were infected with lentiviral particles (2×108/ml), and after 12 h, the virus-containing medium of infected cells was substituted with RPMI-1640 medium supplemented with 10% FBS, and infected cells were incubated with 2 µg/ml puromycin for 48 h at 37°C and 5% CO2. Empty lentiviral vectors were used as a control. Following screening for 48h, the infected cells were used in subsequent experiments.

Table I.

ABCA7 shRNA sequences.

Table I.

ABCA7 shRNA sequences.

shRNASequence (3′-5′)
shRNA1 CCGGCTCAATCCGATGCCATCTTTGCTCGA
GCAAAGATGGCATCGGATTGAGTTTTTTG
shRNA2 CCGGTCCTCGGGAAGCTACTCTTTGCTCGA
GCAAAGAGTAGCTTCCCGAGGATTTTTTG

[i] shRNA, short hairpin RNA.

Wound healing assay

SKVO-3 cells were seeded into 6-well plates and cultured to 100% confluence. A pipette tip was used to scratch a straight line in the cell layer to create a wound. Then, the cells were washed with PBS and treated with RPMI-1640 medium without FBS. Wound images were observed under a light microscope (magnification, ×200). The wound gap widths were measured using ImageJ software 1.46r.

Transwell migration assay

Cell culture inserts (24-well, 8-µm pore size; Sigma-Aldrich; Merck KGaA) were seeded with 1×105 cells in 200 µl RPMI-1640 medium without FBS in the upper chamber. RPMI-1640 medium with 5% FBS (500 µl) was added to the lower chamber and served as a chemotactic agent. Following incubation for 24 h, non-migrating cells were removed from the upper side of the membrane, and the cells on the lower side of the membrane were fixed with 4% paraformaldehyde for 15 min at 37°C. The cells were stained with crystal violet stainingfor 15 min at 37°C, and cell numbers were counted under a light microscope (magnification, ×200). Each individual experiment was performed with triplicate inserts, and five microscopic fields were counted per insert.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA, isolated from all cell lines using TRIzol® reagent (Takara Biotechnology Co., Ltd., Dalian, China), was reverse-transcribed into cDNA in a reaction volume of 20 µl using the Double-Strand cDNA Synthesis kit (Takara Biotechnology Co., Ltd.) at 37°C for 15 min. The generated cDNA was used as the template for the RT-qPCR reaction. All gene transcripts were quantified by RT-qPCR using the Power SYBR Green PCR Master mix on the ABI StepOnePlus system. The levels of mRNAs were determined using a StepOnePlus Realtime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the SYBR Premix Ex Taq (Takara Biotechnology Co., Ltd.) under the following conditions: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. The primer sequences were as follows: ABCA7 forward, 5′-GTGCTATGTGGACGACGTGTT-3′ and reverse, 5′-TGTCACGGAGTAGATCCAGGC-3′; and β-actin (internal control) forward, 5′-GAAGGTGAAGGTCGGAGT-3′and reverse, 5′-GAAGATGGTGATGGGATTT-3′. The 2−∆∆Cq method was used to calculate relative gene expression (14).

Western blot analysis

Cells were lysed in radioimmunoprecipitation assay lysis buffer supplemented with a protease inhibitor (Beyotime Institute of Biotechnology, Haimen, China). The concentration of total protein was detected by the BCA method. Whole cell extracts containing equal quantities of proteins (50 µg) were separated by 8% SDS-PAGE and then transferred to a polyvinylidene fluoride membrane. Following blocking in 10% bovine serum albumin at 37°C for 2 h, the membranes were incubated overnight at 4°C with antibodies specific to β-actin (cat. no. 4970S; 1:1,000; CST Biological Reagents Co., Ltd., Shanghai, China), ABCA7 (cat. no. 25339-1-AP; 1:200; ProteinTech Group, Inc., Chicago, IL, USA), N-cadherin (cat. no. ab76057; 1:1,000; Abcam), E-cadherin (cat. no. ab15148; 1:1,000; Abcam) and SMAD4 (cat. no. D3R4N; 1:1,000; CST Biological Reagents Co., Ltd.). Horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5,000; cat. no. BA1039; Boster Biological Technology) was applied as a secondary antibody for 1 h at 37°C. For all western blots, β-actin served as the internal control. All protein expression was quantified using Bio-Rad Quantity One software 4.68 (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Statistical analysis

Statistical analysis was performed using SPSS 19.0 software (IBM Corp., Armonk, NY, USA). All experiments were performed in a minimum of triplicate, and the data are presented as the mean ± standard deviation. Statistical significance was determined using one-way analysis of variance followed by Bonferroni's post hoc test when comparing more than two groups, and a two-tailed Student's t test when comparing two groups. P<0.05 was considered to indicate a statistically significant difference.

