Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
March-2021 Volume 47 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2021 Volume 47 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks

  • Authors:
    • Ye Seon Lim
    • Do-Young Lee
    • Hye-Yoon Kim
    • Yejin Ok
    • Seonyeong Hwang
    • Yuseok Moon
    • Sik Yoon
  • View Affiliations / Copyright

    Affiliations: Department of Anatomy, Pusan National University School of Medicine, Yangsan, Gyeongsangnam‑do 50612, Republic of Korea, Immune Reconstitution Research Center, Medical Research Institute, Pusan National University School of Medicine, Yangsan, Gyeongsangnam‑do 50612, Republic of Korea
    Copyright: © Lim et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 4
    |
    Published online on: December 29, 2020
       https://doi.org/10.3892/ijmm.2020.4837
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Epidermal growth factor‑like domain 8 (EGFL8), a newly identified member of the EGFL family, and plays negative regulatory roles in mouse thymic epithelial cells (TECs) and thymocytes. However, the role of EGFL8 in these cells remains poorly understood. In the present study, in order to characterize the function of EGFL8, genome‑wide expression profiles in EGFL8‑overexpressing or ‑silenced mouse cortical TECs (cTECs) were analyzed. Microarray analysis revealed that 458 genes exhibited a >2‑fold change in expression levels in the EGFL8‑overexpressing vs. the EGFL8‑silenced cTECs. Several genes involved in a number of cellular processes, such as the cell cycle, proliferation, growth, migration and differentiation, as well as in apoptosis, reactive oxygen species generation, chemotaxis and immune responses, were differentially expressed in the EGFL8‑overexpressing or ‑silenced cTECs. WST‑1 analysis revealed that that the overexpression of EGFL8 inhibited cTEC proliferation. To investigate the underlying mechanisms of EGFL8 in the regulation of cTEC function, genes related to essential cellular functions were selected. Reverse transcription‑polymerase chain reaction analysis revealed that EGFL8 knockdown upregulated the expression of cluster differentiation 74 (CD74), Fas ligand (FasL), C‑X‑C motif chemokine ligand 5 (CXCL5), CXCL10, CXCL16, C‑C motif chemokine ligand 20 (CCL20), vascular endothelial growth factor‑A (VEGF‑A), interferon regulatory factor 7 (Irf7), insulin‑like growth factor binding protein‑4 (IGFBP‑4), thrombospondin 1 (Thbs1) and nuclear factor κB subunit 2 (NF‑κB2) genes, and downregulated the expression of angiopoietin‑like 1 (Angptl1), and neuropilin‑1 (Nrp1) genes. Additionally, EGFL8 silencing enhanced the expression of anti‑apoptotic molecules, such as B‑cell lymphoma‑2 (Bcl‑2) and Bcl‑extra large (Bcl‑xL), and that of cell cycle‑regulating molecules, such as cyclin‑dependent kinase 1 (CDK1), CDK4, CDK6 and cyclin D1. Moreover, gene network analysis revealed that EGFL8 exerted negative effects on VEGF‑A gene expression. Hence, the altered expression of several genes associated with EGFL8 expression in cTECs highlights the important physiological processes in which EGFL8 is involved, and provides insight into its biological functions.

Introduction

Thymic epithelial cells (TECs) are key components of the thymic stromal compartment, which creates a specialized microenvironment for the maturation of T cell precursors into mature, immunocompetent cells at various stages of development. TECs are closely associated with developing thymocytes within the thymic microenvironment, playing a crucial role in the attraction, migration, survival, proliferation, differentiation and the selection of thymocytes (1). Histologically, the thymus can be divided into two sub-compartments, the outer cortex and the inner medulla, which hold different populations of TECs and thymocytes undergoing discrete, stepwise maturation. TECs are largely composed of the cortical and medullary types, and serial interactions of TECs with thymocytes, including positive and negative selection of the T cell repertoire, are required for thymocyte development (2).

The age-related involution of the thymus, a major cause of the decreased production of T cells and the subsequent loss of immune function in the elderly, is closely associated with aging of TECs, which is linked to various mechanisms, such as the inhibition of thymopoietic cytokine production (3). Furthermore, TECs play a pivotal role in thymic regeneration. In particular, multiple lines of evidence have indicated that cortical TECs (cTECs) play a key role in the regeneration process of the damaged thymus by producing a variety of factors (4-9). However, the molecular mechanisms underlying thymus regeneration remain largely unknown, although some molecules, including interleukin (IL)-7, keratinocyte growth factor, transforming growth factor-β (TGF-β), insulin-like growth factor-1 (IGF-1), Wnt-4 and IL-22 have been identified thus far (10,11). An enhanced understanding of the process of thymopoietic regulation at a molecular level, particularly the molecular basis of TEC function, is essential for the development and maintenance of a healthy, intact immune system. Therefore, an effective approach is required to identify positive or negative regulatory factors involved in TEC functioning that may aid in developing innovative therapeutic strategies to promote thymus regeneration, which may ultimately lead to the successful treatment of a number of clinical conditions caused by T cell deficiency.

Epidermal growth factor-like domain (EGFL), consisting of 30-40 amino acid residues possessing significant homology to epidermal growth factor (EGF), is an evolutionarily conserved domain present in many vertebrate proteins (12-15). EGFL proteins, characterized by the presence of single or multiple EGFL repeats, are membrane-bound or secreted, and function in several essential cellular activities, such as cell proliferation, differentiation, apoptosis, adhesion, and migration (16,17). Several EGFL family members have been identified, including EGFL2, EGFL3, EGFL5, EGFL6, EGFL7, EGFL8, and EGFL9. Among these, EGFL2, EGFL5 and EGFL9 contain transmembrane domains, whereas EGFL3, EGFL6, EGFL7 and EGFL8 lack these domains, and are secreted into the extracellular environment (17,18).

