Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-2025 Volume 29 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2025 Volume 29 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma

  • Authors:
    • Jiapeng Shi
    • Xintong Wei
    • Fangmei Jiang
    • Jianjun Zhu
    • Jiandong Shen
    • Yanjun Sun
  • View Affiliations / Copyright

    Affiliations: Department of Interventional Medicine, Nantong Traditional Chinese Medicine Hospital, Nantong, Jiangsu 226001, P.R. China, Department of Medical Imaging, Nantong Traditional Chinese Medicine Hospital, Nantong, Jiangsu 226001, P.R. China, Department of Oncology, Yancheng Tinghu District People's Hospital, Yancheng, Jiangsu 224000, P.R. China, Department of Invasive Technology, Affiliated Nantong Hospital 3 of Nantong University, Nantong, Jiangsu 226001, P.R. China
    Copyright: © Shi et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 42
    |
    Published online on: November 5, 2024
       https://doi.org/10.3892/ol.2024.14788
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide. Despite continuous development of treatment methods, overall survival rate of liver cancer is low. Transcatheter arterial chemoembolization (TACE) is a first‑choice treatment for advanced liver cancer. Although it is generally effective, a number of patients do not benefit from it. Therefore, the present study was conducted to assess the response of patients following TACE. RNA‑sequencing data and corresponding clinical information were extracted from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus databases. Models were constructed using weighted gene co‑expression network analysis and least absolute shrinkage and selection operator‑Cox regression analysis based on TCGA‑LIHC and GSE104580 cohorts. The receiver operating characteristic curve was used for evaluation. Immunoassay, half‑maximal inhibitory concentration analysis of risk groups, genomic enrichment analysis and nomogram construction were also performed. The predictive models were validated at the single‑cell level using single‑cell databases. Finally, the present study examined the expression of TACE refractoriness‑related TFs (TRTs) in TACE‑resistant and non‑resistant cell lines in vitro. A risk categorization approach was created based on screening of four TRTs. The patients were split into high‑ and low‑risk groups. There were significant variations in immune cell infiltration, medication sensitivity and overall survival (OS) between patients in the high‑risk and low‑risk groups. Multivariate Cox regression analysis showed that the risk score was an independent prognostic factor for OS. In the single‑cell gene set, risk score was a good indicator of tumor microenvironment (TME). Reverse transcription‑quantitative PCR revealed that three high‑risk TRTs were upregulated in TACE‑resistant cells. Prognosis and TME status of liver cancer patients following TACE could be assessed using a predictive model based on transcription factor correlation. This predictive model provided a reliable and simplified method to guide the clinical treatment of HCC.

Introduction

Hepatocellular carcinoma (HCC) ranks sixth and third in terms of global cancer morbidity and mortality, respectively (1). Liver cancer has become a major public health problem. Hepatitis B is one of the most important causes of liver cancer (2). The main pathological types of liver cancer include HCC and cholangiocarcinoma and HCC accounts for nearly 80% of cases. Early symptoms of liver cancer are not obvious; therefore, most patients are diagnosed at a middle or advanced stage. At present, surgical resection is the main treatment method for liver cancer worldwide and other methods such as transcatheter arterial chemoembolization (TACE), radiotherapy and immunotherapy are auxiliary (3). However, the benefits of various treatments are limited and overall survival (OS) remains low. Therefore, it is necessary to explore the causes of liver cancer recurrence after treatment and intervene to improve treatment efficacy.

TACE is a first-line treatment for unresectable HCC. The principle of TACE involves selectively or superselectively inserting a catheter into the tumor-feeding artery, followed by administration of embolic and chemotherapeutic agents. This induces ischemic necrosis of the tumor, thereby inhibiting its progression and improving quality of life.

Depending on the operation time and method, TACE can be divided into assistant, conventional and drug-eluting TACE (4). However, there remains some controversy surrounding TACE. Due to the use of chemotherapeutic drugs, some patients experience a transient decrease in liver function following surgery (5). Furthermore, the abundant blood supply of liver cancer, production of new blood vessels following TACE, establishment of collateral circulation and other factors have made it difficult to achieve ideal therapeutic effects with simple TACE (6). There are also significant differences in the efficacy of TACE for different patients. To address this, the Japan Society of Hepatology introduced and subsequently revised the concept of TACE failure/refractoriness to improve evaluation of patient responses (7).

Investigation of the molecular mechanisms underlying TACE resistance is crucial for improving its therapeutic efficacy (8). In recent years, the combination of TACE with systemic therapies, particularly targeted therapies and immune checkpoint inhibitors (ICIs), has shown potential in prolonging progression-free survival and enhancing OS (9). For example, the combination of TACE with targeted drugs such as sorafenib and lenvatinib, as well as immunotherapies such as pembrolizumab, has demonstrated synergistic effects in several studies (10–12). However, despite the promising outcomes in some patients, the overall prognosis for HCC remains suboptimal, partly due to the development of resistance and recurrence following TACE (13). Consequently, further research into the mechanisms of TACE resistance and their interaction with combination therapy is essential for optimizing treatment protocols and improving patient outcomes.

Transcription factors (TFs) are proteins that regulate the transcription of genetic information from DNA to mRNA by binding to specific DNA sequences (14). TFs ensure that various genes are expressed inside the cell at the right time and in the right amount. There are >1,600 TFs in humans and most of them are involved in regulating a variety of important cellular functions, including division and death, as well as embryonic development (15). TFs are closely related to the occurrence and development of tumors. E-box binding zinc finger protein 2 can bind to the hepatitis B virus (HBV) core promoter, thereby inhibiting its activity and reducing the occurrence of HBV-induced liver cancer (16). Transcription termination factor (TTF)1 can affect proliferation of hepatoma cells by regulating the activity of ribosomes (17). Metastasis of liver cancer is also regulated by TFs, such as the transcription factor forkhead box P4, which can enhance its expression by directly binding to the promoter region of the SLUG gene and then transcribe a series of proteins downstream of EMT to promote liver cancer metastasis (18). TFs can regulate genes related to drug resistance, such as MDR1 and TWIST. At present, research on the role of TFs in TACE resistance remains limited and further exploration is needed.

The present study combined TFs with TACE resistance and used weighted gene co-expression network analysis (WGCNA) to screen out HUB genes related to TACE nonresponse. Least absolute shrinkage and selection operator (LASSO)-Cox regression was used to build a prognosis-related predictive model and possible roles of TFs in the model of TACE resistance were analyzed in relation to immune microenvironment, drug sensitivity, single cells and cell experiments. It is expected that the present study will serve as a new resource for determining TACE effectiveness and the best course of treatment for liver cancer.