Results

High ABCA7 mRNA levels in OC tissues are associated with poor overall survival

Increased expression of ABCA7 mRNA in OC tissue was associated with a poor 5-year overall survival (high ABCA7 expression, n=40; low ABCA7 expression, n=39; hazard ratio =11.58, P=0.019; Fig. 1).

ABCA7 expression is increased in OC tissues compared with adjacent noncancerous tissues

Immunohistochemistry revealed thatABCA7 expression levels were significantly higher in OC tissues than in adjacent non-cancerous tissues (Fig. 2A and B; P<0.05).

ABCA7 mRNA levels in OC and adjacent non-cancerous tissues were determined by PCR. Adjacent non-cancerous tissue revealed significantly lower ABCA7 mRNA levels than OC tissues (Fig. 2C; P<0.05). Additionally, ABCA7 mRNA levels were higher in OC cell lines (SKOV-3, Caov-3, A2780, OVCA433 and OVC429) than in the normal HOSE 6–3 cell line (Fig. 2D; P<0.05). The ABCA7 mRNA level in SKOV-3 cells was moderate with representativeness; therefore, to avoid the ceiling and floor effects (8,9), the SKOV-3 cells with moderate ABCA7 levels were selected for subsequent experiments.

Downregulation of ABCA7 in SKOV-3 cells using shRNAs

shRNAs were used to downregulate ABCA7 expression in SKOV-3 cells; the effect on protein expression was confirmed by western blotting (Fig. 3).

ABCA7-knockdown decreases the migration of SKOV-3 cells and increases expression of E-cadherin and N-cadherin. EMT serves an important role in cancer migration and metastasis. During EMT, epithelial cells lose their cell-adhesive properties, repress the expression of epithelial markers and increase the expression of mesenchymal markers. Therefore, the present study examined the expression levels of an epithelial marker (E-cadherin) and a mesenchymal marker (N-cadherin). Western blot analysis revealed that the expression levels of E-cadherin and N-cadherin were decreased and increased, respectively, by ABCA7 depletion (Fig. 4A).

Furthermore, a Transwell migration assay revealed that migration of OC cells was markedly decreased by suppression of ABCA7 (Fig. 4B).

A wound migration assay was performed to evaluate the effect of ABCA7 on the migration of OC cells. ABCA7 depletion markedly reduced the wound-closure capacity of OC cells at 24 h (Fig. 4C).

ABCA7 depletion inhibits activation of the TGF-β signaling pathway and TGF-β1 increases the expression of EMT markers

To investigate the underlying molecular mechanism, the levels of proteins of the TGF-β signaling pathway, a key regulator of EMT, were evaluated. As previously mentioned, ABCA7-knockdown significantly decreased the level of SMAD4, a TGF-β-activated transcription factor (Fig. 4A).

The effect of TGF-β pretreatment on E-cadherin and N-cadherin expression in ABCA7-knockdown cells was subsequently investigated. The cells were pretreated with TGF-β1 (5 ng/ml) for 48 h (9,15). Of note, TGF-β1 pretreatment reduced E-cadherin levels in mock-transfected and ABCA7-knockdown cells (Fig. 5A and B). Conversely, SMAD4 and N-cadherin levels in mock-transfected and ABCA7-knockdown cells were significantly increased by TGF-β1 stimulation (Fig. 5A and B).

The viability of the cells was not affected by TGF-β1 stimulation (5 ng/ml for 48 h) (9,15). Compared with the control group, TGF-β1 stimulation significantly increased migration of mock-transfected and ABCA7-knockdown cells (Fig. 5C).

Discussion

Ovarian cancer (OC) is a leading cause of gynecological malignancy-associated mortality worldwide (1). Approximately 20% of types of OC are preventable through population-based testing for genes associated with susceptibility to OC (16). In the present study, it was revealed that higher expression of ABCA7 was associated with a lower survival rate in patients with OC. In addition, ABCA7 levels were revealed to be higher in OC tissues than in adjacent non-cancerous tissues. ABCA7-knockdown decreased the migration of OC cells. These results are consistent with those of previous reports (5,6).