EGFL8, a newly identified member of the EGFL family, was originally identified as a paralog of EGFL7 using a Basic Local Alignment Search Tool (BLAST) of the mouse genome (19). The expression of EGFL8 has been detected in osteoclasts and osteoblasts (18). Additionally, it has been reported that the EGFL8 expression level is significantly decreased in colorectal and gastric cancer, suggesting that EGFL8 may have a distinct expression pattern and mechanism of action in cancer progression (20,21). Recently, it has been demonstrated that EGFL8 is expressed during T cell development in both TECs and thymocytes and is involved in the suppression of thymocyte differentiation (22,23). Additionally, the overexpression of EGFL8 may exert negative regulatory effects on TECs through the inhibition of thymocyte adherence to TECs and the suppression of the expression of molecules involved in TEC function (22). This finding may facilitate the development of therapeutic strategies for the treatment of immune-mediated diseases associated with T cell abnormalities. However, the precise cellular functions of EGFL8 are not fully understood. A high throughput study may be the most effective, available approach to characterize global changes in gene expression to create an overall picture of cellular function. Therefore, the aim of the present study was to identify novel EGFL8 targets among the induced differentially expressed genes (DEGs), and to discover molecular interaction networks underlying the global effects of EGFL8 using an integrated analysis of gene expression profiles and networks in EGFL8-overexpressing or -silenced cTECs. It is reported herein that EGFL8 is likely to be involved in the regulation of the cell cycle, cell proliferation, differentiation, apoptosis and migration, as well as in immune responses, and may also be an important regulator of vascular endothelial growth factor-A (VEGF-A) gene expression.

Materials and methods

Cell lines and cell culture

The generation, maintenance and functional characterization of 427.1 mouse cTECs, which represent mouse thymic sub-capsular cortex or thymic nurse epithelial cells, were performed as described previously (24), and the cells were kindly provided by The jackson Laboratory. These cell lines constitutively express the class I antigens of the major histocompatibility complex (MHC), and can be induced to express MHC class II antigens upon stimulation with recombinant interferon (IFN)-γ and produce granulocyte-macrophage colony-stimulating factor (GM-CSF) (24). cTECs were cultured and maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 2 mM glutamine (Sigma-Aldrich; Merck KGaA), 100 U/ml penicillin (Gibco; Thermo Fisher Scientific, Inc.), and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37°C in a 5% CO2-enriched atmosphere.

Plasmid constructs and transfection

To construct EGFL8 plasmids, full-length mouse EGFL8 complementary DNA (cDNA) was amplified with total thymic RNA using polymerase chain reaction (PCR) with BamHI and XbaI restriction enzymes, and cloned into a pcDNA3.1 mammalian expression vector (Life Technologies; Thermo Fisher Scientific, Inc.). The PCR-amplified DNA sequence was analyzed by Bionics Co. Ltd., and the presence of any errors in the PCR product, such as point mutations, deletions, insertions and duplications was not detected (data not shown). The cTECs were transfected with 5 µg pcDNA3.1-EGFL8 expression constructs using Lipofectamine™ 2000 reagent (Gibco; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The media were changed after 4-6 h to antibiotic-containing media and incubated at 37°C for a further 48 h.

To construct mouse EGFL8 gene knockdowns, siRNA duplex oligos and scrambled control siRNA with an overhang of dTdT were synthesized by Bioneer Corp. The siRNA sequences for mouse EGFL8 were as follows: 5′-CCA GAG GAG GAU CUU UCA A-3′ (siRNA1), 5′-GGA UCU UUC AAA GAG AGU U-3′ (siRNA2). The cTECs were seeded into 6-well microplates or a 100 mm dish and transfected with 100 pmol of siRNA using Lipofectamine™ 2000 reagent according to the manufacturer's instructions. The media were changed after 4-6 h to antibiotic-containing media and incubated at 37°C; the cTECs were harvested 2 days following siRNA transfection, and EGFL8 knockdown efficiency was confirmed by RT-PCR.

Gene microarray and expression analysis

The effects of the overexpression or knockdown of the mouse EGFL8 gene in cTECs on whole genome expression profiles were investigated using a whole transcript genechip microarray (GeneChip® Mouse Gene 1.0 ST Array; Affymetrix; Thermo Fisher Scientific, Inc.), which has 770,317 distinct 25-mer oligonucleotide probes that represent 28,853 well-annotated mouse genes. Total RNA for microarray analysis was isolated using the RNeasy Mini kit as per the manufacturer's instructions and recommendations (Qiagen, Inc.). Briefly, cells were diced in a mixture of 1.5 ml QG buffer (Qiagen, Inc.) and 2 ml RLT buffer (Qiagen, Inc.). Samples were kept at room temperature until complete dissolution and then stored at -20°C. Defrosted samples were homogenized and supplemented with 2 ml 70% ethanol. RNA quality was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.) with the RNA 6000 Nano Chip (Agilent Technologies, Inc.), and quantified using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, Inc.). Biological triplicates were obtained for each group: Mock pcDNA3.1-vector-transfected cTECs, pcDNA3.1-EGFL8-transfected cTECs, scrambled siRNA-transfected cTECs, and EGFL8 siRNA-transfected cTECs. The labeling and hybridization of total RNA were performed by DNALink Incorporated (Affymetrix-authorized service provider), according to the standard protocol. Global gene expression analysis for each sample was performed using GeneChip® Mouse Gene 1.0 ST Arrays (Affymetrix; Thermo Fisher Scientific, Inc.) as per the recommended manufacturer's protocols. Briefly, 300 ng of total RNA from each sample was converted to double-stranded cDNA. using a random hexamer incorporating a T7 promoter, amplified RNA (cRNA) was generated from the double-stranded cDNA template though an in vitro transcription reaction and purified with the Affymetrix sample cleanup module. cDNA was regenerated through a random-primed reverse transcription using a deoxynucleotide triphosphate (dNTP) mixture containing deoxyuridine triphosphate (duTP) (Promega Corporation). The cDNA was then fragmented by uracil-DNA glycosylase (uDG) and human apurinic/apyrimidinic endonuclease-1 (APE1, also known as HAP1, REF1 and APEX1) and end-labeled using a terminal transferase reaction incorporating a biotinylated dideoxynucleotide (ddNTP). Fragmented end-labeled cDNA was hybridized to the GeneChip® Mouse Gene 1.0 ST arrays for 17 h at 45°C and 60 rpm as described in the Gene Chip Whole Transcript Sense Target Labeling Assay Manual (Affymetrix; Thermo Fisher Scientific, Inc.).

Following hybridization, the microarrays were passed through a wash process and marking was performed by streptavidin-phycoerythrin using the 'GeneChip Fluidics Station 450' (Affymetrix; Thermo Fisher Scientific, Inc.). Subsequently, the microarrays were scanned with 'GeneChip Scanner 3000 7G' (Affymetrix; Thermo Fisher Scientific, Inc.) and images of each sample were obtained. The quality control of these images was performed using the program 'Affymetrix GeneChip Command Console'. Each hybridization was a distinct biological replicate.