Materials and methods

Datasets and preprocessing

The present study included sequencing data (TPM format) from TCGA-LIHC (portal.gdc.cancer.gov/). Patients with incomplete follow-up information, 0 days of survival and repeated sequencing samples from the same patient were excluded. A total of 365 tumor samples were included for bioinformatics analysis and model construction. With same inclusion criteria, 231 HCC patients in the ICGC-LIHC (https://dcc.icgc.org/projects/LIRI-JP) cohort and 221 in the GSE14520 dataset were included for external validation. To identify genes associated with TACE resistance, the GSE104580 cohort (100 TACE responders and 100 non-responders) in the GEO database (https://www.ncbi.nlm.nih.gov/geo/) was obtained and further analysis was performed. When performing internal and external validation, the sva R package (v3.46.0) (19) was used for background correction and normalization to ensure comparability of validation (Fig. S1). A total of 1,639 TFs were extracted based on previous studies (20–22). GSE125449 is a single-cell sequencing set for LIHC and its processing pipeline is from the TISCH database. R software (version 4.0.5) (23) was used to conduct all of the analyses.

Differentially expressed TF identification and enrichment analysis

In GSE104580, differentially expressed genes (DEGs) between different response states were identified using the limma R package (version 3.52.0) (24) with P<0.05 and |log2FC|>0.5 as thresholds; adjusted P<0.05. The top 20 up-/downregulated differentially expressed TFs (DETFs) were plotted using the pheatmap R package (version 1.0.12) (25) after intersection with 1,639 TFs.

Gene Ontology (GO) was used to annotate the biological process, molecular function and cellular component of genes. Gene pathways were annotated using the Kyoto Encyclopedia of Genes and Genomes (KEGG). Significantly enriched pathways were indicated by P-values and q-values <0.05. The clusterprofiler R package (v4.4.0) (26) was used for enrichment analysis of DETF-related functions and pathways (GO and KEGG), with P<0.05 as the threshold.

TACE refractoriness-related TFs identification and enrichment analysis

The present study took as input the ensemble of TFs in GSE10458 and removed genes with a standard deviation of 0 in each sample. To eliminate outlier genes and samples, R software package WGCNA goodSamplesGenes technique (version 1.68) (27) was used. WGCNA was then used to create a scale-free co-expression network. A soft threshold of 1–25 was used for topological calculations and the relation matrix was converted into an adjacency matrix using the best soft threshold. A topological overlap matrix (TOM) was created from the results and average link hierarchical clustering was performed. TOM classification of the associated modules was used and each module had ≥50 genes. The modules with a distance of <0.8 were combined and the correlation between the combined modules and TACE response was calculated. Finally, the DETFs and TFs in the co-expressed core module were overlapped and the identified TFs were used as TACE refractoriness-related TFs (TRTs). Enrichment analysis further explored the potential functions of DETFs and enriched pathways (GO and KEGG) using the clusterprofiler package, with P<0.05 as the threshold.

Construction of a nomogram and prognostic model

TCGA-LIHC cohort was used for modeling and the GSE14520 and ICGC-LIHC cohorts for external validation. In TCGA-LIHC, univariate Cox regression analysis was first used to filter out TFs with no prognostic significance in TRTs (P<0.05). To prevent overfitting effects, using LASSO regression, 10-fold cross-validation and 1,000 cycles with 1,000 random stimulations, a risk model was developed. The risk score formula was established by multivariate Cox regression analysis (stepwise) with integration coefficients and gene expression values. The patients were divided into high-risk and low-risk groups based on the median value of the risk score formula. Univariate and multivariate Cox regression analyses were used to assess the prognostic value of risk scores across the entire dataset and an external validation dataset. Time-dependent receiver operating characteristic (ROC) curves were used to compare the predictive accuracy of risk scores with traditional clinicopathological parameters. Prognostic nomograms were constructed using the replot R package (version 1.0.0) (28) and validated using calibration curves.

Immune landscape analysis

To assess the quantity of immune cells in various samples, several methods were used simultaneously, including TIMER (version 2.0) (29), CIBERSORT (version 1.06) (30), QUANTISEQ (version 1.0) (31), MCP-counter (version 1.2.0) (32), XCELL (version 1.1.0) (33) and EPIC (version 1.1) (34). In addition, the ESTIMATE algorithm (v1.0.13) (35) was used to calculate the immune score; the interstitial score to reflect the microenvironmental status (36). The tumor microenvironment (TME) is constructed by a variety of cell types. Thorsson et al (37) defined six immunoexpression signature subtypes based on the gene expression profile of all solid tumors in TCGA, including: Wound Healing (Immune C1), IFN-γ Dominant (Immune C2), Inflammatory (Immune C3), Lymphocyte Depleted (Immune C4), Immunologically Quiet (Immune C5) and TGF-bβ Dominant (Immune C6). The present study classified patients based on immune expression signatures.

Drug sensitivity analysis

The present study obtained (38) half-maximal inhibitory concentration (IC50) values of commonly used chemotherapeutic drugs for liver cancer from the Genomics of Cancer Drug Sensitivity (GDSC) database (https://www.cancerrxgene.org/) and used R software. The PRrophytic R package (v1.0.2) (39) was used for calculation. By using the Wilcoxon signed rank test, the differences in IC50 between various risk categories were examined. Boxplots were used to depict the results.

Cell lines and culture conditions

Every cell line was bought from the National Certified Cell Center for Cultural Collections (Shanghai, China). Huh7 cells were cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum. SNU-387 cells were cultured in RPMI medium (HyClone; Cytiva) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. A cell incubator was used for cell culture, which was performed at 37°C with 5% CO2 and 10% humidity. The cell lines used in the presence of mycoplasma were investigated in the present study.

Protein staining

Tumor tissue samples were fixed with 10% formalin at room temperature for 24 h. Subsequently, the samples were embedded in paraffin and sectioned at a thickness of 4 microns to allow for optimal staining and microscopic observation. Antigen retrieval was conducted at 95°C using citrate buffer (pH 6.0) to expose antigenic sites, followed by washing with phosphate-buffered saline (PBS) three times for 5 min each. Endogenous peroxidase activity was blocked using 3% hydrogen peroxide at room temperature for 10 min to prevent non-specific background staining. The sections were incubated with rabbit anti-XYZ antibody (cat. number: ab11174; Abcam), at a dilution of 1:200 at 4°C overnight, and detection was performed using DAB substrate and sections were counterstained with 0.1% hematoxylin solution at room temperature for 5 min. Images were captured using a light microscope at 40× magnification to document the staining results and assess the presence and localization of the target protein within the tissue samples.

