Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November-2014 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2014 Volume 32 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

SHIP1 is targeted by miR-155 in acute myeloid leukemia

  • Authors:
    • Hua Xue
    • Luo-Ming Hua
    • Ming Guo
    • Jian-Min Luo
  • View Affiliations / Copyright

    Affiliations: Department of Hematology, The Second Hospital of Hebei Medical University, Shijiazhuang, Hebei 050000, P.R. China, Department of Hematology, Affiliated Hospital of Hebei University, Baoding, Hebei 071000, P.R. China
  • Pages: 2253-2259
    |
    Published online on: August 22, 2014
       https://doi.org/10.3892/or.2014.3435
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The SH2 domain-containing inositol 5'-phosphatase 1 (SHIP1) has been implicated as a suppressor of hematopoietic transformation as its activity can inhibit the PI3K/Akt signaling pathway. Reduced activity of SHIP1 has been observed in acute myeloid leukemia (AML). SHIP1 is a target of microRNA-155 (miR-155). Therefore, the aim of the present study was to investigate the role of miR-155/SHIP1 in the pathogenesis of AML. We examined the levels of SHIP1 protein and miR-155 in tissue samples of patients with AML and in AML cell lines. In addition, we investigated cell proliferation, apoptosis and expression of SHIP1/PI3K/AKT pathway molecules in the THP-1 and U937 cell lines after miR-155 inhibitor or mimics were transfected. We showed that the levels of SHIP1 protein were significantly decreased in tissue samples of patients with some subtypes of AML (M4 or M5) and in AML cell lines with concomitant overexpression of miR-155. In addition, we demonstrated that decreased expression of SHIP1 in the AML cell lines was a consequence of increased levels of miR-155 and can therefore be reversed in vitro through inhibition of miR-155, with subsequent inhibition of cell proliferation and promotion of cell apoptosis. In conclusion, expression of the SHIP1 protein is targeted by miR-155 in AML. miR-155 acts as an onco-miR, and the miR-155/SHIP1/PI3K/AKT signaling pathway could play an important role in the pathogenesis of AML.

Introduction

SH2 domain-containing inositol 5′-phosphatase 1 (SHIP1) is a member of the phosphatidylinositol phosphatase (PIPase) class that is important in the negative regulation of proliferation and survival of hematopoietic cells through its negative regulation of the PI3K/AKT signaling pathway (1,2). Recent studies have shown that inactivation of SHIP1 could play a central role in certain hematologic malignancies (1–6). Inactivation of point mutations of the SHIP1 gene and reduction in SHIP1 activity have been observed in patients with acute myeloid leukemia (AML), implicating a possible tumor-suppressor function of SHIP1 in the pathogenesis of AML (6). However, it appears that SHIP1 gene mutations are an uncommon cause of reduction in SHIP1 activity in AML (7). Several other possible explanations that could account for the loss of SHIP1 function include epigenetic modification, decreased transcription, translational repression, and increased protein breakdown. miR-155 has been shown to bind to the 3′UTR of SHIP1 mRNA and inhibit its translation (8–11). It was demonstrated that SHIP1 is a primary target of miR-155 in B cells, with high levels of miR-155 and reduced expression of SHIP1 linked to the development of acute lymphoblastic leukemia in mice (3,12). Levels of miR-155 were also found to be significantly increased in human patients with diffuse large B cell lymphoma or NK/T cell leukemia with decreased SHIP1 expression (13,14). Further investigation is needed to evaluate the role of miR155 and SHIP1 in the pathogenesis of AML.

In the present study, we examined the levels of SHIP1 protein and miR-155 in samples of patients with AML and in AML cell lines. In addition, we investigated cell proliferation, apoptosis and expression of SHIP1/PI3K/AKT pathway molecules in the THP-1 and U937 cell lines after miR-155 inhibitor or mimics were transfected.