Cell proliferation assay

The cTECs were plated into 96-well microplates at 3×104 cells/well in DMEM containing 10% FBS. The cells were left untreated as an untreated control, or transfected with either 5 µg pcDNA3.1-EGFL8 or 100 pmol EGFL8 siRNA2 in antibiotic-free medium using Lipofectamine™ 2000 (Gibco; Thermo Fisher Scientific, Inc.). A rescue experiment was also performed by co-transfection with EGFL8 siRNA2 and pcDNA3.1-EGFL8. After the cells were cultured for 48 h, cell proliferation was determined using the colorimetric WST-1 conversion assay (EZ-Cytox assay kit; Daeil Lab Service). WST-1 reagent (10 µl) was added to each well, after which the cells were incubated for 2 h at 37°C in a humidified atmosphere under 5% CO2. The absorbance of the formazan dye, generated by the reaction between dehydrogenase and WST-1 in metabolically active cells, was measured using a microplate reader (Tecan Group Ltd.) at 450 nm according to the manufacturer's instructions. The percentage cell viability was calculated. Experiments were performed a minimum of 3 times.

RT-PCR

Total RNA was isolated from the cultured cells using TRIzol reagent (Gibco; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The RNA quantity and quality were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Briefly, the samples were transferred into RNA extraction solution (1 ml). The homogenate was then chloroform-extracted, precipitated with isopropanol, washed with ethanol and resuspended in 30 µl of distilled water. The RNA concentration and purity were determined by measuring the absorbance at 260 and 280 nm. Samples exhibited 260/280 absorbance ratios ≥1.9. First-strand cDNA synthesis was performed by reverse transcription using total RNA (2 µg). The reaction was conducted in a 25 µl reaction mixture containing 0.5 µg oligo(dT) 12-18 primer (Promega Corporation), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 40 mM dithiothreitol, 0.5 mM dNTP mixture (Promega Corporation), 10 units RNase inhibitor (Promega Corporation) and 200 units of Moloney murine leukemia virus reverse transcriptase (Promega Corporation). The mixture was incubated at 37°C for 60 min, and the reaction was terminated by heating at 70°C for 5 min. The obtained cDNA was used as a template for PCR amplification using gene-specific primers. The primer sequences are presented in Table I. The PCR amplification of cDNA was performed in an automated thermal cycler (PC-320, Astec, Co. Ltd.) in a final reaction volume of 25 µl containing the following components: 4 µl of cDNA solution, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, 0.2 mM dNTP mixture (Promega Corporation), 0.5 pmol of each primer and 5 units of Taq DNA polymerase (Promega Corporation). All PCR reactions were performed in 22 to 35 cycles at 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec. Amplified products were analyzed by electrophoresis using a 2% agarose gel and visualized by ethidium bromide staining under ultraviolet light. The band intensities of PCR products were quantified and analyzed using an image analysis software (Imagej, version 1.52a, National Institute of Health). The results are expressed as ratios vs. glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA amplified from the same cDNA samples.

Table I

Primer sequences used for RT-PCR in the present study.

Table I

Primer sequences used for RT-PCR in the present study.

Target geneForward primer sequenceReverse primer sequence
Angptl1 ATCCCGACTTGAAATACAACTGC CTGGATGATGAATGTCTGACGAG
CCL20 C GACTGTTGCCTCTCGTACA GAGGAGGTTCACAGCCCTTT
CD74 CGCGACCTCATCTCTAACCAT ACAGGTTTGGCAGATTTCGGA
CXCL5 GCATTTCTGTTGCTGTTCACGCTG CCTCCTTCTGGTTTTTCAGTTTAGC
CXCL10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA
CXCL16 CCTTGTCTCTTGCGTTCTTCC TCCAAAGTACCCTGCGGTATC
FasL TATCAAGGAGGCCCATTTTGC GTTTCCACTTCTAAACCATGCT
IGFBP-4 C AGCGTGCTTGCTAACTTCC TAGAGAACCAGACCCGGAGG
Irf7 TGCTGTTTGGAGACTGGCTAT TCCAAGCTCCCGGCTAAGT
NF-κB2 GGCCGGAAGACCTATCCTACT CTACAGACACAGCGCACACT
Nrp1 TGTAAGCTCGGAAGGGCATC TAACGCCTAGTGCCAGCATC
Thbs1 GCTGCCAATCATAACCAGCG GGTTGTTTGGCGGTGAGTTC
VEGF-A GCACATAGAGAGAATGAGCTTCC CTCCGCTCTGAACAAGGCT
GAPDH ACCACAGTCCATGCCATCAC GGCTACAGCAACAGGGTGGTG

[i] Angptl1, angiopoietin-like 1; CCL20, chemokine (C-C motif) ligand 20; CD74, cluster differentiation 74; CXCL5, C-X-C motif chemokine ligand 5; CXCL10, C-X-C motif chemokine ligand 10; CXCL16, C-X-C motif chemokine ligand 16, FasL, Fas ligand; IGFBP-4, insulin like growth factor binding protein-4; Irf7, Interferon regulatory factor 7; NF-κB2, nuclear factor-κB-2; Nrp1, neuropilin-1; Thbs1, thrombospondin 1; VEGF-A, vascular endothelial growth factor-A; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

The cells were cultured in 100 mm dishes overnight and incubated at 37°C in a 5% CO2-enriched atmosphere with siRNA in antibiotic-free media according to the manufacturer's protocol for Lipofectamine™ 2000 (Gibco; Thermo Fisher Scientific, Inc.). The media were changed after 4-6 h to antibiotic-containing media and incubated at 37°C for a further 48 h. The total proteins were extracted from the cultured cells using a protein extraction solution (Intron Biotechnology, Inc.) supplemented with protease inhibitor mixture (Roche Applied Science). Protein concentrations were measured using the Bradford protein assay kit (Bio-Rad Laboratories, Inc.). A total of 25 µg of equal protein from each sample was electrophoresed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 8-12% (v/v) resolving gel and electroblotted onto a polyvinylidene fluoride membrane (Immobilon-P; EMD Millipore). After blocking for 1 h at room temperature with 3% bovine serum albumin in Tris-buffered saline with 0.1% Tween®-20, the membrane was incubated overnight at 4°C with primary antibodies (diluted at 1:1,000 in 5% BSA) against B-cell lymphoma (Bcl)-2 (sc-7382, Santa Cruz Biotechnology, Inc.), Bcl-xL (2764, Cell Signaling Technology, Inc.), cyclin-dependent kinase 1 (CDK1) (sc-54, Santa Cruz Biotechnology, Inc.), CDK6 (sc-177, Santa Cruz Biotechnology, Inc.), CDK4 (2906, Cell Signaling Technology, Inc.) and cyclin D1 (2922, Cell Signaling Technology, Inc.), and β-actin (sc-47778, Santa Cruz Biotechnology, Inc.). The blots were then incubated with peroxidase-conjugated goat anti-mouse and anti-rabbit secondary antibodies (7076 and 7074, respectively, Cell Signaling Technology) diluted at 1:10,000 in 3% BSA for 1 h at room temperature. Immunoreactivity was detected by the enhanced chemiluminescent substrate kit (Pierce; Thermo Fisher Scientific, Inc.), and images were captured using a LAS-3000 imaging system (Fujifilm) and the band intensities of blot products were quantified and analyzed using Imagej software, version 1.52a.