Cell viability and drug sensitivity

Cells were seeded in 96-well plates at 5,000 cells/well and placed in a 37°C, 5% CO2 incubator for 48 h. To simulate the TACE environment, another set of cells was placed in a 37°C, 5% CO2, 1% O2 incubator for 48 h. According to the concentration gradient, the experimental group was treated with lobaplatin (cat. no. H20050309; Hainan Changan International Pharmaceutical Co. Ltd.). The plates were taken out of the incubator after 48 h and put in a dark place so that 10 µl of CCK8 reagent (cat. no. A311-02; Vazyme Biotech Co., Ltd.) could be added to each well. The plates were returned to the incubator for 1–2 h. Optical density was determined using a microplate reader, (Multiskan FC; Thermo Fisher Scientific, Inc.).

Reverse transcription-quantitative (RT-q) PCR

For RNA extraction, ~5,000 cells per well were seeded in a 96-well plate. RNA isolation kit (cat. no. RC112-01; Vazyme Biotech Co., Ltd.) was used to extract total RNA and a cDNA synthesis kit (cat. no. R233-01; Vazyme Biotech Co., Ltd.) was used to create cDNA. All steps were performed according to the manufacturer's protocols. Using SteponePlus (Applied Biosystems; Thermo Fisher Scientific, Inc.), RT-qPCR was performed using 10 µM primers and SYBR qPCR Master Mix (cat. no. Q511-02; Vazyme Biotech Co., Ltd.). PCR cycling conditions were as follows: Initial denaturation at 95°C for 2 min, followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 1 min. The relative expression levels were determined using the ΔΔCq method (40). Relative expression values were normalized to the control gene (GADPH). The primer pairs used in the present study are shown in Table I.

Table I.

PCR primer sequences.

Table I.

PCR primer sequences.

GenePrimer
CENPAForward: AAGAGCACACACCTCTTGATAA
Reverse: CATGTAAGGTGAGGAGATAGGC
KLF2Forward: CTTCGGTCTCTTCGACGAC
Reverse: GTAGCTGCAGGTGTGAGTG
CBX2Forward: GACTTAGATGCTAAGAGGGGTC
Reverse: CTTCTTCCGGATGGGATCCTTC
KCMF1Forward: GTGGATCACGAGGTTAGTTCAGGAC
Reverse: CCGAGTAGCAGGAATTACAGGCATC
Statistical analysis

For the IC50 results, statistical analysis of optical density values was performed using GraphPad Prism version 8.0 (Dotmatics). Data are presented as mean ± standard deviation derived from three independent experiments conducted in triplicate (n=3). For the RT-qPCR, the data were represented as mean ± SD from three independent experiments (n=3). The statistical significance of differences in gene expression levels between the two cell lines was evaluated using an unpaired Student's t-test. The statistical analyses were performed using GraphPad Prism version 8.0 (Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of specific TRTs

To explore potential TRTs in HCC, a differential gene expression study was conducted in the GSE104580 dataset on patients who had TACE responses and those who had none. Among 1,639 TFs, 158 DETFs were identified using the limma package, including 78 up- and 80 downregulated (P<0.05; |log2FC|>0.5). The heat map showed the top 20 upregulated (Fig. 1A) and downregulated (Fig. 1B) DEGs and DETFs. The clusterProfiler package was used to analyze the DETFs. Fig. 1C shows the top 20 KEGG signaling pathways that may be related to TACE responses, including ‘transcriptional misregulation in cancer’, ‘circadian rhythm’, ‘herpes simplex virus 1 infection’, ‘hepatitis B’, ‘human T-cell leukemia virus 1 infection’ and ‘amphetamine addiction’. Fig. 1D-F shows GO terms that may be related to the TACE response. The cellular component part mainly included ‘transcription factor complex’, ‘nuclear’, ‘transcription factor complex’, ‘RNA polymerase II transcription factor complex’, ‘protein-DNA complex’ and ‘nuclear chromatin’; the biological process part mainly included ‘primary miRNA transcription by RNA polymerase II’, ‘tissue development’, ‘cell fate commitment’, ‘endocrine system development’, ‘DNA-templated transcription’ and ‘initiation’; and the molecular function part mainly included ‘enhancer-sequence-specific DNA binding’, ‘enhancer binding’ and ‘RNA polymerase II distal enhancer sequence-specific DNA binding’.

Figure 1.

Landscape of TRTs in TCGA cohort and functional analysis. Heat map of the (A) upregulated and (B) downregulated TRTs between nonresponse and response patients. (C) KEGG and (D-F) GO analysis of TRTs. TRTs, TACE refractoriness-related transcription factors; TCGA, The Cancer Genome Atlas; KEGG, Kyoto Encyclopedia of Genes and Genomes; GO, Gene Ontology; CC, cellular component; BP, biological process; MF, molecular function.

With a good association with TACE response, WGCNA was used to build co-expression networks and modules containing the DETFs. All TFs in GSE10458 were used as input genes for WGCNA. After determining the optimal soft threshold of 5 (Fig. 2A), according to the dynamic tree-cutting technique, all of the TFs were clustered using a TOM-based dissimilarity metric, partitioning the tree into eight modules (Fig. 2B). The correlation of each module with TACE response was calculated (Fig. 2C). The blue module showed a strong positive correlation with TACE response (Fig. 2D). The GO and KEGG pathway enrichment results of the 212 TFs in the co-expressed blue module were similar to the previous enrichment results for DETFs. The KEGG pathways mainly included ‘transcriptional misregulation in cancer’, ‘inflammatory bowel disease’, ‘Th1 and Th2 cell differentiation’, ‘Th17 cell differentiation’ and ‘hepatitis B’ (Fig. 2E). The GO terms mainly included ‘transcription initiation from RNA polymerase II promoter’, ‘cell fate commitment’, ‘intracellular receptor signaling pathway’ and ‘embryonic organ development’ (Fig. 2F). The 158 DETFs in the aforementioned TACE response and nonresponse and the 212 TFs in the co-expressed blue module were overlapped and 65 TFs as TRTs were identified for subsequent analysis.

Figure 2.