Materials and methods

Bone marrow or blood samples

Bone marrow or blood samples were collected from 30 patients with AML after obtaining informed consent according to our hospital guidelines. The pathological diagnosis of AML was established according to the French-American-British (FAB) classification criteria as M1 (n=4), M2 (n=8), M3 (n=2), M4 (n=6), M5 (n=9), or M6 (n=1). Bone marrow mononuclear cells (BMMNCs) or peripheral blood mononuclear cells (PBMNCs) of the patients were separated by density gradient centrifugation and cryopreserved until further analysis could be performed. BMMNCs from 10 unrelated healthy volunteers were also examined for miR-155 and SHIP1 by quantitative reverse-transcription polymerase chain reaction (qRT-PCR).

Cell lines

The leukemia cell lines K562, THP-1 and U937 were purchased from the Blood Institute of Tianjin, China. Cells were cultured using RPMI-1640 medium containing 10% fetal bovine serum (FBS), 2 mM glutamine, and streptomycin in a humidified incubator at 37°C in 5% CO2. Cells were used for experimentation at a density of 106–107/l.

Cell transfections

U937 and THP-1 cells were transfected using X-tremeGENE siRNA transfection reagent (Roche, CH) according to the manufacturer’s protocol. Briefly, cells were cultured in 6-well plates. Transfection reagent 1 was prepared by mixing 90 μl of Opti-MEM medium and 10 μl of X-tremeGENE siRNA transfection reagent. Additionally, reagent 2 containing siRNA (2 μg of inhibitor) and 100 μl of Opti-MEN medium was prepared. Reagent 2 was mixed with reagent 1 and incubated for 30 min. This mixture was then carefully added to the plated cells to obtain a final concentration of miR-155 mimics or miR-155 siRNA of 50 nmol/l. Cells were cultured for 48 h and then collected for analysis of gene expression and subsequent experiments. Cells used for the blank and negative control groups were treated with only serum-free RPMI-1640 medium or with control reagent (at a final concentration of 50 nmol/l), respectively.

Measurement of apoptosis

Cellular apoptosis was measured by flow cytometry, according to the following protocol, 48 h after transfection. Briefly, ~5–10×104 resuspended cells were collected by centrifugation at 500 × g for 5 min and resuspended again in 195 μl of Annexin V-FITC. A total of 5 μl of Annexin V-FITC solution was added to the cells, mixed gently, and incubated in the dark at room temperature. Cells were collected again by centrifugation and resuspended in 190 μl of Annexin V-FITC. A total of 10 μl of propidium iodide staining solution was added and mixed, and apoptosis measurement was performed by flow cytometry. Data were analyzed using FACS Diva software (BD Biosciences, San Jose, CA, USA).

Measurement of cell proliferation

Cells were collected 48 h after transfection by centrifugation at 500 × g for 5 min, resuspended, and added to 96-well plates (100 μl/well, approximately 104 cells/well). This time point was defined as zero (0). Then, 10 μl of CCK-8 was added to the wells separately at 24, 48 and 72 h, and the absorbance was measured at 450 nm.

RNA isolation and PCR

Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. The quality of total RNA was assessed using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA).

Measurement of miR-155 gene expression

Total RNA (2 μg) was reversed-transcribed using an All-in-One miRNA qRT-PCR detection system (Invitrogen) according to the manufacturer’s protocol. All-in-One miRNA qRT-PCR detection system kits were used to measure gene expression using specific sets of primers (Table I) according to the protocol (Invitrogen). All reactions were performed with the ABI Prism 7000 sequence detection system instrument (Applied Biosystems). Gene expression was normalized to the U6 gene, and the data were analyzed using the comparative 2−ΔΔCt method.

Table I

Primers and sequences of miR-155 mimics, inhibitors and negative control.

Table I

Primers and sequences of miR-155 mimics, inhibitors and negative control.

PrimersSequence (5′-3′)
miR-155-5p mimics UUAAUGCUAAUCGUGAUAGGGGU
CCCUAUCACGAUUAGCAUUAAUU
Negative control for markup mimics UUCUCCGAACGUGUCACGUTT
ACGUGACACGUUCGGAGAATT
miR-155-5p inhibitor ACCCCUAUCACGAUUAGCAUUAA
Negative control for miR-155-5p inhibitor CAGUACUUUUGUGUAGUACAA
Measurement of SHIP-1 gene expression