Microarray data analysis

The intensity values of CEL files were normalized to remove bias between the arrays, using the Robust Multi-array Average (RMA) algorithm implemented in the Affymetrix Expression Console software (v1.3.1) (25). Normalized data were imported into the programming software 'R' (v3.0.2) and overall signal distributions of each array were compared using the Bioconductor Project to verify normalization of the data (26). Thereafter, data were log2-transformed, and differentially expressed genes (DEGs) that exhibited a >2-fold difference between the average signal values of the control and treatment groups were selected manually. Additionally, 'R' was used for the statistical analyses (t-test) on selected DEGs data and genes with P<0.05 were extracted as significant DEGs for further analysis (26). To classify the co-expression of gene groups with similar expression patterns, hierarchical clustering analysis was performed using the Multi Experiment Viewer (v4.4) (27). Finally, using the web-based tool Database for Annotation, Visualization, and Integrated Discovery (DAVID), DEGs were functionally annotated and classified based on the information of gene function, such as OMIM disease, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, and BioCarta databases to elucidate the regulatory networks in which they are involved (28). Fisher's exact test was performed to assess the relevance of the found pathways and determine the significance of the associations of genes to pathways.

Pathway analysis

Pathway Studio software (v7.1; Ariadne Genomics, Inc.) was used to define the cellular networks and interactions among genes expressed in the microarray experiment. This software contains >100,000 regulations, interactions, modifications, and cell process events between proteins and small molecules. An automated text-mining tool, MedScan, enabled the generation of pathways from multiple sources, including the PubMed database and online public sources, such as full text journal and proprietary data sets (literature, experimental, and electronic notebooks) (29). This text information was then converted to biological relationships and imported into the ResNet Mammalian knowledge databases. Thereafter, these associations were used for hypothesis testing, verification and elucidating biological function. Additionally, the gene expression values were visualized and the status in the context of protein interaction networks and pathways were analyzed using Pathway Studio. Gene name were imported into Pathway Studio to identify the cellular processes that were influenced by EGFL8 overexpression or silencing. In the analysis, each identified cellular process was manually curated to identify validated data using the relevant PubMed/Medline hyper-linked abstracts.

Statistical analysis

All data are presented as the means ± standard deviation (SD) of at least 3 independent experiments. For validation experiments using RT-PCR and western blot analysis, control and sample groups were compared using a one-way analysis of variance (ANOVA) followed by a Tukey's post hoc test. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

Modulation of cell proliferation induced by EGFL8 in cTECs

To verify efficient EGFL8 transfection and knockdown, cTECs transfected with pcDNA3.1-EGFL8 or EGFL8 siRNA were analyzed by RT-PCR. EGFL8 mRNA expression was analyzed in EGFL8-overexpressing and -silenced cTECs (Fig. 1A and B). To evaluate the regulatory effects of EGFL8 on cell proliferation, cTECs stably transfected with EGFL8 expression vector or EGFL8 siRNA were cultured for 48 h. As shown in Fig. 1C, cell viability was determined in EGFL8-overexpressing and -silenced cTECs and compared with that of the controls. EGFL8 overexpression reduced cell proliferation, whereas EGFL8 knockdown enhanced cell proliferation (Fig. 1C). Furthermore, it was demonstrated that cTECs were successfully 'rescued' from EGFL8 siRNA-mediated cell proliferation when co-transfected with siRNA and plasmid containing the EGFL8 gene, verifying the selectivity and specificity of the knockdown and overexpression of the EGFL8 gene (Fig. 1C).

Figure 1

Proliferation of mouse cTECs is modulated via EGFL8 overexpression or knockdown. (A) Validation of the knockdown of mouse EGFL8 gene. EGFL8 mRNA expression to confirm EGFL8 knockdown. Relative expression levels of EGFL8 mRNA were plotted for the EGFL8-silenced cells. (B) Validation of the overexpression of mouse EGFL8 gene. EGFL8 mRNA expression to confirm EGFL8 overexpression. Relative expression levels of EGFL8 mRNA were plotted for the EGFL8-overexpressed cells. (C) Overexpression of EGFL8 in cTECs significantly attenuated cell proliferation, whereas EGFL8 knockdown robustly promoted cell proliferation. Co-transfection with the siRNA and plasmid containing the EGFL8 gene successfully rescued cTECs from EGFL8-siRNA mediated cell proliferation. Data were analyzed using one-way ANOVA. *P<0.05, **P<0.01, ***P<0.001 vs. control group; ###P<0.001 vs. siRNA group. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8.

Identification of DEGs induced by EGFL8 overexpression or silencing

Microarray analysis was used to determine the gene expression profiles of EGFL8-overexpressing and -silenced cTECs. RNAs obtained from the pcDNA3.1-EGFL8-, EGFL8 siRNA-transfected cells, and the mock vector- and scrambled siRNA-transfected cells were amplified, fragmented, labeled and hybridized to Affymetrix GeneChip microarrays containing 28,853 gene-level probe sets. From 28,853 probe sets on the GeneChip® Mouse Gene 1.0 ST arrays, 43 genes (>2-fold change, P<0.05) were differentially expressed in the cTECs overexpressing EGFL8 compared to the control cells (Table II). A hierarchical clustering analysis revealed that 10 of these genes were upregulated and 33 were downregulated (Fig. 2A and Table II). Additionally, 390 genes (>2-fold change, P<0.05) were differentially expressed in the EGFL8-silenced cTECs compared to the control cells (Table II). A hierarchical clustering analysis revealed that 192 of these genes were upregulated and 198 were downregulated (Fig. 2B and Table II). Furthermore, 458 genes (>2-fold change, P<0.05) were differentially expressed in the EGFL8-silenced cTECs compared to the EGFL8-overexpressing cells (Table II). A hierarchical clustering analysis showed that 289 of these genes were upregulated and 169 were downregulated (Fig. 2C and Table II).

