Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
August-2016 Volume 36 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2016 Volume 36 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression

  • Authors:
    • Liwen Guo
    • Jiaping Zheng
    • Jing Zhang
    • Haohao Wang
    • Guoliang Shao
    • Lisong Teng
  • View Affiliations / Copyright

    Affiliations: Department of Surgical Oncology, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, P.R. China, Department of Intervention Therapy, Zhejiang Cancer Hospital, Hangzhou, Zhejiang 310022, P.R. China
  • Pages: 729-736
    |
    Published online on: June 15, 2016
       https://doi.org/10.3892/or.2016.4875
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Triple-negative breast cancer (TNBC) constitutes ~10-15% of breast cancer patients and represents an aggressive subtype with poor overall prognosis. TNBC is an important clinical challenge because it does not respond well to endocrine therapy and have a higher rate of early recurrence and distant metastasis following chemotherapy. Although it has been reported that the epidermal growth factor receptor (EGFR) was overexpressed in ~80% of TNBC, anti-EGFR therapy showed limited clinical benefit according to phase II studies. In this study, we first observed that knockdown of the transcriptional coactivator with PDZ-binding domain (TAZ) gene can regulate the sensitivity of TNBC cell lines to EGFR inhibitors (EGFRI) in a cell context-depended manner. Furthermore, in certain breast cancer cell lines the YES-associated protein, paralog of TAZ (YAP) expression can be upregulated by TAZ inhibition which leads to EGFRI resistance. These results suggest a specific inhibitor to TAZ/YAP combined with anti-EGFR therapy may prove effective and provide a reason why targeting EGFR showed limited clinical benefit in TNBC treatment.

Introduction

Breast cancer is the most frequently diagnosed cancer in women around the world (1). Although the mortality has declined over the two decades mainly due to the deeper understanding of its biology and advances in management approaches, it is still the most life-threatening cancer in women, and, even worse, the incidence rate is increasing gradually (2). Through gene expression profiling, several intrinsic breast cancer subtypes have been identified. Triple-negative breast cancer (TNBC), one of the subtypes, accounting for 10–15% of invasive breast cancers, is characterized by the absence of estrogen receptor and progesterone receptor and no overexpression of human epidermal growth factor receptor 2 (HER2) (3). Therefore, patients with TNBC cannot be treated with endocrine therapy or therapies targeted to HER2. As a group, they have a worse prognosis and tend to relapse early compared with other subtypes of breast cancers (4). Hence, there is a compelling need to find more effective treatments. It has been reported that the overexpression of epidermal growth factor receptor (EGFR) was seen in ~80% of TNBC (5,6). This discovery led to the investigation of the EGFR inhibitors (EGFRI). However, both the anti-EGFR monoclonal antibody cetuximab and the small molecular tyrosine kinase inhibitors (TKIs) gefitinib and erlotinib seem to be ineffective according to phase II studies (7-9). Thus, more studies are needed to answer the question of why EGFR inhibitors failed in treatment of those EGFR overexpressed breast cancers.

TAZ (transcriptional coactivator with PDZ-binding domain; also known as WWTR1) and its paralog YAP (YES associated protein) are the two main downstream effectors of the Hippo signaling pathway, which plays a major role in organ size control, cell differentiation, and tumorigenesis across species (10). TAZ is preferentially overexpressed in highly invasive breast cancer cells, most of which belong to TNBC cell lines (11). In addition, it has been reported that overexpression of TAZ induced the activation of EGFR signaling, and one of the EGFR ligands, amphiregulin (AREG), is a target of TAZ. AREG functions in a non-cell-autonomous manner to mediate EGF-independent growth and malignant behavior of mammary epithelial cells (12). These studies suggest that the high expression of TAZ may be one of the reasons that TNBC was not sensitive to EGFR inhibitors.

In this study, we successfully established two types of TNBC cell lines with TAZ stably silenced. For the first time, we observed TAZ gene silencing modified the drug sensitivity of breast cancer cells to EGFRI in a cell context-depended manner. In addition, also for the first time, we found YAP expression could be upregulated both at mRNA and protein levels by TAZ inhibition in certain breast cancer cell line, which leads to the EGFRI resistance. These findings indicate that TAZ/YAP inhibition can significantly improve EGFRI efficacy, which may pave the way for TNBC therapy.