WGCNA was used to construct coexpression networks and modules of DETFs with strong correlation with TACE response. (A) Determining the optimal soft threshold for WGCNA. (B) Clustering all TFs using TOM-based dissimilarity measure. (C) Correlation of each module with TACE response. (D) Blue modules show a strong positive correlation with TACE response. (E) GO and (F) KEGG analysis of blue module genes. WGCNA, weighted gene co-expression network analysis; DETFs, differentially expressed transcription factors; TACE, transcatheter arterial chemoembolization; TFs, transcription factors; TOM, topological overlap matrix; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Construction of a prognostic TRT signature

To identify key TRTs associated with TACE response, univariate Cox regression analysis was used to identify TRTs significantly associated with prognosis in TCGA-LIHC cohort (Fig. 3A). The present study obtained 28 TRTs associated with prognosis (all P<0.05). Based on univariate Cox regression analysis, redundant TRTs were removed using LASSO regression analysis (enter method) for further screening (Fig. 3B). The best eigenvalue was 8. Multivariate Cox regression analysis (stepwise method) was performed on the eight TRTs following LASSO regression and four TRTs involved in modeling were identified, namely CENPA, KLF2, KCMF1 and CBX2 (Fig. 3C). A risk score was calculated for each patient based on the coefficients and expression levels of each TRT (Fig. 3C to assess prognosis. The heat map showed the expression of the four TRTs in the high- and low-risk groups, as well as the relationship between the high- and low-risk groups and the associated traits (Fig. 3D). ROC curves for 1-, 3- and 5-year survival prediction of patients showed that an area under the curve >0.7 indicating the ability to strongly predict prognosis (Fig. 3E). Kaplan-Meier analysis showed that patients with low risk scores had significantly longer survival times than patients with high risk scores (Fig. 3F). The risk distribution map also showed that survival time decreased significantly with increasing risk score (Fig. 3G and H). The prognostic value of the risk signatures were assessed according to risk score, age, sex, tumor stage and tumor grade. According to univariate Cox regression analysis, the risk score was significantly associated with OS [hazard ratio (HR)=1.544, 95% confidence interval (CI)=1.369–1.742] (Fig. 4A). Multivariate Cox regression analysis showed that risk score was an independent prognostic factor (HR=1.426, 95% CI=1.247–1.631) (Fig. 4B). Nomograms and calibration plots were used to quantify the contribution of individual factors to clinical prognosis and validate the model (Fig. 4C and D). The prognostic model had good predictive ability in the three cohorts (TCGA, ICGC and GSE14520). The predicted line segments in the calibration curves in the different datasets were all close to the actual line segments.

Figure 3.

Construction of prognostic TRTs signature. (A) Univariate Cox regression analysis was used to identify TRTs significantly associated with prognosis. (B) LASSO regression analysis (ENTER method) to remove redundant TRTs for further screening. (C) The four TRTs involved in modeling and their coefficient. (D) Heat map of expression of four TRTs and their relationship between clinical features. (E) ROC curves for predicting patient survival at 1, 3 and 5 years. (F) Kaplan-Meier analysis of differences in survival among patients with different risk groups. (G) Scatter plot and (H) curve plot of different risk scores. TRTs, TACE refractoriness-related transcription factors; LASSO, least absolute shrinkage and selection operator; ROC, receiver operating characteristic; AUC, area under curve.

Figure 4.

Assessment of the prognostic signature. (A) Univariate analysis and (B) multivariate analysis of risk score and clinical characters in TCGA cohort. (C) Nomograms and (D) calibration plots were used to quantify the contribution of individual factors to clinical outcomes and to verify the validity of the model. TCGA, The Cancer Genome Atlas. ***P<0.001.

Validation of prognostic TRT signature in the external datasets

The present study risk-scored patients in the external validation cohort ICGC-LIHC and the GSE14520 dataset using the same formula and cutoff as for TCGA-LIHC, with high- and low-risk groups, to confirm the external validity of the prognostic model. A total of 108 low-risk and 123 high-risk patients from the ICGC-LIHC group were found. In the GSE14520 cohort, 107 high-risk and 114 low-risk patients were identified. In the ICGC-LIHC cohort, the risk score was an independent prognostic indicator (Fig. 5A and B) and survival time decreased significantly with increasing risk score (Fig. 5C-E). ROC curve analysis also showed the excellent predictive power of the risk score (1-year AUC, 0.755; 3-year AUC, 0.799; 5-year AUC, 0.730; Fig. 5F). In the GSE14520 cohort, the risk score was also an independent prognostic factor and a good predictor of survival risk (Fig. 5G-L).

Figure 5.

Validation of prognostic TRT signature in external datasets. (A) Univariate and (B) multivariate regression were used for validation of risk score in ICGC-LIHC cohort. (C) Curve plot and (D) scatter plot between different risk groups in the ICGC-LIHC cohort. (E) Kaplan-Meier survival curves of OS and (F) ROC curves of the TRT signature in the ICGC-LIHC cohort. (G) Univariate and (H) multivariate regression were used for validation of risk score in GSE14520 cohort. (I) Curve plot and (J) scatter plot between different risk groups in the GSE14520 cohort. (K) Kaplan-Meier survival curves of OS and (L) ROC curves of the TRT signature in the GSE14520 cohort. TRTs, TACE refractoriness-related transcription factors; OS, overall survival; ROC, receiver operating characteristic; AUC, area under curve.

Analysis of immune infiltration

In addition to TACE therapy, patients with liver cancer can also receive immunotherapy to improve the therapeutic effect. Immune infiltrating cells are a key part of the TME, which is vital for tumor development, therapy response and patient prognosis. The present study assessed TME as a whole in TCGA-LIHC cohort using the ESTIMATE algorithm and found that tumor purity scores increased and immune scores decreased as the risk scores increased (Fig. 6A and B). Increasing evidence suggests that there is a strong correlation between enhanced stem-cell-related biomarker expression in tumor cells and drug resistance, cancer recurrence and tumor growth (41). Thus, the relationship between the risk scores and DNA stem cell score (DNAss) and RNA stem cell score (RNAss) were evaluated. The present study revealed a substantial positive correlation between the risk score and DNA and RNA concentrations. The gene mutation status of the groups with high and low risk scores was also compared. Considering the important effect of stemness index on immunotherapy, correlation analysis showed that DNAss and RNAss increased with risk score (Fig. 6C and D). The identified immune subtypes were analyzed. Thorsson et al (19) defined six immunoexpression signature subtypes based on the gene expression profile of all solid tumors in TCGA, including Wound Healing (Immune C1), IFN-γ Dominant (Immune C2), Inflammatory (Immune C3), Lymphocyte Depleted (Immune C4), Immunologically Quiet (Immune C5) and TGF-β Dominant (Immune C6). The present study found a higher proportion of the lymphocyte depleted subtype in high-risk patients and the highest expression of the risk scores in the Wound Healing subtype (Fig. 6E and F). To determine the number of immune cells present in various samples, a variety of algorithms were used, including TIMER, CIBERSORT, QUANTISEQ, MCP-counter, XCELL and EPIC. The abundance of killer immune cells, such as CD4+ and CD8+ T cells, increased as the risk score increased (Fig. 6G). At the same time, there were also differences in the distribution of immune cells among the different risk subtypes (Fig. 6H). To verify the survival prediction and treatment reflection predictive value of the risk score in the immunotherapy cohort, it was tested in different Imvigor-210 immunotherapy cohorts. The results showed that the risk score also had a prognostic value in different immunotherapy cohorts (Fig. 6I). In low-risk patients, there was an improved response to immunotherapy, with complete response/partial response accounting for 29% compared with 17% in high-risk patients (Fig. 6J).