Figure 2

Identification of differentially expressed genes (DEGs) depicted by a heatmap. (A) DEGs in the pcDNA3.1-EGFL8-transfected vs. the mock-transfected cTECs. (B) DEGs in the EGFL8 siRNA-transfected vs. the scrambled siRNA-transfected cTECs. (C) DEGs in the EGFL8 siRNA-transfected vs. the pcDNA3.1-EGFL8-transfected cTECs. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8.

Table II

Hierarchical clustering analysis of differentially expressed genes profile of epidermal growth factor-like domain 8-overexpressing and -silenced cortical thymic epithelial cells.

Table II

Hierarchical clustering analysis of differentially expressed genes profile of epidermal growth factor-like domain 8-overexpressing and -silenced cortical thymic epithelial cells.

Cell groupUpregulationDownregulationTotal probes
pcDNA3.1 EGFL8 vs. mock103343
EGFL8 siRNA vs. scramble192198390
pcDNA3.1 EGFL8 vs. EGFL8 siRNA289169458
GO analysis of DEGs induced by EGFL8 overexpression or silencing

To investigate the biological significance of DEGs induced by EGFL8 overexpression or silencing in cTECs, KEGG pathway analysis was performed. A total of 8 significantly enriched pathways associated with the DEGs were identified. Among the enriched pathways in the upregulated and downregulated DEGs, cytokine-cytokine interaction, focal adhesion, axon guidance, p53 signaling, endocytosis, pathways in cancer, steroid biosynthesis and terpenoid backbone biosynthesis of TECs were annotated (P<0.05; Table III).

Table III

Kyoto Encyclopedia of Genes and Genomes enrichment analysis of biological pathways.

Table III

Kyoto Encyclopedia of Genes and Genomes enrichment analysis of biological pathways.

KEGG analysisExpressionEnriched geneGene descriptionFold changeP-value
Cytokine-cytokine receptor interactionUpregulatedCxcl10Chemokine (C-X-C motif) ligand 103.7530.009
Cxcl16Chemokine (C-X-C motif) ligand 162.86
Cxcl5Chemokine (C-X-C motif) ligand 52.813
VegfaVascular endothelial growth factor-A2.741
OsmrOncostatin M receptor2.643
FasFas (TNF receptor super family member 6)2.506
InhbeInhibin beta E2.2
DownregulatedPdgfcPlatelet-derived growth factor, C polypeptide2.082
InhbaInhibin beta-A2.535
Figfc-fos induced growth factor2.644
MetMET proto-oncogene2.676
Cxcl12Chemokine (C-X-C motif) ligand 122.705
Il18rapInterleukin 18 receptor accessory protein2.822
Focal adhesionUpregulatedVegfaVascular endothelial growth factor-A2.7410.005
FynFyn proto-oncogene2.066
Ccnd2Cyclin D22.012
DownregulatedCcnd1Cyclin D13.138
PdgfcPlatelet-derived growth factor, C polypeptide2.607
Col3a1Collagen, Type III, alpha 12.353
Thbs1Thrombospondin 12.042
Igf1rInsulin-like growth factor 1 receptor2.082
Cav2Caveolin 22.368
Cav1Caveolin 1, caveolae protein2.676
Figfc-fos induced growth factor2.644
MetMET proto-oncogene2.676
Axon guidanceUpregulatedRnd1Rho family GTPase 12.4770.003
Fyn Fynproto-oncogene2.066
DownregulatedSema7aSema domain, Semaphorin 7A2.040
Sema3cSema domain, Semaphorin 3C2.098
Sema3eSema domain, Semaphorin 3E2.139
MetMET proto-oncogene2.676
Cxcl12Chemokine (C-X-C motif) ligand 122.705
Epha4EPH receptor A42.861
Nrp1Neuropilin 13.669
Sema3dSema domain, Semaphorin 3D4.986
p53 signaling pathwayUpregulatedGadd45aGrowth arrest and DNA-damage-inducible 45 alpha4.0740.02
FasFas (TNF receptor super family member 6)2.506
Sesn2Sestrin 22.338
Ccnd2Cyclin D22.012
DownregulatedCcnd1Cyclin D12.042
Thbs1Thrombospondin 12.334
EndocytosisUpregulatedPip5k1b Phosphatidylinositol-4-phosphate 5-kinase, type 1 beta2.2080.039
H2-K1Histocompatibility 2, K1, K region2.1
H2-Q6Histocompatibility 2, Q region locus 62.05
DownregulatedIgfl1rInsulin like growth factor 1 receptor2.368
Adrb2Adrenergic receptor, beta 22.481
Hspa1aHeat shock protein 1A2.572
Ehd2EH domain containing 22.607
MetMET proto-oncogene2.676
TfrcTransferrin receptor2.736
LdlrLow density liproprotein receptor4.541
Pathways in cancerUpregulatedFgf21Fibroblast growth factor 213.1380.002
Nos2Nitric oxide synthase 2, inducible3.097
VegfaVascular endothelial growth factor-A2.741
Rb1Retinoblastoma 12.607
FasFas (TNF receptor superfamily member 6)2.506
Nfkb2Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p1002.478
Fzd4Frizzled homolog 4 (Drosophila)2.368
Mitf Microphthalmia-associated transcription factor2.353
Brca2Breast cancer 22.238
Stat1Signal transducer and activator of transcription 12.171
DownregulatedCcdn1Cyclin D12.042
JupJunction plakoglobin2.14
Igf1rInsulin like growth factor 1 receptor2.368
Bmp4Bone morphogenetic protein 42.637
Figfc-fos-induced growth factor2.644
MetMET proto-oncogene2.676
FosFos proto-oncogene3.391
Steroid biosynthesisUpregulatedSoat2Sterol O-acyltransferase 23.3950.000
DownregulatedSqleSqualene epoxidase2.040
Fdft1 Farnesyl-diphosphate farnesyltransferase 12.182
Hsd17b7Hydroxysteroid 17-beta dehydrogenase 72.468
Dhcr7 7-dehydrocholesterol reductase2.520
NsdhlNAD(P) dependent steroid dehydrogenase-like2.917
Cyp51Cytochrome P450, family 513.040
Dhcr24 24-Dehydrocholesterol reductase3.383
Terpenoid backbone biosynthesisUpregulated---0.000
DownregulatedHmgcr 3-Hydroxy-3-methylglutaryl-CoA reductase2.002
Acat2Acetl-CoA acetyltransferase 22.257
MvdMevalonate (diphospho) decarboxylase2.732
Idi1 Isopentenyl-diphosphate delta isomerase 13.507
Hmgcs1 3-Hydroxy-3-methylglutaryl-CoA synthase 13.797

Furthermore, genes were categorized based on the GO analysis, illustrated in Fig. 3. The functions of DEGs were characterized using GO terms. GO was was utilized to investigate the nature of the EGFL8-associated genes identified by microarray data analyses. Fisher's exact test with P<0.05 and gene frequency (gene count assigned to an annotation term) of >2% was set as the threshold to select over-represented GO biological processes. Enrichment in the processes of cell proliferation, differentiation, adhesion, cycle and migration, as well as in the regulation of immune responses and transcription was noted.