Materials and methods

Cell culture and antibodies

Human breast cancer cell lines (MCF-7, MDA-MB-231, MDA-MB-468, and BT-549) were obtained from American Type Culture Collection. These original cells were routinely cultured at 37°C in the presence of 5% CO2 in RPMI-1640 supplemented with 10% fetal bovine serum (FBS, Hyclone). Cells in the exponential growth phase were used for all experiments. The primary antibodies, anti-YAP, anti-TAZ/YAP, and anti-GAPDH, were purchased from Cell Signaling Technology Inc., and HRP-conjugated secondary antibodies against rabbit from GE Amersham.

Cell lysates preparation and western blot analysis

Briefly, cells were washed twice with phosphate-buffered saline (PBS) and then lysed on ice in RIPA buffer (50 mM Tris-HCl pH 7.4, 1% Nonidet P-40, 0.5% sodium deoxycholate, 150 mM NaCl, 0.02% sodium azide, and 0.1% SDS) containing protease and phosphatase inhibitors (Sigma-Aldrich, St. Louis, MO, USA) for 15 min and cleared of debris by centrifugation at 12,000 rpm for 15 min at 4°C. After boiling with an equal volume of 2X SDS loading buffer for 5 min, cell lysates were electrophoresed with 10% SDS-PAGE and blotted to PVDF membranes (Millipore). The membranes were blotted with 5% non-fat milk in TBS-T (10 mmol/l Tris-HCl pH 7.5, 0.5 mol/l NaCl, and 0.05% w/v Tween-20) buffer at room temperature for 1 h, and then incubated with primary antibodies overnight at 4°C. The membranes were washed and then incubated with suitable peroxidase conjugated secondary antibodies for 1 h at room temperature. After washing three times with TBS-T, antibody binding was visualized using chemiluminescence detection system as described by the manufacturer (Millipore). Molecular weights of the immunoreactive proteins were estimated based on PageRuler Prestained Protein ladder (MBI, Fermentas). Experiments were repeated at least three times.

RNA purification and quantitative reverse transcriptase-PCR (RT-qPCR)

Total RNA was extracted using TRIzol reagent according to the protocol provided by the manufacturer (Invitrogen). RNA concentrations were quantified by NanoDrop 2000 (Nanodrop). Reverse transcription reaction was performed using 2 µg of total RNA with Reverse Transcription System (Promega). The mRNA levels of TAZ and YAP were analyzed using SYBR-Green qPCR Master Mix kit (Promega) in ABI PRISM 7500 fast Sequence Detection System (Applied Biosystems). The real-time qPCR reaction was carried out in triplicate for each sample. The GAPDH gene was used as an endogenous control for normalization and the mRNA levels of TAZ and YAP were determined using the 2−ΔΔCt methods (13). Specific primer pairs are listed in Table I.

Table I

Sequences of primers for real-time qPCR.

Table I

Sequences of primers for real-time qPCR.

NamePrimer sequences
GAPDHF: TGATGACATCAAGAAGGTGGTGAAG
R: TCCTTGGAGGCCATGTGGGCCAT
TAZF: CAGCAATGTGGATGAGATGG
R: AAGGAGGGAGCACGAGTCA
YAPF: GGAACACTGGAAGGAGATGG
R: AGCAATGGACAAGGAAGAGC

[i] F, Forward. R, reverse.

siRNA transfection and lentivirus infection

The small interfering RNAs (siRNAs) against TAZ and YAP were designed and synthesized by GenePharma Inc. (GenePharma) and transfection was done with Lipofectamine™ RNAiMAX (Life Technologies) regent according to the manufacturer's protocol. The regions of the TAZ mRNA (GenBank accession no. NM_001168278) and YAP mRNA (GenBank accession no. NM_006106) were selected as the RNAi target sites. The RNA interfering sequences were 5′-CCGUUUCCCUGAUUUCCUUTT-3′ (sense) for si-TAZ and 5′-GGUGAUACUAUCAACCAAATT-3′ (sense) for si-YAP. BLAST analysis shows no homology of the siRNA sequences to any other sequences in the Human Genome Database. Scrambled siRNA as negative control was also obtained from GenePharma.