Figure 6.

Analysis of immune infiltration. ESTIMATE algorithm was used to evaluate TME. (A) Tumor purity, (B) immune score, (C) correlation of DNAss and (D) RNAss with different risk score. (E and F) Percentage of identified immune subtypes in patients at different risk. (G) Different algorithms such as TIMER, CIBERSORT, QUANTISEQ, MCP-counter, XCELL and EPIC were used to estimate immune cell abundance in different samples. (H) Differences in the distribution of immune cells in different risk subtypes. (I) Imvigor-210 immunotherapy cohort was used to validate the prognostic value of risk scores. (J) Proportion of complete/PR and SD/PD in different risk groups. DNAss, DNA stem cell score; RNAss, RNA stem cell score; PR, Partial Response; SD, Stable Disease; PD, Progressive Disease

Expression and prognostic profile of four TRTs

The present study compared the expression profiles of four TRTs in normal and tumor tissues obtained from TCGA and Genotype-Tissue Expression databases, including paired and unpaired samples. Expression of CENPA, KCMF1 and CBX2 in tumor tissues was significantly higher than in normal tissues, while expression of KLF2 was not significantly different (Fig. 7A and B). Expression of the aforementioned four TRTs in different groups in the Human Protein Atlas (HPA) database were detected. Protein expression was more consistent with mRNA expression. Compared with normal tissue, protein staining in tumor tissue was stronger (Fig. 7C). Cox regression analysis was performed on expression of CENPA, KCMF1, CBX2, KLF2 and various prognostic outcomes in multiple HCC cohorts. KCMF1 was a risk factor in four cohorts (Fig. 7D); CBX2 was a risk factor in cohorts (Fig. 7E); CENPA was a risk factor in eight cohorts (Fig. 8A); and KLF2 was a protective factor in six cohorts (Fig. 8B). These results demonstrated that the prognostic indicators of different TRTs were consistent.

Figure 7.

Expression and prognostic profile of four TRTs. (A and B) Expression of four signatures in normal and HCC tissues were compared by combining TCGA and GTEx databases. (C) Comparison of expression of four TRTs in different tissues using HPA database. Multiple HCC cohorts were used to validate (D) KCMF1 and (E) CBX2 expression and prognostic prediction. TRTs, TACE refractoriness-related transcription factors; HCC, hepatocellular carcinoma; TCGA, The Cancer Genome Atlas; GTEx, Genotype-Tissue Expression. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001.

Figure 8.

Different cohort validation and drug sensitivity analysis. Multiple HCC cohorts were used to validate (A) CENPA and (B) KLF2 expression and prognostic prediction. GDSC database was used to detect the IC50 values of patients with different risk groups for commonly used clinical TACE drugs such as (C) vinblastine, (D) sorafenib, (E) mitomycin, (F) etoposide, (G) doxorubicin and (H) cisplatin. HCC, hepatocellular carcinoma; GDSC, Genomics of Cancer Drug Sensitivity; IC50, half-maximal inhibitory concentration; TACE refractoriness-related transcription factors. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001.

Drug sensitivity analysis

Due to the limitations of systemic chemotherapy, most patients with advanced HCC have the option of local therapy based on TACE, which delivers chemotherapeutic drugs to the region surrounding the tumor (42). According to the enrichment analysis discussed aforementioned, patients in the various risk groups may have variable medication sensitivity and metabolism. The present study measured IC50 values of the drugs frequently used in the treatment of HCC, such as vincristine, sorafenib, mitomycin, etoposide, doxorubicin and cisplatin. The IC50 value of platinum was significantly lower in the high-risk group than in the low-risk group (both P<0.05) (Fig. 8C-H). These results suggested that high-risk patients were more sensitive to commonly used chemotherapy and targeted drug therapy for HCC.

Risk score at a single-cell level treated with ICIs

Considering bulk-RNA-sequencing data, risk scores based on CENPA, KLF2, KCMF1 and CBX2 are good indicators of TME. Therefore, analyses were performed in the GSE125449 single-cell sequencing dataset, to assess changes in risk scores in various types of cell before and after ICI treatment. The GSE125449 single-cell sequencing dataset was annotated based on the TISCH database (Fig. 9A) and the risk scores in different cells were calculated. Expression of risk scores was higher in interstitial cells (Fig. 9B). After treatment with ICIs, the risk score increased in tumor cells but decreased in stromal cells (Fig. 9C). Cell-type-specific analyses was performed and showed that the risk scores in liver progenitors changed significantly after ICI treatment (Fig. 9D).

Figure 9.

Risk score in single cells treated with ICIs. (A) Annotation of the GSE125449 single-cell sequencing dataset based on the TISCH database. (B) Correlation between risk score and TME status. (C) Correlation between risk score and TME status following ICI treatment. (D) Correlation between different types of cells and risk score following ICI treatment. ICIs, immune checkpoint inhibitors; TME, tumor microenvironment. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001.

Validation of TRTs in HCC cell lines

SNU-387 and Huh7 cells were simultaneously cultured under hypoxia (1% O2) and normoxia for 48 h to mimic TACE. The present study detected the IC50 of lobaplatin, the first-line drug for TACE treatment, in these cell types. Compared with normal oxygen concentration, the IC50 of SNU-387 lobaplatin cultured under hypoxia was significantly higher, while that of Huh7 was significantly lower (Fig. 10A). This indicates that SNU-387 is a TACE-resistant cell line and Huh7 is a TACE nonresistant cell line. We detected expression of the four TRTs in these two cell lines. CENPA, KCMF1 and CBX2, which are high-risk factors, were higher in the resistant cell line SNU-387 than in Huh7 cells. However, KLF2, the protective factor, showed no difference in expression between the two cell lines (Fig. 10B).

Figure 10.

Validation of the TRTs in HCC cell lines. (A) IC50 of SNU-387 and Huh7 for lobaplatin under normoxia and hypoxia (1% O2). (B) Relative expression of four TRTs in Huh7 and SNU-387 cells. TRTs, TACE refractoriness-related transcription factors; HCC, hepatocellular carcinoma; IC50, half-maximal inhibitory concentration. *P<0.05; ***P<0.001.