Figure 3

Functional categorization of genes up- or downregulated in EGFL8-overexpressing or -silenced cTECs. (A) Cell proliferation, (B) cell differentiation, (C) cell adhesion, (D) cell cycle, (E) cell migration, (F) immune response, and (G) regulation of transcription. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8.

Validation of DEGs induced by EGFL8 knockdown

To confirm the results of microarray analysis, the expression patterns of genes associated with cell proliferation were evaluated in EGFL8 siRNA-transfected cTECs. The FasL, CXCL10 and CXCL16 genes were selected on the basis of their potential role in cell proliferation and adhesion. As shown in Fig. 4, EGFL8 knockdown upregulated the expression levels of FasL, CXCL5, CXCL10, CXCL16 and CCL20, whereas it downregulated those of Nrp1 in cTECs.

Figure 4

Mouse cTECs were transfected with EGFL8 siRNA; EGFL8 knockdown increased the expression of (A) FasL and Nrp1 and (B) CXCL5, CXCL10, CXCL16 and CCL20. Data were analyzed using one-way ANOVA. *P<0.05, **P<0.01, ***P<0.001. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8; FasL, Fas ligand; Nrp1, neuropilin-1; CXCL, C-X-C motif chemokine ligand; CCL20, chemokine ligand 20.

In the present study, the potential role of EGFL8 in angiogenesis was evaluated. As shown in Fig. 5, EGFL8 knockdown reduced the expression levels of Angptl, whereas it augmented those of VEGF-A, CD74 and NF-κB2 in the cTECs. Furthermore, it was found that EGFL8 knockdown promoted the gene expression of IGFBP-4, Thbs1 and Irf7 in cTECs (Fig. 6).

Figure 5

Mouse cTECs were transfected with EGFL8 siRNA; EGFL8 knockdown (A) suppressed the gene expression of Angptl1 but augmented that of VEGF-A, CD74, and (B) nuclear factor κB subunit 2 (NF-κB2). Data were analyzed using one-way ANOVA. *P<0.05, **P<0.01, ***P<0.001. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8; Angptl1, angiopoietin-like 1; VEGF-A, vascular endothelial growth factor-A; CD74, cluster differentiation 74; NF-κB2, nuclear factor κB subunit 2.

Figure 6

Mouse cTECs were transfected with EGFL8 siRNA and EGFL8 knockdown upregulated the expression levels of IGFBP-4, Thbs1 and Irf7. Data were analyzed using one-way ANOVA. **P<0.01, ***P<0.001. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8; IGFBP-4, insulin-like growth factor binding protein-4; Thbs1, thrombospondin 1; Irf7, interferon regulatory factor 7.

To determine the effects of EGFL8 on the expression of apoptosis- and cell cycle-related proteins, EGFL8 siRNAs were stably transfected into cTECs. Differential protein expression levels of Bcl-2, Bcl-xL, CDK1, CDK4, CDK6 and cyclin D1 were observed for the EGFL8-silenced cTECs. As shown in Fig. 7, EGFL8 knockdown increased the expression of apoptosis-related molecules, Bcl-2 and Bcl-xL in the cTECs. Additionally, EGFL8 knockdown enhanced the expression of the key cell cycle regulatory molecules, CDK1, CDK4, CDK6 and cyclin D1 proteins in the cTECs (Fig. 8).

Figure 7

Mouse cTECs were transfected with EGFL8 siRNA showing that EGFL8 knockdown increased the expression levels of apoptosis-related molecules Bcl-2 and Bcl-xL. Data were analyzed using one-way ANOVA. *P<0.05, **P<0.01, ***P<0.001. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8.

Figure 8

Mouse cTECs were transfected with EGFL8 siRNA; EGFL8 knockdown increased the expression of cell cycle regulatory proteins, CDK1, CDK4, CDK6, and cyclin D1. Data were analyzed using one-way ANOVA. ***P<0.001. cTECs, cortical thymic epithelial cells; EGFL8, epidermal growth factor-like domain 8; CDK, cyclin-dependent kinase.

Interaction network analysis of DEGs induced by EGFL8 overexpression or silencing in cTECs

To further investigate the key pathways utilized by the identified DEGs, the analysis of multi-genic pathways depicting possible molecular interactions that define biologic activities based on related sets of DEGs was performed and visualized using Pathway Studio software. In-depth literature mining with Pathway Studio revealed that a high percentage of the EGFL8-associated genes are involved in cell proliferation (20%), apoptosis (19%), differentiation (15%), growth (12%), migration (10%), immune response (7%), cell cycle (7%), reactive oxygen species (ROS) generation (7%) and chemotaxis (3%) (Fig. 9). These are biological processes that regulate crucial cellular functions, and whose deregulation is commonly observed in diseases. Biological networks of all known associations and potential interactions between the DEGs are shown in Fig. 10. A possible gene network using the 344 genes mapped by the algorithms 'expression' and 'regulation' to filter the associations from 458 total genes that were differentially expressed between the EGFL8-overexpressing and -silenced cTECs was identified. The associations of the mapped DEGs were linked to each other based on previously published literature. DEGs that share associations were displayed in the network and unlinked genes were excluded from it (Fig. 10). Pathway analysis depicted the expression pattern of upregulated and downregulated genes in EGFL8-overexpressing or -silenced cTECs. In the extracellular region, the expression of CCL20, IGFBP4, lipocalin 2 (LCN2) and carbonic anhydrase VI (CA6) was upregulated, whereas that of Sema3D, Angpt1 and prolactin family 2 subfamily c member 3 (Prl2c3) was downregulated (Fig. 10). In the plasma membrane, the expression of CD74 and solute carrier family 7 member 11 (SLC7A11) was upregulated, whereas that of aquaporin 1 (AQP1) was downregulated (Fig. 10). In the cytoplasmic region, the expression of cytochrome b5 reductase 2 (CYB5R2) and ubiquitin specific peptidase 18 (uSP18) was upregulated, whereas that of SH2 domain-containing protein 1B (SH2D1B) was downregulated (Fig. 10). In the nuclear region, the expression of activating transcription factor 3 (ATF3) was upregulated (Fig. 10). KEGG, GO and Pathway Studio analyses of DEGs associated with EGFL8 modulation in cTECs revealed 2 overlaps of enriched pathways involved in the cell cycle regulation and immune responses (Fig. 11).