Total RNA (2 μg) was analyzed for gene expression using One-Step qRT-PCR kits according to the manufacturer’s protocol. Briefly, 25 μl of 2X Quant One-Step SYBR qRT-PCR Master Mix, 2.5 μl of 2.5 U/μl Hot Master Taq polymerase, 0.4 μl of Quant Rtase, 2 μl of the forward primer (10 pM), 2 μl of the reverse primer (10 pM) (both by Invitrogen), and 2 μg of total RNA were mixed and double-distilled water was added to reach a final volume of 50 μl. The primer sequences of the SHIP1 gene are listed in Table II. All reactions were performed in the ABI Prism 7000 sequence detection system. Gene expression was normalized to the GAPDH gene, and the data were analyzed using the comparative 2−ΔΔCt method.

Table II

Primers for real-time PCR.

Table II

Primers for real-time PCR.

PrimersSequence
SHIP1F: 5′-GCGTGCTGTATCGGAATTGC-3′
R: 5′-TGGTGAAGAACCTCATGGAGAC-3′
GAPDHF: 5′-ACCACAGTCCATGCCATCACT-3′
R: 5′-TCCACCACCCTGTTGCTGTA-3′
miR-155F: 5′-CCCCTATCACGATTAGCATTAA-3′
U6F: 5′-GCAGGGGCCATGCTAATCTTCTCTGTATCG-3′

[i] F, forward; R, reverse.

Western blotting

Cells were digested and proteins were extracted in RIPA lysis buffer. The concentration of proteins was measured by the Bradford method according to the standard protocol. A total of 20 μg of total protein extract was electrophoresed on polyacrylamide/sodium dodecyl sulfate (SDS) gels and transferred by electroblotting onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked for 1 h in 5% (w/v) nonfat milk before incubation with appropriate dilutions of the primary antibodies against SHIP-1, AKT, p-AKT and actin (all at 1:1,000; from Cell Signaling Technology, Boston, MA, USA) at 4°C overnight. The membranes were then incubated with the corresponding secondary antibodies (1:10,000; Zymed). The blots were developed using the enhanced chemiluminescence (ECL) system (Immobilon Western; Millipore, Billerica, MA, USA) and were analyzed using Quantity One Software (Bio-Rad Laboratories Inc., Hercules, CA, USA). Protein contents were normalized to the actin level.

Data analyses

Data are expressed as the means ± SD. Statistical analyses of experimental groups were performed by Student’s t-test or one-way analysis of variance (ANOVA). The level of statistical significance was set at P<0.05. Analyses were performed using SPSS 13.0 for Windows software (SPSS, Chicago, IL, USA).

Results

Expression of miR-155 and SHIP1 in patients with AML

The SHIP1 protein content was significantly lower in the tissue samples from AML patients when compared with that in the controls (P<0.05). No differences were found in the expression of SHIP1 at the mRNA level among the 30 patients with different subtypes of AML according to the FAB classification (P>0.05, Fig. 1A). However, the levels of SHIP1 protein varied greatly. A much lower expression than the average level of SHIP1 protein was detected in 15 patients classified as FAB-AML-M4 or FAB-AML-M5 compared with the other subtypes of AML (P<0.05, Fig. 1B and C). The average level of miR-155 was significantly higher in the 30 AML patients compared with the average level in the healthy controls (P<0.05). Additionally, the levels of miR-155 were significantly higher in patients with AML subtype M4 or M5 compared with the other AML subtypes (P<0.05, Fig. 1D).

Figure 1

Expression of miR-155 and SHIP1 in bone marrow cells from the subjects. (A) Expression of SHIP1 at the mRNA level in tissue samples from patients with M4 or M5 AML (n=15), with other types of AML according to FAB classification except M4 or M5 (other AML) (n=15) and in normal controls (n=10). *P<0.05, M4/M5 vs. other AML. (B) SHIP1 protein levels in the tissue samples from patients and normal controls. Lanes 1, 2, 10, 11 and 16 correspond to patients with M4 or M5; lanes 3, 5, 9, 12 and 13 correspond to normal controls and lanes 4, 6, 7, 8, 14 and 15 correspond to patients with other AML. (C) SHIP1 protein levels in tissue samples from patients with M4 or M5, with other AML and in normal controls. *P<0.05, M4/M5 vs. other AML. (D) Relative gene expression of miR-155 at the mRNA level in tissue samples from patients with M4 or M5, with other AML and in normal controls. *P<0.05, M4/M5 vs. other AML.