Discussion

Primary liver cancer, characterized by high incidence and mortality rates, is a malignant tumor that poses a serious threat to the lives and health of patients (43). Despite continuous advances in treatment methods in recent years, the overall efficacy of liver cancer therapy remains suboptimal. The present study explored the mechanisms by which TFs influence liver cancer, thereby providing new insights for improving therapeutic strategies.

The limited effectiveness of current treatments prompts a critical re-evaluation of existing therapeutic approaches and highlights gaps in our understanding. While the pivotal role of TFs in tumor progression is well recognized, their specific mechanisms in TACE remain inadequately elucidated. This knowledge gap presents a crucial research opportunity to delve into the function of TFs and to investigate their role in TACE resistance, ultimately aiming to optimize treatment regimens.

TFs play a crucial role in tumor progression by sustaining tumor stemness and regulating the TME, thereby driving cancer development (44). As our understanding of the functions of TFs deepens, it is expected that in the next 5 years, there will be more research focused on their application in TACE. Specifically, studies on how targeting TFs can overcome TACE resistance could lead to significant breakthroughs in liver cancer treatment (45).

Given the critical role of TFs and poor prognosis of patients following TACE, the present study developed a prognostic model based on TFs to more accurately assess patient risk and guide personalized treatment. The model demonstrated potential value in evaluating the efficacy of TACE, particularly in predicting the prognosis of high-risk patients. However, the limitations of the model cannot be overlooked, primarily concerning the sources and quality of the data. Future research should focus on validating the model and exploring its applicability across different populations.

The present study systematically analyzed the role of transcription-related genes in TACE of HCC patients. It screened and constructed the predictive model including CENPA, KLF2, KCMF1 and CBX2 for risk assessment of liver cancer patients to determine the degree of benefit from TACE. Among these genes, CENPA, which encodes a protein that epigenetically determines the location of the centromere on each chromosome (46), was significantly upregulated in liver cancer tissues. It is considered important for metastatic ability and advanced disease status and may be a biomarker of poor prognosis and a high likelihood of recurrence (47). As a protective factor in this model, KLF2 (a host TF that regulates C-C chemokine receptor 5 expression in CD4+ T cells) is involved in a variety of biochemical processes in humans, including lung development, embryonic erythropoiesis, epithelial integrity, T cell viability and adipogenesis (48). Although KLF2 has been shown to play a role in promoting tumor progression in a variety of tumors, there may be changes in a number of pathways due to the unique hypoxia and chemotherapeutic drug microenvironment of TACE (49), which needs to be further explored. There are few reports on the relationship between KCMF1 and tumors. As an evolutionarily highly conserved protein, increased expression of KCMF1 in the nucleus may be closely related to pancreatic cancer in mice and humans (50). CBX2 is associated with prognosis of liver cancer (51).

The present study intersected the genes in the TF module most associated with TACE response in GSE104580 with the differential genes in this dataset. As the GSE104580 dataset lacks survival data, the intersected gene set was placed in TCGA-LIHC cohort for LASSO-Cox analysis and four TRTs were identified to build a predictive model. Based on the predictive model, the patients were divided into high- and low-risk groups and the stability of the model verified. Immunotherapy provides a new option for liver cancer. The combination of TACE and immunotherapy has become a new strategy for advanced liver cancer. It has been shown that immunotherapy after TACE can prolong and maximize the immune response to liver cancer by preventing T-cell exhaustion (12). The combination of TACE and programmed death protein-1 in the treatment of advanced HCC can significantly prolong OS (11). Immune scores were significantly lower in high-risk patients. Comparing the identified immune subtypes, a higher proportion of the Lymphocyte Depleted subtype was found in high-risk patients. After analysis using various immune infiltration algorithms, it was found that the abundance of killer immune cells, such as CD4+ and CD8+ T cells, was increased in high-risk patients. KLF2 in the model negatively controlled the responsiveness of CD8+ T cells to the C-X-C chemokine receptor 3 ligand CXCL10, which is consistent with the results of the present study (52). Sorafenib, doxorubicin and cisplatin are the first-line drugs for TACE and the IC50 in the high-risk group was significantly lower than that in the low-risk group. This suggested that high-risk patients may be superior candidates for TACE and targeted drug therapy. Single-cell analysis can provide guidance for precise immunotherapy of tumors. Mesenchymal stem/stromal cells have high immunomodulatory activity, are easy to obtain and isolate and have a strong tropism for inflamed and damaged tissues (53). RNA was extracted from common liver cancer cell lines. RT-qPCR of genes in the four models revealed the highest expression of CENPA, CBX2 and CENPA in resistant cells, which was consistent with the hypothesis.

The present study focused on TFs closely related to TACE. The predictive model based on TFs was constructed to predict the prognosis of TACE patients. It was hypothesized that this model can provide new options for combined immunization and targeted therapy for TACE patients. However, the present study still had some limitations. First, the data were from public databases and lacked more data for verification. Second, the specific regulatory mechanism between TFs and TACE resistance remain to be elucidated, which requires further research.

The prognosis and TME status of liver cancer patients following TACE can be assessed using the predictive model based on the TF correlation created in the present study. This predictive model provides a reliable and simplified method to guide the clinical treatment of HCC patients.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was supported by Scientific research project of Jiangsu Provincial Health Commission (project no. Z2022054).

Availability of data and materials

The data generated in the present study are included in the figures and/or tables of this article.

Authors' contributions

YS and JShi contributed to the conceptualization. XW and FJ performed the data analyses. JShen participated in data analysis and study design. JShi wrote the manuscript. JShen reviewed and edited the manuscript. YS and JShen confirm the authenticity of all the raw data. JZ interpreted data. All authors read and approved the final manuscript.