To establish stable TAZ knockdown cells (BT-549/sh-TAZ; MDA-MB-231/sh-TAZ), biologically active short hairpin RNA (shRNA) was subcloned into lentiviral vector hU6-MCS-Ubiquitin-EGFP-IRES-puromycin (GV248, Genechem), which carried the transgene for green fluorescent protein (GFP), and used to infect BT-549 and MDA-MB-231 cells. The shRNA target sequence was the same target sequence of the si-TAZ mentioned above. Breast cancer cells were incubated with viral supernatants for 24 h and then returned to normal growth medium. For confirmation of downregulation of TAZ gene, after 72 h cells were harvested and analyzed for reduction of TAZ expression by real-time RT-qPCR and western blot analysis.

Flow cytometry assay

Apoptosis induction in siRNA treated cells was assayed by the detection of membrane externalization of phosphatidylserine using an Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis assay kit (KeyGen Biotech). At 72 h after transfection, cells were harvested and washed with ice-cold PBS twice and resuspended in 500 µl of binding buffer, 5 µl Annexin v-FITC and 5 µl PI were added, and then cells were incubated for 15 min in the dark. Finally, the cells were analyzed within 1 h by flow cytometry.

Cell proliferation assay

Cell proliferation was investigated by colorimetric assay using 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT). In brief, breast cancer cells were seeded in a 96-well flat-bottomed plate at 5×103 cells/well in triplicate. At each experimental point, 0.5 mg/ml MTT (Sigma-Aldrich) was added into the medium and cells were cultured for additional 4 h. Afterwards, the supernatant was removed and the formazan crystals were dissolved in 150 ml dimethyl sulfoxide (DMSO) at room temperature for 15 min. Absorbance of the solution was then measured at 490 nm wavelength using an ELx800 Absorbance Microplate Reader (Biotek). The experiments were performed independently in triplicate.

Chemosensitivity assay

EGFR inhibitor, gefitinib or AG-1478 (Selleckchem) was initially dissolved in DMSO, which was diluted with fresh medium immediately before each experiment. Briefly, BT-549/sh-TAZ or MDA-MB-231/sh-TAZ cells were seeded in a 96-well plate at 5×103 cells/well in triplicate and incubated for 24 h. Then the medium was moved and replaced with the fresh medium containing the drugs with different concentrations. After incubation for another 48 h, the cell viability was examined by the MTT assay.

Colony formation assay

Log-phase cells were seeded in triplicate onto 6-well plates with 2 ml of complete media (500 cells/well) and incubated at 37°C in a humidified incubator. Every week the medium was replaced with fresh medium. After 3 weeks, the colonies were fixed with 100% methanol, stained with 0.1% crystal violet, and washed with PBS. The numbers of colonies were counted using a light microscope.

Statistical analysis

The results were expressed as mean ± standard deviation. Statistical significance was assessed by Student's t-test or one-way ANOVA followed by Bonferroni multiple comparison post-tests. Statistical analyzes were performed using GraphPad Prism v.5.0 package. Differences were considered statistically significant at a level of P<0.05 (shown as *P<0.05; **P<0.01 in the figures).

Results

TAZ expression was upregulated in triple-negative breast cancer cells

The expression of TAZ and YAP was examined by western blotting and RT-qPCR in 4 human breast cancer cell lines. TAZ is preferentially overexpressed in TNBC cells (BT-549, MDA-MB-468, and MDA-MB-231); however, high expression level of YAP was only seen in MDA-MB-231 cells (Fig. 1). These results are consistent with a previous study (14). TAZ is comparably highly expressed in TNBC cells suggesting that it may be correlated with certain characteristics of TNBC (15).

Figure 1

TAZ and YAP expression in four breast cancer cell lines. (A) Expression of TAZ and YAP mRNA was examined by RT-qPCR. (B) Lysates derived from the breast cancer cell lines were analyzed by western blotting using anti-TAZ antibodies; these anti-TAZ antibodies also reacted well with YAP. The levels of GAPDH as detected by anti-GAPDH antibodies were used as loading controls.

sh-TAZ regulates breast cancer cell sensitivity to EGFRI gefitinib and AG-1478

In order to establish breast cancer cells with TAZ stably silenced, we successfully constructed a lentivirus vector harboring shRNA against TAZ. We chose TAZ overexpressing cells, BT-549 and MDA-MB-231, for TAZ knockdown. The knockdown efficiency was evaluated using western blotting and RT-qPCR. The results disclosed that the best knockdown effect was with shRNA at multiplicity of infection (MOI) 30 both in BT-549 and MDA-MB-231 cells. After 72 h post-transfection, >90% of the survived cells were GFP-positive (Fig. 2A–D). RT-qPCR analyses showed that TAZ mRNA levels were significantly reduced when compared with corresponding negative control transfection (Fig. 2E). To correlate the decreases in TAZ mRNA expression with TAZ protein levels, western blot analysis was performed at 72 h after shRNA silencing and showed that TAZ protein levels were also reduced, thereby confirming efficient knockdown (Fig. 2F).