Figure 9

Classification of biological processes of EGFL8-associated genes. EGFL8, epidermal growth factor-like domain 8.

Figure 10

Proposed biological network of EGFL8-associated DEGs. A schematic representation of upregulated (red) and downregulated (blue) genes that share links within the DEGs is shown. EGFL8, epidermal growth factor-like domain 8; DEGs, differentially expressed genes.

Figure 11

Comparison of 3 enrichment analyses showing overlapping enrichment for the pathways related to cell cycle and immune response.

In a second analysis, 'network connectivity' was examined to identify genes that are highly linked to the proteins regulated by EGFL8 (i.e., to identify a common node). As a result, 49 genes were found to be nodes having a connectivity >1,000. The nodes having connectivity a >4,000 are listed in Table IV. Notably, VEGF-A, was determined to be the node with the highest degree of connectivity (15,004) between the EGFL8-associated genes (Fig. 12).

Figure 12

Proposed protein relations among proteins encoded by EGFL8 and VEGF-A. A schematic representation of the connectivity is shown where upregulation is depicted in red and downregulation is depicted in blue.

Table IV

Epidermal growth factor-like domain 8-associated gene network connectivity. Top 11 nodes with more than 4000 connectivity.

Table IV

Epidermal growth factor-like domain 8-associated gene network connectivity. Top 11 nodes with more than 4000 connectivity.

Gene nameGene symbolConnectivity
Vascular endothelial growth factor-AVEGF-A15,004
Cyclin D1CCND16,846
FBJ murine osteosarcoma viral oncogene homologFOS6,527
Heat shock protein family A (Hsp70) member 1AHSPA1A6,480
Nerve growth factorNGF5,940
Vascular cell adhesion molecule 1VCAM14,869
C-X-C motif chemokine ligand 12CXCL124,860
Caveolin 1CAV14,702
Signal transducer and activator of transcription 1STAT14,401
Insulin like growth factor 1 receptorIGF1R4,140
C-X-C motif chemokine ligand 10CXCL104,080

Discussion

cTECs play a central role in physiological T cell development and thymopoiesis during regeneration from thymic involution, which leads to T cell depletion (4,30). In the present study, microarray analysis was applied to identify candidate genes responsible for EGFL8-regulated cellular functions in TECs using the gain- and loss-of function mutations of EGFL8. The findings of this study corroborate the hypothesis that EGFL8 can serve as a key molecule regulating several fundamental functions of cTECs, such as cell proliferation and signaling.

The results presented in the present study identified genes that are differentially expressed based on statistical evaluations of the manipulation of EGFL8 expression levels in cTECs. Notably, the present study provided direct evidence for the involvement of EGFL8 in the inhibition of TEC proliferation. The mechanisms underlying the suppressed cell proliferation induced by EGFL8 may be attributed to the inhibition of cell cycle progression and induction of apoptosis as EGFL8 knockdown elevated expression levels of important cell cycle regulatory molecules, such as CDK1, CDK4, CDK6 and cyclin D1. Additionally, the expression of the anti-apoptotic genes, Bcl-2 and Bcl-xL, was increased. Furthermore, the present study demonstrated that EGFL8 significantly modulated the expression of genes related to the following: i) Regulatory factors of T cell development, such as, FasL, Nrp1, IGFBP-4 and Thbs1; ii) T cell chemotactic migration, such as CCL20, CXCL5, CXCL10 and CXCL16; iii) Important transcription factors, such as Irf7 and NF-κB2; and iv) Angiogenic factors, such as Angptl1, ANGPT1, CD74 and VEGF-A.

TECs express a variety of proteins that regulate T cell survival, proliferation and maturation in the thymus. Among these, FasL (CD95L/APO-1L), a TNF family member, plays a functional role in the proliferation of activated T cells. The cross-linking of FasL in CD8+ T cells is required for maximal cellular proliferation in vivo (31). In the present study, the silencing of EGFL8 gene expression with EGFL8-specific siRNA upregulated the expression level of FasL in cTECs. A previous study demonstrawted that EGFL8 significantly inhibited the expression of IL-7 in TECs (22). FasL plays a direct regulatory role through IL-7 activation, which increases its efficacy to induce proliferation of sub-optimally activated T cells (32). Thus, it was hypothesized that the EGFL8-induced changes in FasL expression levels in cTECs may be implicated in the regulation of proliferation of T cell precursors.

Nrp1 is a non-tyrosine kinase trans-membrane glycoprotein and is a high-affinity receptors for semaphorins on the cell membrane (33). Semaphorin signaling plays an important role in focal adhesion assembly/disassembly and induces cytoskeletal remodeling, thereby affecting cell shape, attachment to the extracellular matrix, cell motility, and cell migration (34,35). Sema3D and Nrp1 are expressed in the thymus, and Sema7A is expressed by thymocytes, predominantly in immature CD4+CD8+ and mature CD4−CD8− subsets (36,37). It has been reported that the expression of Nrp1 increases with age and Nrp1 may play a significant role in the regulation of thymic involution (35,37). However, the exact role of Nrp1 in the thymus function requires further investigation.