Expression of miR-155 and SHIP1 in AML cell lines

Real-time PCR demonstrated that both miR-155 and SHIP1 were expressed in the THP-1, K562, and U937 cell lines. Downregulation of SHIP1 expression in the K562 cells, which are known to be Philadelphia chromosome-positive, could be the result of overexpression of BCR/ABL. Thus, the U937 and THP-1 cell lines were chosen for further study. Specifically, THP-1 cells expressed a higher miR-155 level but a lower SHIP1 level between the two cell lines studied (Fig. 2A). In contrast, U937 cells had a higher SHIP1 level but a lower miR-155 expression (Fig. 2B).

Figure 2

Expression of miR-155 and SHIP1 in AML cell lines. Relative gene expression of (A) miR-155 and (B) SHIP/GADPH in the THP1, U937 and K562 cell lines.

Expression of SHIP1, AKT and pAKT after miR-155 transfection

Since SHIP1 is a negative regulator of the PI3K/AKT signaling pathway, we hypothesized that increased activation of PI3K/AKT signaling in AML samples with low SHIP1 expression may be observed after miR-155 transfection. Because the levels of miR-155 expression were lower in the U937 cells than that in the THP-1 cells, we chose to transfect miR-155 mimics into the U937 cells (Fig. 3A). Transfection of miRNA-155 mimics in the U937 cells did not alter the expression of SHIP1 at the mRNA level compared with the expression in the blank control and negative transfection groups (P>0.05, Fig. 3B). However, U937 cells transfected with the miRNA-155 mimics had significantly reduced expression of SHIP1 at the protein level (P<0.05, Fig. 3C and D), associated with unchanged AKT content but increased p-AKT protein levels (P<0.05, Fig. 3C and E). Consequently, inhibition of SHIP1 expression by miR-155 would likely increase the activity of the AKT pathway. Therefore, miR-155 appears to behave as an onco-miR by reducing SHIP1 expression.

Figure 3

Expression of SHIP1, AKT, and p-AKT after miR-155 transfection. Relative gene expression of (A) miR-155 and (B) SHIP1 at the mRNA level in U937 cells without transfection (U937c), and in U937 cells transfected with the miR-155 mimics (U937m) or with the miR-155 mimic control (U937mc). (C) Protein levels of SHIP1, p-AKT and T-AKT in the U937m and U937mc cells. (D) A significantly decreased SHIP1 level and (E) increased p-AKT/T-AKT ratio were found in the U937m cells when compared with the U937mc cells. *P<0.05 vs. U937mc.

Expression of SHIP1, AKT, and pAKT after transfection of the miR-155 inhibitor

We then used miR-155 siRNA to examine the effects of restoring SHIP1 protein levels by reducing miR-155 expression in the THP-1 cells (Fig. 4A), which are known to overexpress miR-155. When THP-1 cells were transfected with the miR-155 siRNA, significantly elevated levels of SHIP1 protein were found, although no alterations in SHIP1 gene expression at the mRNA level could be detected compared with the expression levels in the blank and negative controls (Fig. 4B). THP-1 cells transfected with miR-155 siRNA also exhibited no alteration in total AKT content, but increased SHIP1 protein and decreased p-AKT levels were found (P<0.05 and P<0.05 respectively; Fig. 4C–E). It appears that suppression of miR-155 expression leads to inactivation of pAKT without altering total AKT via restoration of SHIP1 protein. Therefore, SHIP1 negatively regulates signaling in the PI3K/AKT pathway. SHIP1 could be a tumor suppressor.

Figure 4

Expression of SHIP1, AKT, and p-AKT after transfection with the miR-155 inhibitor. Relative gene expression of (A) miR-155 and (B) SHIP1 at the mRNA level in THP-1 cells without transfection (THP-1c), and in THP-1 cells transfected with the miR-155 inhibitor (THP-1I) or with the miR-155 inhibitor control (THP-1Ic). (C) Protein levels of SHIP1, T-AKT and p-AKT in the THP-1I and THP-1Ic cells. (D) A significantly increased SHIP1 level and (E) decreased p-AKT/T-AKT ratio were found in the THP-1I cells when compared with the THP-1Ic cells. *P<0.05 vs. THP-1Ic.