Ethics approval and informed consent

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

TACE

transcatheter arterial chemoembolization

HCC

hepatocellular carcinoma

TFs

transcription factors

OS

overall survival

TRTs

TACE refractoriness-related transcription factors

TCGA

The Cancer Genome Atlas

GEO

Gene Expression Omnibus

WGCNA

weighted gene co-expression network analysis

LASSO

least absolute shrinkage and selection operator

ROC

receiver operating characteristic

IC50

half-maximal inhibitory concentration

TME

tumor microenvironment

RT-qPCR

reverse transcription-quantitative PCR

DEGs

differentially expressed genes

DETFs

differentially expressed transcription factors

GO

Gene Ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

TOM

topological overlap matrix

ICIs

immune checkpoint inhibitors

HBV

Hepatitis B virus

HPA

Human Protein Atlas

MSCs

mesenchymal stem/stromal cells

GDSC

Genomics of Cancer Drug Sensitivity

References

1 

Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I and Jemal A: Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 74:229–263. 2024. View Article : Google Scholar : PubMed/NCBI

2 

Di Bisceglie AM: Hepatitis B and hepatocellular carcinoma. Hepatology. 49 (5 Suppl):S56–S60. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Deng ZJ, Li L, Teng YX, Zhang YQ, Zhang YX, Liu HT, Huang JL, Liu ZX, Ma L and Zhong JH: Treatments of hepatocellular carcinoma with portal vein tumor thrombus: Current status and controversy. J Clin Transl Hepatol. 10:147–158. 2022. View Article : Google Scholar : PubMed/NCBI

4 

Frenette CT, Osorio RC, Stark J, Fok B, Boktour MR, Guy J, Rhee J and Osorio RW: Conventional TACE and drug-eluting bead TACE as locoregional therapy before orthotopic liver transplantation: Comparison of explant pathologic response. Transplantation. 98:781–787. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Miksad RA, Ogasawara S, Xia F, Fellous M and Piscaglia F: Liver function changes after transarterial chemoembolization in US hepatocellular carcinoma patients: The LiverT study. BMC Cancer. 19:7952019. View Article : Google Scholar : PubMed/NCBI

6 

Sergio A, Cristofori C, Cardin R, Pivetta G, Ragazzi R, Baldan A, Girardi L, Cillo U, Burra P, Giacomin A and Farinati F: Transcatheter arterial chemoembolization (TACE) in hepatocellular carcinoma (HCC): The role of angiogenesis and invasiveness. Am J Gastroenterol. 103:914–921. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Kudo M, Matsui O, Izumi N, Kadoya M, Okusaka T, Miyayama S, Yamakado K, Tsuchiya K, Ueshima K, Hiraoka A, et al: Transarterial chemoembolization failure/refractoriness: JSH-LCSGJ criteria 2014 update. Oncology. 87 (Suppl 1):S22–S31. 2014. View Article : Google Scholar

8 

Sahin TK, Rizzo A, Aksoy S and Guven DC: Prognostic significance of the royal Marsden hospital (RMH) score in patients with cancer: A systematic review and Meta-analysis. Cancers (Basel). 16:18352024. View Article : Google Scholar : PubMed/NCBI

9 

Rizzo A, Ricci AD and Brandi G: Trans-arterial chemoembolization plus systemic treatments for hepatocellular carcinoma: An update. J Pers Med. 12:17882022. View Article : Google Scholar : PubMed/NCBI

10 

Rizzo A, Dadduzio V, Ricci AD, Massari F, Di Federico A, Gadaleta-Caldarola G and Brandi G: Lenvatinib plus pembrolizumab: The next frontier for the treatment of hepatocellular carcinoma? Expert Opin Investig Drugs. 31:371–378. 2022. View Article : Google Scholar : PubMed/NCBI

11 

Qin J, Huang Y, Zhou H and Yi S: Efficacy of sorafenib combined with immunotherapy following transarterial chemoembolization for advanced hepatocellular carcinoma: A Propensity Score Analysis. Front Oncol. 12:8071022022. View Article : Google Scholar : PubMed/NCBI

12 

Zhang JX, Chen P, Liu S, Zu QQ, Shi HB and Zhou CG: Safety and efficacy of transarterial chemoembolization and immune checkpoint inhibition with camrelizumab for treatment of unresectable hepatocellular carcinoma. J Hepatocell Carcinoma. 9:265–272. 2022. View Article : Google Scholar : PubMed/NCBI

13 

Rizzo A, Ricci AD and Brandi G: Systemic adjuvant treatment in hepatocellular carcinoma: Tempted to do something rather than nothing. Future Oncol. 16:2587–2589. 2020. View Article : Google Scholar : PubMed/NCBI

14 

Latchman DS: Transcription factors: An overview. Int J Biochem Cell Biol. 29:1305–1312. 1997. View Article : Google Scholar : PubMed/NCBI

15 

Bushweller JH: Targeting transcription factors in cancer-from undruggable to reality. Nat Rev Cancer. 19:611–624. 2019. View Article : Google Scholar : PubMed/NCBI

16 

He Q, Li W, Ren J, Huang Y, Huang Y, Hu Q, Chen J and Chen W: ZEB2 inhibits HBV transcription and replication by targeting its core promoter. Oncotarget. 7:16003–16011. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Takada H and Kurisaki A: Emerging roles of nucleolar and ribosomal proteins in cancer, development, and aging. Cell Mol Life Sci. 72:4015–4025. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Zhang G and Zhang G: Upregulation of FoxP4 in HCC promotes migration and invasion through regulation of EMT. Oncol Lett. 17:3944–3951. 2019.PubMed/NCBI

19 

replot (Version sva v3.46.0) [Computer software], . 2023.Retrieved from. https://github.com/jtleek/sva-devel

20 

Lambert SA, Jolma A, Campitelli LF, Das PK, Yin Y, Albu M, Chen X, Taipale J, Hughes TR and Weirauch MT: The human transcription factors. Cell. 172:650–665. 2018. View Article : Google Scholar : PubMed/NCBI

21 

Hume MA, Barrera LA, Gisselbrecht SS and Bulyk ML: UniPROBE, update 2015: New tools and content for the online database of protein-binding microarray data on protein-DNA interactions. Nucleic Acids Res. 43((Database Issue)): D117–D122. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Wingender E, Schoeps T, Haubrock M, Krull M and Dönitz J: TFClass: Expanding the classification of human transcription factors to their mammalian orthologs. Nucleic Acids Res. 46:D343–D347. 2018. View Article : Google Scholar : PubMed/NCBI

23 

replot (Version 4.0.5) [Computer software], . 2023.Retrieved from. http://www.R-project.org/

24 

replot (Version limma v3.52.0) [Computer software], . 2023.Retrieved from. https://bioconductor.org/packages/release/bioc/html/limma.html

25 

replot (Version pheatmap v1.0.12) [Computer software], . 2019.Retrieved from. https://cran.r-project.org/web/packages/pheatmap/index.html

26 

replot (Version clusterProfiler v4.4.0) [Computer software], . 2023.Retrieved from. https://bioconductor.org/packages/release/bioc/html/clusterProfiler.html

27 

replot (Version WGCNA v1.68) [Computer software], . 2021.Retrieved from. https://cran.r-project.org/web/packages/WGCNA/index.html

28 

replot (Version v1.0.0) [Computer software], . 2023.Retrieved from. https://cran.r-project.org/web/packages/replot/index.html

29 

replot (Version TIMER v2.0) [Computer software], . 2020.Retrieved from. http://timer.cistrome.org/