Figure 2

TAZ shRNA lentivirus-silenced TAZ expression in the BT-549 cells and MDA-MB-231 cells. BT-549 (A and C) and MDA-MB-231 cells (B and D) were successfully infected with TAZ shRNA lentivirus at MOI 30 at 72 h; a fluorescence microscope system was used for observing the expression of green fluorescence protein (GFP). Light micrograph (magnification, ×400) (upper panel); fluorescent micrograph (magnification, ×400) (lower panel). (E) TAZ mRNA expression decreased significantly in 72 h post-infection with TAZ shRNA detected by real-time RT-PCR. The data were normalized to the negative control. (F) TAZ protein expression was significantly reduced at 72 h post-infection by immunoblotting.

To investigate the effect of sh-TAZ on EGFRI sensitivity in the breast cancer cells, we treated TAZ shRNA or negative control (NC) shRNA transfected cells with gefitinib or AG-1478 separately and the cell viability curves are shown in Fig. 3A. The silencing of TAZ expression in BT-549 cells resulted in strikingly higher cell growth inhibition at different drug concentrations, with the IC50 of gefitinib being 22.65±3.28 µM in BT-549/sh-TAZ cells, significantly lower than 58.19±3.58 µM in BT-549/NC cells (P=0.002). The same trend was found in AG-1478 treatment, with the IC50 reduced from 18.76±1.52 to 12.52±0.53 µM (P=0.018). In contrast, shRNA-TAZ in MDA-MB-231 cells led to EGFRI resistance, with the IC50 values of gefitinib and AG-1478 in MDA-MB-231/NC cells being 69.27±0.86 and 15.02±0.68 µM, respectively, significantly lower than 79.01±2.54 (P=0.022) and 21.14±0.49 µM (P=0.002) in MDA-MB-231/sh-TAZ cells (Fig. 3B). These results suggest that TAZ inhibition by lentiviral shRNA resulted in enhancement in chemosensitivity of EGFRI in BT-549 cells, but was diminished in MDA-MB-231 cells.

Figure 3

Inhibition of gefitinib or AG-1478 on EGFRI sensitivity in TAZ expression modified BT-549 cells and MDA-MB-231 cells. (A) Inhibition curves of gefitinib and AG-1478 at six different drug concentrations. (B) Knockdown of TAZ in BT-549 cells showed higher sensitivity to gefitinib and AG-1478 as evidenced by lower IC50, but TAZ knockdown induced gefitinib and AG-1478 resistance in MDA-MB-231 cells.

The sh-TAZ led EGFRI resistance in MDA-MB-231 cells was mediated by upregulation of YAP expression

To understand the underlying mechanism of the effect of sh-TAZ on EGFRI sensitivity in the breast cancer cells, we further analyzed the expression change of YAP before and after TAZ knockdown. As shown in Fig. 1, YAP expression in MDA-MB-231 cells was higher than that in MCF-7, but was slight or absent in BT-549 cells. In addition, after TAZ knockdown, the expression of YAP in MDA-MB-231/sh-TAZ cells was markedly elevated both in mRNA and protein levels, which was not seen in BT-549/sh-TAZ cells (Fig. 4).

Figure 4

Knockdown of TAZ in MDA-MB-231 cells induces upregulation of YAP expression both at mRNA and protein levels, but not in BT-549 cells.

In order to study the relationship between YAP expression and EGFRI resistance, we further knocked down YAP in MDA-MB-231/sh-TAZ cells by YAP specific siRNA, and investigated the changes of IC50. The results show that IC50 values of gefitinib and AG-1478 were 79.01±2.54 and 21.14±0.49 µM for MDA-MB-231/sh-TAZ cells, respectively, but IC50 values in TAZ/YAP co-knockdown MDA-MB-231 cells declined to 41.02±1.26 (P<0.01) and 9.98±0.96 µM (P<0.01), respectively (Fig. 5). These results suggest that compared with the MDA-MB-231/sh-TAZ cells, the TAZ/YAP co-knockdown MDA-MB-231 cells restored the EGFRI sensitivity.