Proliferation and apoptosis in the cell lines after transfection

To investigate the role of the miR-155/SHIP1/PI3K/AKT pathway in leukemogenesis, we performed proliferation and apoptosis assays in cell lines. First, we analyzed the effect on the autonomous proliferation of cells after transfection. Compared with the cells transfected with the mimic control (U937mc), the proliferation rate of the cells transfected with the miR-155 mimics (U937m) appeared higher but did not reach a statistically significant difference at any time point (U937m vs. U937mc; all P>0.05; Fig. 5A). However, the U937m cells had a significantly lower apoptosis rate when compared with that of the U937mc cells (U937m vs. U937mc; P<0.05; Fig. 6A), indicating that miR-155 might cause AML progression by reducing cell apoptosis rather than increasing cell proliferation.

Figure 5

Proliferation in the cell lines after transfection. (A) Proliferation of the U937 cells without transfection (U937), or transfected with the miR-155 mimics (U937m), or with the mimic control (U937mc). (B) Proliferation of THP-1 cells without transfection (THP-1), or THP-1 cells transfected with the miR-155 siRNA (THP-1I), or with the miR-155 siRNA control (THP-1Ic).

Figure 6

Apoptosis in the cell lines after transfection as measured by flow cytometry. (A) A significantly increased apoptosis rate was found in the THP-1I cells when compared to this rate in the THP-1c cells (*P<0.05), and (B) a significantly decreased apoptosis rate was found in the U937m cells when compared to this rate in the U937mc cells (*P<0.05).

Similar results were also noted in the proliferation rate of THP-1 cells transfected with the miR-155 siRNA (THP-1I) and transfected with the inhibitor control (THP-1Ic), which indicated that miR-155 inhibition could not affect the proliferation rate of THP-1 at any time point (THP-1I vs. THP-1Ic; P>0.05; Fig. 5B). A significantly increased rate of apoptosis was observed in the THP-1I cells compared with that of the THP-1Ic cells (THP-1I vs. THP-1Ic; P<0.05; Fig. 6B), indicating miR-155 inhibition may cause an increased apoptosis rate in AML without interfering with proliferation.

Discussion

Considering that SHIP1 is a negative regulator of the PI3K/AKT signaling pathway, inactivation of SHIP1 may result in Akt activation (1,2,15). SHIP1-deficient mice develop myeloproliferative disease and leukemia (11,16). Inactivating point mutations of SHIP1 have been observed in AML. It appears that SHIP1 mutations are an uncommon cause of the reduction in SHIP1 activity (7). In our study, low SHIP1 protein expression levels that did not completely correspond to SHIP1 mRNA levels were detected in a subset of patients with AML. We then tried to identify the molecular basis for the loss of SHIP1 function at the protein level.

microRNAs are a newly discovered class of short, noncoding RNA species, which may serve as master switches in gene networks (8,17–20). miR-155 was shown to bind to the 3′UTR of SHIP1 mRNA and, therefore, to inhibit its translation (9–11,16,20,21). SHIP1 is expressed in the same cell types that express miR-155, and it plays an opposing role in many cases. Some studies demonstrated a strong correlation between myeloproliferative disorders (MPDs) caused by miR-155 expression and specific knockdown of SHIP1 (11,16). Recent studies showed that SHIP1 is a primary target of miR-155. Therefore, miR-155-mediated suppression of SHIP1 expression may contribute to the development of human MPDs and myeloid leukemia, in which miR-155 has been shown to be overexpressed (8,16,19,20,22,23). Moreover, it was recently reported that the endogenous expression of SHIP1 is reduced in hematopoietic cells overexpressing miR-155 in vitro and in vivo, which leads to increased activation of AKT (3). Our present findings are consistent with these reports.