EMT serves an important role in the progression of OC. At the molecular level, EMT underlies the dynamic cellular heterogeneity during metastasis (14). E-cadherin is a cell-to-cell adhesion molecule expressed predominantly by epithelial cells. E-cadherin is an important suppressor of metastasis. Downregulation of E-cadherin has several important consequences that are of direct relevance to EMT, and initiates a series of signaling events and a major reorganization of the cytoskeleton (17). Therefore, loss of E-cadherin is a marker of EMT (18). In the present study, it was demonstrated that ABCA7 depletion increased the expression of E-cadherin. Furthermore, decreased expression of E-cadherin during EMT is accompanied by increased expression of the mesenchymal marker N-cadherin, which renders the cell more motile and invasive (11). Increased E-cadherin and decreased N-cadherin were identified following ABCA7 depletion in the present study, suggesting that ABCA7 is associated with EMT in OC cells.

The TGF-β signaling pathway promotes metastasis of OC cells as a moderator of EMT (12). The decreased expression of SMAD4 and EMT markers induced by ABCA7 depletion could be rescued by TGF-β stimulation. In the present study, ABCA7-knockdown also decreased expression of SMAD4, a transcription factor important in TGF-β signaling (12). These data suggested that ABCA7 activates the TGF-β signaling pathway in OC cells. The reduction in SMAD4 expression induced by ABCA7 depletion could be rescued by TGF-β1 stimulation (5 ng/ml for 48 h). Therefore, the data from the present study suggested that ABCA7 accelerates EMT in OC cells via the TGF-β signaling pathway. Similar results have been previously reported; Chen et al (15) revealed that SIRT1 downregulated EMT in metastasis of oral squamous cell carcinoma by suppressing the TGF-β signaling pathway. Shirakihara et al (19) reported differential regulation of epithelial and mesenchymal markers by δEF1 proteins in EMT induced by TGF-β.

The in vitro findings of the present study require verification in other OC cell lines and in vivo. Furthermore, the involvement of other signaling pathways is unclear; therefore, further studies are warranted.

Taken together, the data from the present study suggested that ABCA7 accelerates EMT in OC by activating the TGF-β signaling pathway. ABCA7 may be a promising therapeutic target for OC metastasis to reduce mortality.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XL, QL, JZ and SZ deigned the experiments. JZ and SZ performed the relevant experiments. XL and QL analyzed the data and wrote the manuscript.

Ethics approval and consent to participate

All procedures performed in studies involving human participants were in accordance with the ethical standards of the Research Ethics Committee of the Medical Ethics Committee of the Jining No. 1 People's Hospital. All subjects provided written informed consent.

Patient consent for publication

Informed consent was obtained for publication of patient data.

Competing interests

All the authors declare that they have no competing interests.

References

1 

Nezhat FR, Apostol R, Nezhat C and Pejovic T: New insights in the pathophysiology of ovarian cancer and implications for screening and prevention. Am J Obstet Gynecol. 213:262–267. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Yeung TL, Leung CS, Yip KP, Au Yeung CL, Wong ST and Mok SC: Cellular and molecular processes in ovarian cancer metastasis. A Review in the theme: Cell and molecular processes in cancer metastasis. Am J Physiol Cell Physiol. 309:C444–C456. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Tan TZ, Miow QH, Miki Y, Noda T, Mori S, Huang RY and Thiery JP: Epithelial-mesenchymal transition spectrum quantification and its efficacy in deciphering survival and drug responses of cancer patients. EMBO Mol Med. 6:1279–1293. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Elsnerova K, Mohelnikova-Duchonova B, Cerovska E, Ehrlichova M, Gut I, Rob L, Skapa P, Hruda M, Bartakova A, Bouda J, et al: Gene expression of membrane transporters: Importance for prognosis and progression of ovarian carcinoma. Oncol Rep. 35:2159–2170. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Elsnerova K, Bartakova A, Tihlarik J, Bouda J, Rob L, Skapa P, Hruda M, Gut I, Mohelnikova-Duchonova B, Soucek P and Vaclavikova R: Gene expression profiling reveals novel candidate markers of ovarian carcinoma intraperitoneal metastasis. J Cancer. 8:3598–3606. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Hedditch EL, Gao B, Russell AJ, Lu Y, Emmanuel C, Beesley J, Johnatty SE, Chen X, Harnett P, George J, et al: ABCA transporter gene expression and poor outcome in epithelial ovarian cancer. J Natl Cancer Inst. 106:dju1492014. View Article : Google Scholar : PubMed/NCBI