30 

replot (Version CIBERSORT v1.06) [Computer software], . 2015.Retrieved from. https://cibersort.stanford.edu/

31 

replot (Version quanTIseq v1.0) [Computer software], . 2019.Retrieved from. https://icbi.i-med.ac.at/software/quantiseq/doc/

32 

replot (Version MCP-counter v1.2.0) [Computer software], . 2021.Retrieved from. https://github.com/ebecht/MCPcounter

33 

replot (Version xCell v1.1.0) [Computer software], . 2017.Retrieved from. https://xcell.ucsf.edu/

34 

replot (Version EPIC v1.1) [Computer software], . 2020.Retrieved from. https://gfellerlab.shinyapps.io/EPIC_1-1/

35 

replot (Version ESTIMATE v1.0.13) [Computer software], . 2013.Retrieved from. https://bioinformatics.mdanderson.org/estimate/

36 

Yoshihara K, Shahmoradgoli M, Martinez E, Vegesna R, Kim H, Torres-Garcia W, Treviño V, Shen H, Laird PW, Levine DA, et al: Inferring tumour purity and stromal and immune cell admixture from expression data. Nat Commun. 4:26122013. View Article : Google Scholar : PubMed/NCBI

37 

Thorsson V, Gibbs DL, Brown SD, Wolf D, Bortone DS, Ou Yang TH, Porta-Pardo E, Gao GF, Plaisier CL, Eddy JA, et al: The immune landscape of cancer. Immunity. 48:812–30.e14. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Geeleher P, Cox NJ and Huang RS: Clinical drug response can be predicted using baseline gene expression levels and in vitro drug sensitivity in cell lines. Genome Biol. 15:R472014. View Article : Google Scholar : PubMed/NCBI

39 

replot (Version pRRophetic v1.0.2) [Computer software], . 2024.Retrieved from. https://github.com/paulgeeleher/pRRophetic2

40 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Luo Q and Vogeli TA: A Methylation-Based reclassification of bladder cancer based on immune cell genes. Cancers (Basel). 12:30542020. View Article : Google Scholar : PubMed/NCBI

42 

Shin SW: The current practice of transarterial chemoembolization for the treatment of hepatocellular carcinoma. Korean J Radiol. 10:425–434. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Ananthakrishnan A, Gogineni V and Saeian K: Epidemiology of primary and secondary liver cancers. Semin Intervent Radiol. 23:47–63. 2006. View Article : Google Scholar : PubMed/NCBI

44 

Islam Z, Ali AM, Naik A, Eldaw M, Decock J and Kolatkar PR: Transcription Factors: The Fulcrum Between Cell Development and Carcinogenesis. Front Oncol. 11:6813772021. View Article : Google Scholar : PubMed/NCBI

45 

Caamano J and Hunter CA: NF-kappaB family of transcription factors: Central regulators of innate and adaptive immune functions. Clin Microbiol Rev. 15:414–429. 2002. View Article : Google Scholar : PubMed/NCBI

46 

Fachinetti D, Folco HD, Nechemia-Arbely Y, Valente LP, Nguyen K, Wong AJ, Zhu Q, Holland AJ, Desai A, Jansen LE and Cleveland DW: A two-step mechanism for epigenetic specification of centromere identity and function. Nat Cell Biol. 15:1056–1066. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Mahlke MA and Nechemia-Arbely Y: Guarding the Genome: CENP-A-Chromatin in health and cancer. Genes (Basel). 11:8102020. View Article : Google Scholar : PubMed/NCBI

48 

Pearson R, Fleetwood J, Eaton S, Crossley M and Bao S: Kruppel-like transcription factors: A functional family. Int J Biochem Cell Biol. 40:1996–2001. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Suzuki H, Ohshima N, Tatei K, Taniguchi T, Sato S and Izumi T: The role of autonomously secreted PGE2 and its autocrine/paracrine effect on bone matrix mineralization at the different stages of differentiating MC3T3-E1 cells. Biochem Biophys Res Commun. 524:929–935. 2020. View Article : Google Scholar : PubMed/NCBI

50 

Beilke S, Oswald F, Genze F, Wirth T, Adler G and Wagner M: The zinc-finger protein KCMF1 is overexpressed during pancreatic cancer development and downregulation of KCMF1 inhibits pancreatic cancer development in mice. Oncogene. 29:4058–4067. 2010. View Article : Google Scholar : PubMed/NCBI

51 

Wang X, Lu Y, Li C, Larbi A and Feng L, Shen Q, Chong MS, Lim WS and Feng L: Associations of lifestyle activities and a heathy diet with frailty in old age: A Community-based study in Singapore. Aging (Albany NY). 12:288–308. 2020. View Article : Google Scholar : PubMed/NCBI

52 

Preston GC, Feijoo-Carnero C, Schurch N, Cowling VH and Cantrell DA: The impact of KLF2 modulation on the transcriptional program and function of CD8 T cells. PLoS One. 8:e775372013. View Article : Google Scholar : PubMed/NCBI

53 

Zhuang WZ, Lin YH, Su LJ, Wu MS, Jeng HY, Chang HC, Huang YH and Ling TY: Mesenchymal stem/stromal Cell-based therapy: Mechanism, systemic safety and biodistribution for precision clinical applications. J Biomed Sci. 28:282021. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shi J, Wei X, Jiang F, Zhu J, Shen J and Sun Y: Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma. Oncol Lett 29: 42, 2025.
APA
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., & Sun, Y. (2025). Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma. Oncology Letters, 29, 42. https://doi.org/10.3892/ol.2024.14788
MLA
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., Sun, Y."Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma". Oncology Letters 29.1 (2025): 42.
Chicago
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., Sun, Y."Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma". Oncology Letters 29, no. 1 (2025): 42. https://doi.org/10.3892/ol.2024.14788
Copy and paste a formatted citation
x
Spandidos Publications style
Shi J, Wei X, Jiang F, Zhu J, Shen J and Sun Y: Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma. Oncol Lett 29: 42, 2025.
APA
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., & Sun, Y. (2025). Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma. Oncology Letters, 29, 42. https://doi.org/10.3892/ol.2024.14788
MLA
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., Sun, Y."Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma". Oncology Letters 29.1 (2025): 42.
Chicago
Shi, J., Wei, X., Jiang, F., Zhu, J., Shen, J., Sun, Y."Construction and validation of transcription‑factor‑based prognostic signature for TACE non‑response and characterization of tumor microenvironment infiltration in hepatocellular carcinoma". Oncology Letters 29, no. 1 (2025): 42. https://doi.org/10.3892/ol.2024.14788
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team