We overexpressed miR-155 in U937 cells and found that the levels of SHIP1 protein were largely reduced in these cells. Furthermore, in THP-1 cells, we inhibited miR-155 expression using siRNA targeting miR-155 and found that the level of SHIP1 protein was increased. Following recent studies showing that SHIP1 plays an important role in the pathogenesis of lymphoma and acute lymphoblastic leukemia that is affected by miR-155 (3,14), we investigated the existence of an association between SHIP1 and miR-155 in AML. Our results demonstrated that SHIP1 is also a direct target of miR-155 in AML cells. We hypothesized that inhibition of the translation of SHIP1 mRNA by miR-155 could be an important mechanism for the loss of function of SHIP1.

To evaluate the importance of SHIP1/miR-155 in AML, we initially examined the levels of expression of SHIP1 and miR-155 in myeloid leukemia cells. We hypothesized that reduced expression of SHIP1 in leukemia cells could be a result of an elevated miR-155 expression as in other hematological malignancies (2,3,13,14,24). In fact, the levels of SHIP1 protein were lower in THP-1 and U937 cells than in control cells. In contrast, miR-155 levels were relatively higher. These results indicate that the expression of miR-155 is negatively associated with the expression of SHIP1 in AML cell lines. To test whether this observation could be found in patients with AML, we examined the expression of SHIP1 and miR-155 in 30 AML patients. We found elevated levels of miR-155 in patients with acute myelomonocytic leukemia and acute monocytic leukemia, corresponding to the FAB-AML-M4 and FAB-AML-M5 classifications, respectively, as well as decreased expression of SHIP1 protein. These results indicate that miR-155 expression is inversely correlated with SHIP1 expression in myeloid leukemia cell lines and in M4 and M5 patients, suggesting that an interaction of SHIP1 and miR-155 may be biologically significant in these two subtypes of AML. In addition, SHIP1 expression is downregulated in AML, whereas miR-155 is commonly overexpressed in subsets of AML patients and acts as an onco-miR. It is likely that the downregulation of SHIP1 expression by miR-155 is a plausible mechanism of miR-155-mediated oncogenesis in AML M4 or M5. This study found an association between the level of miR-155 and a specific leukemic phenotype, similar to the finding that miR-181 expression is positively correlated with M1 and M2 subtypes of AML (25), suggesting a possible role in the developmental lineage and differentiation state of the tumors (12,20–23,26,27).

Given that miR-155 is overexpressed in AML and that it may act as an onco-miR, we decided to examine whether miR-155 has oncogenic functions in AML cells in vitro. Our results indicated that miR-155 may cause AML by reducing cell apoptosis rather than increasing cell proliferation. The results of our in vitro assays indicated that miR-155 mimics inhibited the apoptosis of U937 cells. Conversely, transfection of anti-miR-155 in THP-1 cells increased apoptosis. Western blot analyses confirmed that the expression of SHIP1 in these cells was modulated by miR-155. Taken together, our results showed that miR-155 acts as an onco-miR in AML cells by downregulating SHIP1 expression. In addition, SHIP1 was also shown to be a tumor suppressor that regulates cell apoptosis in AML.

SHIP1 has been known to be a negative feedback regulator of PI3K/Akt signaling, and the antitumoral activity of SHIP1 is mediated by inhibition of Akt signaling via the PI3K pathway (1,2,4,5,15,28–30). Akt activation may affect many cellular processes, including cell cycle progression, transcription, translation, differentiation, and apoptosis. Given that SHIP1 expression is inhibited by miR-155, we hypothesized that miR-155 overexpression in AML may play a role in Akt signaling. In U937 cells with overexpressed miR-155, Akt was found to be activated. Conversely, we found that anti-miR-155 reduced p-Akt in THP-1 cells. Meanwhile, the levels of Akt protein were not affected by miR-155 overexpression or anti-miR-155. These results demonstrated that overexpression of miR-155 enhanced oncogenic Akt signaling via the SHIP1/PI3K pathway in AML cells. Given that the expression of miR-155 was significantly enhanced and that Akt signaling was active in the AML cell lines and a subset of patients with AML, we propose that the miR-155/SHIP1/PI3K/Akt pathway may play an important role in the pathogenesis of AML.