Figure 5

Co-knockdown of TAZ and YAP reverses gefitinib and AG-1478 resistance in MDA-MB-231/sh-TAZ cells.

TAZ inhibition affects apoptosis and proliferation of breast cancer cells

To determine whether inhibition of TAZ affected apoptosis and proliferation in breast cancer cells, we performed flow cytometry, cell proliferation curve, and colony forming assays. Flow cytometry showed the cellular apoptosis was significantly increased in the BT-549 cells transfected with TAZ specific siRNA (BT-549/si-TAZ) compared with control, while no significant change was seen in MDA-MB-231/si-TAZ cells, suggesting that si-TAZ induced spontaneous apoptosis in BT-549 cells (Fig. 6). Similarly, cell proliferation curves by MTT assay show that silencing of TAZ gene substantially affected BT-549 cells on proliferation compared with control; however, silencing of TAZ gene slightly promoted cell proliferation in MDA-MB-231 cells (Fig. 7). The colony forming efficiency of the transfected cells was investigated by colony forming assay, and the results show that TAZ-shRNA transfected BT-549 cells had significantly fewer colonies than control, while, on the contrary, MDA-MB-231/sh-TAZ cells showed more colonies than control (Fig. 7).

Figure 6

Effects of TAZ knockdown on apoptosis of BT-549 and MDA-MB-231 cells. Apoptosis was assessed after transfection with TAZ specific siRNA for 48 h. Flow cytometry revealed that knockdown of TAZ by specific siRNA induced apoptosis in BT-549 cells, but not in MDA-MB-231 cells. **P<0.01.

Figure 7

Effects of TAZ knockdown on proliferation of BT-549 and MDA-MB-231 cells The proliferation curves by MTT assay shows the growth rate of BT-549/sh-TAZ cells was inhibited, while that of MDA-MB-231/sh-TAZ cells was increased, compared with negative control and parent cells. Colony forming assay showed that TAZ-shRNA transfected BT-549 cells formed significantly fewer colonies than control, while the MDA-MB-231/sh-TAZ cells showed more colonies than control.

Discussion

The Hippo signaling pathway is a newly discovered and evolutionally conserved signal cascade, which plays a pivotal role in regulating organ size, stem cell pluripotency, and tumorigenesis from Drosophila to mammals (15). Mechanically, when the main downstream effectors TAZ or YAP translocated into the nucleus, they will act as transcription coactivators to promote proliferation-associated gene expression (16). Despite highly conserved sequence and domain organization, TAZ and YAP have their own specific transcription factor partners, and some researchers believe they can hardly compensate each other (17).

Indeed, it has been reported that TAZ expression level was increased in a broad range of different human cancers, such as colorectal, breast, and lung cancers. Moreover, the higher TAZ protein level is always associated with poorly differentiated tumors and shorter patient overall survival (18). In vitro experiments demonstrate that downregulation of TAZ expression not only reduced cancer cell migration and invasion, but also inhibited tumorigenesis in nude mice, while upregulation was able to induce cell malignant transformation (11). Therefore, TAZ is proposed as an oncogene and a potentially attractive therapeutic target for cancer treatment (19).

We have noted that TAZ can induce growth factors to promote independent proliferation of breast cancer cells through activation of its transcription target EGFR ligand AREG, and expression of TAZ and EGFR is positively correlated with the invasiveness of breast cancer cell lines (12). These observations implicate the potential benefit of TAZ knockdown on EGFR targeted therapy. However, no published studies exist focused on this issue in the PubMed, although TAZ mediated Taxol resistance in breast cancer cells have been reported (20).

In this study, we investigated the therapeutic effects of EGFRI on human breast cancer cells overexpressing TAZ. Gefitinib, an EGFRI, has been shown to be highly effective in clinical treatment of certain pathological types of lung cancer, and AG-1478, which is a highly selective EGFRI, has almost no activity on HER2, platelet-derived growth factor receptor (PDGFR), tyrosine kinase receptor (Trk), Bcr-abl or insulin receptor (InsR). Interestingly, BT-549 and MDA-MB-231 cell lines showed different responses to EGFRI treatment when TAZ was silenced, with an increase in chemosensitivity of BT-549/sh-TAZ cells to EGFRI and a decrease in MDA-MB-231/sh-TAZ cells.