7 

Hlavata I, Mohelnikova-Duchonova B, Vaclavikova R, Liska V, Pitule P, Novak P, Bruha J, Vycital O, Holubec L, Treska V, et al: The role of ABC transporters in progression and clinical outcome of colorectal cancer. Mutagenesis. 27:187–196. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Li W, Zhang X, Wang J, Li M, Cao C, Tan J, Ma D and Gao Q: TGFβ1 in fibroblasts-derived exosomes promotes epithelial-mesenchymal transition of ovarian cancer cells. Oncotarget. 8:96035–96047. 2017.PubMed/NCBI

9 

Yeung TL, Leung CS, Wong KK, Samimi G, Thompson MS, Liu J, Zaid TM, Ghosh S, Birrer MJ and Mok SC: TGF-β modulates ovarian cancer invasion by upregulating CAF-derived versican in the tumor microenvironment. Cancer Res. 73:5016–5028. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Luo L, McGarvey P, Madhavan S, Kumar R, Gusev Y and Upadhyay G: Distinct lymphocyte antigens 6 (Ly6) family members Ly6D, Ly6E, Ly6K and Ly6H drive tumorigenesis and clinical outcome. Oncotarget. 7:11165–11193. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Goswami CP and Nakshatri H: PROGgeneV2: Enhancements on the existing database. BMC Cancer. 14:9702014. View Article : Google Scholar : PubMed/NCBI

12 

Dong P, Xiong Y, Watari H, Hanley Sharon JB, Konno Y, Ihira K, Yamada T, Kudo M, Yue J and Sakuragi N: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells. J Exp Clin Canc Res. 35:1322016. View Article : Google Scholar

13 

Yan F, Wang X, Shao L, Ge M and Hu X: Analysis of UHRF1 expression in human ovarian cancer tissues and its regulation in cancer cell growth. Tumour Biol. 36:8887–8893. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Tang X, Shi L, Xie N, Liu Z, Qian M, Meng F, Xu Q, Zhou M, Cao X, Zhu WG and Liu B: SIRT7 antagonizes TGF-β signaling and inhibits breast cancer metastasis. Nat Commun. 8:3182017. View Article : Google Scholar : PubMed/NCBI

15 

Chen IC, Chiang WF, Huang HH, Chen PF, Shen YY and Chiang HC: Role of SIRT1 in regulation of epithelial-to-mesenchymal transition in oral squamous cell carcinoma metastasis. Mol Cancer. 13:2542014. View Article : Google Scholar : PubMed/NCBI

16 

Sopik V, Rosen B, Giannakeas V and Narod SA: Why have ovarian cancer mortality rates declined? Part III. Prospects for the future. Gynecol Oncol. 138:757–761. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Savagner P: Epithelial-mesenchymal transitions: From cell plasticity to concept elasticity. Curr Top Dev Biol. 112:273–300. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Nakayama K, Nakayama N, Katagiri H and Miyazaki K: Mechanisms of ovarian cancer metastasis: Biochemical pathways. Int J Mol Sci. 13:11705–11717. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Shirakihara T, Saitoh M and Miyazono K: Differential regulation of epithelial and mesenchymal markers by δEF1 proteins in epithelial-mesenchymal transition induced by TGF-β. Mol Biol Cell. 18:3533–3544. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2018
Volume 16 Issue 5

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu X, Li Q, Zhou J and Zhang S: ATP‑binding cassette transporter A7 accelerates epithelial‑to‑mesenchymal transition in ovarian cancer cells by upregulating the transforming growth factor‑β signaling pathway Retraction in /10.3892/ol.2024.14483. Oncol Lett 16: 5868-5874, 2018
APA
Liu, X., Li, Q., Zhou, J., & Zhang, S. (2018). ATP‑binding cassette transporter A7 accelerates epithelial‑to‑mesenchymal transition in ovarian cancer cells by upregulating the transforming growth factor‑β signaling pathway Retraction in /10.3892/ol.2024.14483. Oncology Letters, 16, 5868-5874. https://doi.org/10.3892/ol.2018.9366
MLA
Liu, X., Li, Q., Zhou, J., Zhang, S."ATP‑binding cassette transporter A7 accelerates epithelial‑to‑mesenchymal transition in ovarian cancer cells by upregulating the transforming growth factor‑β signaling pathway Retraction in /10.3892/ol.2024.14483". Oncology Letters 16.5 (2018): 5868-5874.
Chicago
Liu, X., Li, Q., Zhou, J., Zhang, S."ATP‑binding cassette transporter A7 accelerates epithelial‑to‑mesenchymal transition in ovarian cancer cells by upregulating the transforming growth factor‑β signaling pathway Retraction in /10.3892/ol.2024.14483". Oncology Letters 16, no. 5 (2018): 5868-5874. https://doi.org/10.3892/ol.2018.9366