In summary, we hypothesized that inhibition of the expression of SHIP1 could be a mechanism by which miR-155 acts as an onco-miR in leukemia. Overexpression of miR-155 alters AKT signaling by inhibiting SHIP1 expression. The severe adverse effects and limitations of conventional chemotherapy and hematopoietic stem cell transplantation underscore the urgent need for new treatment strategies for patients with AML. Our findings provide new insight into the pathogenesis of leukemia and suggest that restoration of SHIP1 expression as a tumor suppressor by inhibiting miR-155 may represent a useful approach for the treatment of certain subtypes of AML.

Acknowledgements

This research was supported by the Special Research Fund of the Ministry of Health of China (no. 201202017) and the Natural Science Foundation of Hebei Province (no. H2012206139).

References

1 

Hamilton MJ, Ho VW, Kuroda E, et al: Role of SHIP in cancer. Exp Hematol. 39:2–13. 2011. View Article : Google Scholar

2 

Conde C, Gloire G and Piette J: Enzymatic and non-enzymatic activities of SHIP-1 in signal transduction and cancer. Biochem Pharmacol. 82:1320–1334. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Costinean S, Sandhu SK, Pedersen IM, et al: Src homology 2 domain-containing inositol-5-phosphatase and CCAAT enhancer-binding protein beta are targeted by miR-155 in B cells of Emicro-MiR-155 transgenic mice. Blood. 114:1374–1382. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Kennah M, Yau TY, Nodwell M, et al: Activation of SHIP via a small molecule agonist kills multiple myeloma cells. Exp Hematol. 37:1274–1283. 2009. View Article : Google Scholar

5 

Lo TC, Barnhill LM, Kim Y, Nakae EA, Yu AL and Diccianni MB: Inactivation of SHIP1 in T-cell acute lymphoblastic leukemia due to mutation and extensive alternative splicing. Leuk Res. 33:1562–1566. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Luo JM, Yoshida H, Komura S, et al: Possible dominant-negative mutation of the SHIP gene in acute myeloid leukemia. Leukemia. 17:1–8. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Gilby DC, Goodeve AC, Winship PR, Valk PJ, Delwel R and Reilly JT: Gene structure, expression profiling and mutation analysis of the tumour suppressor SHIP1 in Caucasian acute myeloid leukaemia. Leukemia. 21:2390–2393. 2007. View Article : Google Scholar : PubMed/NCBI

8 

O’Connell RM, Zhao JL and Rao DS: MicroRNA function in myeloid biology. Blood. 118:2960–2969. 2011.

9 

Teng G and Papavasiliou FN: Shhh! Silencing by microRNA-155. Philos Trans R Soc Lond B Biol Sci. 364:631–637. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Tili E, Croce CM and Michaille JJ: miR-155: on the crosstalk between inflammation and cancer. Int Rev Immunol. 28:264–284. 2009. View Article : Google Scholar : PubMed/NCBI

11 

O’Connell RM, Chaudhuri AA, Rao DS and Baltimore D: Inositol phosphatase SHIP1 is a primary target of miR-155. Proc Natl Acad Sci USA. 106:7113–7118. 2009.PubMed/NCBI

12 

Schwind S, Maharry K, Radmacher MD, et al: Prognostic significance of expression of a single microRNA, miR-181a, in cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B study. J Clin Oncol. 28:5257–5264. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Pedersen IM, Otero D, Kao E, et al: Onco-miR-155 targets SHIP1 to promote TNFalpha-dependent growth of B cell lymphomas. EMBO Mol Med. 1:288–295. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Yamanaka Y, Tagawa H, Takahashi N, et al: Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia. Blood. 114:3265–3275. 2009. View Article : Google Scholar

15 

Metzner A, Precht C, Fehse B, et al: Reduced proliferation of CD34(+) cells from patients with acute myeloid leukemia after gene transfer of INPP5D. Gene Ther. 16:570–573. 2009. View Article : Google Scholar : PubMed/NCBI

16 

O’Connell RM, Rao DS, Chaudhuri AA, et al: Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. J Exp Med. 205:585–594. 2008.PubMed/NCBI

17 

Sayed D and Abdellatif M: AKT-ing via microRNA. Cell Cycle. 9:3213–3217. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Volinia S, Galasso M, Costinean S, et al: Reprogramming of miRNA networks in cancer and leukemia. Genome Res. 20:589–599. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Zhi F, Cao X, Xie X, et al: Identification of circulating microRNAs as potential biomarkers for detecting acute myeloid leukemia. PLoS One. 8:e567182013. View Article : Google Scholar : PubMed/NCBI