Further research found that BT-549 cells expressed a high level of TAZ, but a low level of YAP, and the level of YAP did not increase after TAZ knockdown. By contrast, MDA-MB-231 cells expressed both TAZ and YAP, and the level of YAP significantly increased after TAZ knockdown. In order to identify whether the EGFRI resistance of MDA-MB-231/sh-TAZ cells was caused by increased expression of YAP, we further knocked down the YAP in MDA-MB-231/sh-TAZ cells, and found that the resistance to EGFRI in MDA-MB-231/sh-TAZ cells was reversed.

Previous studies have shown that TAZ may compensate for the loss of YAP functions. Huang et al reported that knockdown of YAP significantly increased EGFRI erlotinib sensitivity in ovarian cancer cell lines that express little or no TAZ (21). In addition, knockdown of YAP in ovarian cancer cell lines that express both YAP and TAZ only led to a very moderate effect on cancer cell growth or drug sensitivity (22,23). Here, we have shown that knockdown of TAZ in breast cancer cell lines that express little or no YAP, such as BT-549 cells, increased EGFRI sensitivity; however, for breast cancer cell lines that express both YAP and TAZ, such as MDA-MB-231 cells, knockdown of TAZ may not help improve sensitivity of EGFRI treatment. These findings indicate YAP may also compensate for the loss of TAZ functions. Therefore, simultaneous inhibition of the functions of TAZ and YAP is needed in some cases.

In conclusion, this study highlights the potential for TAZ to be a therapeutic target in breast cancers, as reducing TAZ levels can partially revert resistance to EGFR inhibitors. In addition, for the first time, we found upregulation of YAP could be induced by TAZ inhibition in a certain breast cancer cell line, which leads to EGFRI resistance. For patients with high expression of both TAZ and YAP, anti-YAP drugs need to be added. Therefore, we propose to develop new therapeutic agents that can simultaneously target TAZ and YAP. We believe that a specific inhibitor to TAZ/YAP combined with anti-EGFR therapy may improve the therapeutic efficacy in TNBC treatment.

Acknowledgments

This study was supported in part by the National Natural Science Foundation of China for the youth (no. 81301809), and the Cultivation of High-level Innovation Health Talents of Zhejiang (grant no. 2012-241).

References

1 

Boyle P and Howell A: The globalisation of breast cancer. Breast Cancer Res. 12(Suppl 4): S72010. View Article : Google Scholar :

2 

Youlden DR, Cramb SM, Yip CH and Baade PD: Incidence and mortality of female breast cancer in the Asia-Pacific region. Cancer Biol Med. 11:101–115. 2014.PubMed/NCBI

3 

Brenton JD, Carey LA, Ahmed AA and Caldas C: Molecular classification and molecular forecasting of breast cancer: Ready for clinical application? J Clin Oncol. 23:7350–7360. 2005. View Article : Google Scholar : PubMed/NCBI

4 

Criscitiello C, Azim HA Jr, Schouten PC, Linn SC and Sotiriou C: Understanding the biology of triple-negative breast cancer. Ann Oncol. 23(Suppl 6): vi13–vi18. 2012. View Article : Google Scholar : PubMed/NCBI

5 

De Laurentiis M, Cianniello D, Caputo R, Stanzione B, Arpino G, Cinieri S, Lorusso V and De Placido S: Treatment of triple negative breast cancer (TNBC): Current options and future perspectives. Cancer Treat Rev. 36(Suppl 3): S80–S86. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Corkery B, Crown J, Clynes M and O'Donovan N: Epidermal growth factor receptor as a potential therapeutic target in triple-negative breast cancer. Ann Oncol. 20:862–867. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Bernsdorf M, Ingvar C, Jörgensen L, Tuxen MK, Jakobsen EH, Saetersdal A, Kimper-Karl ML, Kroman N, Balslev E and Ejlertsen B: Effect of adding gefitinib to neoadjuvant chemotherapy in estrogen receptor negative early breast cancer in a randomized phase II trial. Breast Cancer Res Treat. 126:463–470. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Carey LA, Rugo HS, Marcom PK, Mayer EL, Esteva FJ, Ma CX, Liu MC, Storniolo AM, Rimawi MF, Forero-Torres A, et al: TBCRC 001: Randomized phase II study of cetuximab in combination with carboplatin in stage IV triple-negative breast cancer. J Clin Oncol. 30:2615–2623. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Dickler MN, Cobleigh MA, Miller KD, Klein PM and Winer EP: Efficacy and safety of erlotinib in patients with locally advanced or metastatic breast cancer. Breast Cancer Res Treat. 115:115–121. 2009. View Article : Google Scholar