20 

Vasilatou D, Papageorgiou S, Pappa V, Papageorgiou E and Dervenoulas J: The role of microRNAs in normal and malignant hematopoiesis. Eur J Haematol. 84:1–16. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Faraoni I, Antonetti FR, Cardone J and Bonmassar E: miR-155 gene: a typical multifunctional microRNA. Biochim Biophys Acta. 1792:497–505. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Wang Y, Li Z, He C, et al: MicroRNAs expression signatures are associated with lineage and survival in acute leukemias. Blood Cells Mol Dis. 44:191–197. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Yuan Y, Kasar S, Underbayev C, Prakash S and Raveche E: MicroRNAs in acute myeloid leukemia and other blood disorders. Leuk Res Treatment. 2012:6038302012.PubMed/NCBI

24 

Lawrie CH: MicroRNAs and haematology: small molecules, big function. Br J Haematol. 137:503–512. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Debernardi S, Skoulakis S, Molloy G, Chaplin T, Dixon-McIver A and Young BD: MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis. Leukemia. 21:912–916. 2007.PubMed/NCBI

26 

Hyde RK and Liu PP: The role of microRNAs in acute myeloid leukemia. F1000 Biol Rep. 2:812010.PubMed/NCBI

27 

Joyce CE and Novina CD: miR-155 in acute myeloid leukemia: not merely a prognostic marker? J Clin Oncol. 31:2219–2221. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Baran CP, Tridandapani S, Helgason CD, Humphries RK, Krystal G and Marsh CB: The inositol 5′-phosphatase SHIP-1 and the Src kinase Lyn negatively regulate macrophage colony-stimulating factor-induced Akt activity. J Biol Chem. 278:38628–38636. 2003.

29 

Blunt MD and Ward SG: Targeting PI3K isoforms and SHIP in the immune system: new therapeutics for inflammation and leukemia. Curr Opin Pharmacol. 12:444–451. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Ong CJ, Ming-Lum A, Nodwell M, et al: Small-molecule agonists of SHIP1 inhibit the phosphoinositide 3-kinase pathway in hematopoietic cells. Blood. 110:1942–1949. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xue H, Hua L, Guo M and Luo J: SHIP1 is targeted by miR-155 in acute myeloid leukemia. Oncol Rep 32: 2253-2259, 2014.
APA
Xue, H., Hua, L., Guo, M., & Luo, J. (2014). SHIP1 is targeted by miR-155 in acute myeloid leukemia. Oncology Reports, 32, 2253-2259. https://doi.org/10.3892/or.2014.3435
MLA
Xue, H., Hua, L., Guo, M., Luo, J."SHIP1 is targeted by miR-155 in acute myeloid leukemia". Oncology Reports 32.5 (2014): 2253-2259.
Chicago
Xue, H., Hua, L., Guo, M., Luo, J."SHIP1 is targeted by miR-155 in acute myeloid leukemia". Oncology Reports 32, no. 5 (2014): 2253-2259. https://doi.org/10.3892/or.2014.3435
Copy and paste a formatted citation
x
Spandidos Publications style
Xue H, Hua L, Guo M and Luo J: SHIP1 is targeted by miR-155 in acute myeloid leukemia. Oncol Rep 32: 2253-2259, 2014.
APA
Xue, H., Hua, L., Guo, M., & Luo, J. (2014). SHIP1 is targeted by miR-155 in acute myeloid leukemia. Oncology Reports, 32, 2253-2259. https://doi.org/10.3892/or.2014.3435
MLA
Xue, H., Hua, L., Guo, M., Luo, J."SHIP1 is targeted by miR-155 in acute myeloid leukemia". Oncology Reports 32.5 (2014): 2253-2259.
Chicago
Xue, H., Hua, L., Guo, M., Luo, J."SHIP1 is targeted by miR-155 in acute myeloid leukemia". Oncology Reports 32, no. 5 (2014): 2253-2259. https://doi.org/10.3892/or.2014.3435
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team