10 

Hong W and Guan KL: The YAP and TAZ transcription co-activators: Key downstream effectors of the mammalian Hippo pathway. Semin Cell Dev Biol. 23:785–793. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Chan SW, Lim CJ, Guo K, Ng CP, Lee I, Hunziker W, Zeng Q and Hong W: A role for TAZ in migration, invasion, and tumorigenesis of breast cancer cells. Cancer Res. 68:2592–2598. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Yang N, Morrison CD, Liu P, Miecznikowski J, Bshara W, Han S, Zhu Q, Omilian AR, Li X and Zhang J: TAZ induces growth factor-independent proliferation through activation of EGFR ligand amphiregulin. Cell Cycle. 11:2922–2930. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

14 

Cordenonsi M, Zanconato F, Azzolin L, Forcato M, Rosato A, Frasson C, Inui M, Montagner M, Parenti AR, Poletti A, et al: The Hippo transducer TAZ confers cancer stem cell-related traits on breast cancer cells. Cell. 147:759–772. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Pan D: The hippo signaling pathway in development and cancer. Dev Cell. 19:491–505. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Piccolo S, Cordenonsi M and Dupont S: Molecular pathways: YAP and TAZ take center stage in organ growth and tumorigenesis. Clin Cancer Res. 19:4925–4930. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Wang K, Degerny C, Xu M and Yang XJ: YAP, TAZ, and Yorkie: A conserved family of signal-responsive transcriptional coregulators in animal development and human disease. Biochem Cell Biol. 87:77–91. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Harvey KF, Zhang X and Thomas DM: The Hippo pathway and human cancer. Nat Rev Cancer. 13:246–257. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Edgar BA: From cell structure to transcription: Hippo forges a new path. Cell. 124:267–273. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Lai D, Ho KC, Hao Y and Yang X: Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer Res. 71:2728–2738. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Huang JM, Nagatomo I, Suzuki E, Mizuno T, Kumagai T, Berezov A, Zhang H, Karlan B, Greene MI and Wang Q: YAP modifies cancer cell sensitivity to EGFR and survivin inhibitors and is negatively regulated by the non-receptor type protein tyrosine phosphatase 14. Oncogene. 32:2220–2229. 2013. View Article : Google Scholar

22 

Zhang X, George J, Deb S, Degoutin JL, Takano EA, Fox SB, Bowtell DD and Harvey KF; AOCS Study group: The Hippo pathway transcriptional co-activator, YAP, is an ovarian cancer oncogene. Oncogene. 30:2810–2822. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Hall CA, Wang R, Miao J, Oliva E, Shen X, Wheeler T, Hilsenbeck SG, Orsulic S and Goode S: Hippo pathway effector Yap is an ovarian cancer oncogene. Cancer Res. 70:8517–8525. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo L, Zheng J, Zhang J, Wang H, Shao G and Teng L: Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression. Oncol Rep 36: 729-736, 2016.
APA
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., & Teng, L. (2016). Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression. Oncology Reports, 36, 729-736. https://doi.org/10.3892/or.2016.4875
MLA
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., Teng, L."Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression". Oncology Reports 36.2 (2016): 729-736.
Chicago
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., Teng, L."Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression". Oncology Reports 36, no. 2 (2016): 729-736. https://doi.org/10.3892/or.2016.4875
Copy and paste a formatted citation
x
Spandidos Publications style
Guo L, Zheng J, Zhang J, Wang H, Shao G and Teng L: Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression. Oncol Rep 36: 729-736, 2016.
APA
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., & Teng, L. (2016). Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression. Oncology Reports, 36, 729-736. https://doi.org/10.3892/or.2016.4875
MLA
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., Teng, L."Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression". Oncology Reports 36.2 (2016): 729-736.
Chicago
Guo, L., Zheng, J., Zhang, J., Wang, H., Shao, G., Teng, L."Knockdown of TAZ modifies triple-negative breast cancer cell sensitivity to EGFR inhibitors by regulating YAP expression". Oncology Reports 36, no. 2 (2016): 729-736. https://doi.org/10.3892/or.2016.4875
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team