Chemokines, the largest family of cytokines in human immunophysiology, are involved in recruiting lymphocytes, neutrophils, and macrophages during an immune response, thereby functioning as signaling proteins of the immune system (38). CXCL10 (IP-10), a small pro-inflammatory chemotactic polypeptide, is associated with recruiting T cell precursors to the thymus (39). CXCL16 promotes lymphocyte adhesion to epithelial cells through integrin-mediated signaling (40). The chemokine ligand CCL20 is expressed in various types of epithelial cells, including TECs (41). CC chemokine receptor 6 (CCR6), the specific chemokine receptor of CCL20, is expressed by T cells, and the CCL20/CCR6 axis is involved in the migration of CCR6+ T cells (42). Additionally, there is evidence to suggest that CXCL5 is linked to immune cell recruitment (43). A previous study using CXCL5-deficient mice demonstrated that the expression levels of NF-κB, mitogen-activated protein kinase (MAPK) and intercellular adhesion molecule-1 (ICAM-1) were reduced in the lungs during exposure to secondhand smoke (43). In the present study, it was demonstrated that EGFL8 knockdown upregulated the expression of CXCL5. In a previous study, it was demonstrated that EGFL8 significantly inhibited the adhesion of thymocytes to TECs through the attenuation of ICAM-1 expression therein (22). Hence, it is possible that EGFL8 inhibits the adhesion of thymocytes to TECs by downregulating the expression of chemokines, including CXCL5, which in turn leads to diminished production of ICAM-1 in TECs. Overall, the current results indicate that EGFL8 knockdown augments the expression of CXCL5, CXCL10, CXCL16 and CCL20. This suggests the important role of EGFL8 in cTECs for the recruitment of T cell precursors to the thymus and for TEC-thymocyte interactions via attenuation of chemokine production.

The results of the present study demonstrating that the expression of Angptl1 was decreased in EGFL8-silenced TECs, and vice versa for VEGF-A, CD74, and NF-κB2 suggest that EGFL8 affects angiogenesis by modulating the expression of Angptl1, VEGF-A, CD74 and NF-κB2. Angptl1 (also known as angioarrestin), a key anti-angiogenic protein, is essential for the regulation of VEGF-A, which is a key signaling protein that stimulates vasculogenesis and angiogenesis (44). CD74 is an integral membrane protein that functions as an MHC class II chaperone, and an accessory-signaling molecule with a distinct role in angiogenesis and inflammation by binding to the pro-inflammatory cytokine, macrophage migration-inhibitory factor (45,46). NF-κB is a pleiotropic transcription factor present in the majority of cell types and is the endpoint of a series of signal transduction events that are initiated by numerous stimuli related to inflammation, immunity, cell differentiation, growth, adhesion, apoptosis and tumorigenesis. It has been shown that NF-κB2 is involved in the upregulation of VEGF mRNA (47).

IGFBP-4 binds and titrates IGF-2 away from the IGF receptor, thereby inhibiting IGF-2 signaling, which reduces apoptosis via the activation of the phosphoinositide 3-kinase/protein kinase B (PI3K/Akt) and MAPK pathways (48). Thbs1 has been suggested to participate in TEC-thymocyte interaction, which is involved in the differentiation of thymocytes into mature T cells (49). Irf7 is essential for the development of TECs and maintenance of thymic architecture through interferon α/β receptor subunit 1 (IFNAR1) and signal transducer and activator of transcription 1 (STAT1) signaling (50). The results of the present study suggest that EGFL8 may be involved in several fundamental processes of cTECs, including survival, proliferation, and adhesion by regulating the expression of IGFBP-4, Irf7 and Thbs1.

The interaction network analysis performed using Pathway Studio software also mapped signaling pathways associated with cell cycle, proliferation, growth, differentiation, and migration, as well as apoptosis, ROS generation, chemotaxis and immune response, supporting the results of KEGG and GO analyses. Overall, the results of the present study demonstrated that DEGs induced by elevated or silenced EGFL8 expression in cTECs play a role in cell proliferation, apoptosis, differentiation, growth, migration and immune response, which are critical to the physiology of cTECs. Moreover, pathway analysis revealed the putative network of DEGs and their localization within the cell. This analysis demonstrated that DEGs of cell surface receptors in the plasma membrane, signal transduction molecules in the cytosol, transcription factors in the nucleus, and DEGs of the extracellular fluid may lead to the discovery of unique signaling molecular mechanisms underlying EGFL8 function.

Microarray data permits the cataloging of a multitude of genes that are differentially expressed, and identifies nodes that are highly linked to the proteins regulated by EGFL8. Notably, a salient feature of the present study was that VEGF-A exhibited the highest degree of connectivity among all nodes in the gene network analysis of DEGs induced by EGFL8 and Angpt1 also exhibited a high degree of connectivity (1,867 connectivity). VEGF-A is the most well-characterized member of the VEGF family, being the most potent stimulator of angiogenic processes. ANGPT1 exhibits potent vascular protective effects and can repress VEGF-induced angiogenesis (51,52).

These results were supported by DEG analysis in which VEGF-A expression was upregulated in EGFL8-silenced TECs and downregulated in EGFL8-overexpressing TECs, whereas Angpt1 expression was downregulated in EGFL8-silenced TECs and upregulated in EGFL8-overexpressing TECs. These findings provide compelling evidence that EGFL8 may play an important anti-angiogenic role. However, it is necessary to define the expression and function of EGFL8 in various processes of angiogenesis or vasculogenesis.

The activity of EGFL8 through autocrine or paracrine mechanism in TECs and other cell types remains uncertain. However, structural analysis of the EGFL8 protein predicted that it is secretory (18). In a previous study by the authors, to investigate the functional role of EGFL8 in TECs, TECs were transfected with an EGFL8-expressing vector to overexpress EGFL8 protein and with an EGFL8 siRNA to knockdown EGFL8 expression (22). EGFL8-silenced TECs exhibited a significant increase in the number of adherent thymocytes by enhancing the expression of ICAM-1, while the overexpression of EGFL8 inhibited the adherence of TECs to thymocytes by suppressing ICAM-1 expression (22). Furthermore, in vitro co-culture experiments revealed that EGFL8 knockdown facilitated the maturation of thymocytes to CD4+ and CD8+ single-positive populations (22). These regulatory effects of EGFL8 in T cell development were further confirmed by the results that EGFL8 knockdown enhanced the expression of genes involved in thymopoiesis, such as IL-7, GM-CSF, and thymus-expressed chemokine (TECK). These data indicate that EGFL8 exerts inhibitory effects on TECs and thymocytes, suggesting that EGFL8 is a secreted protein and possibly modulates gene expression via a paracrine, autocrine or both mechanism(s). In addition, it was reported that, in an in vitro study, recombinant EGFL8 (rEGFL8) protein inhibited thymocyte proliferation and induced apoptosis and, in an in vivo study, rEGFL8 injection into mice resulted in a decreased thymic mass, and total number of thymocytes (23).

In conclusion, the ability to manipulate the activity of TECs is important for deciphering the underlying mechanisms governing T cell development, and developing approaches to regenerate the thymus after thymic involution induced by age, ablative therapies, or viral infection to boost new T cell production. The present study demonstrated that EGFL8 inhibited the proliferation of cTECs and provides new insight into its underlying molecular mechanisms. Furthermore, gene expression profiling of cTECs by the overexpression or silencing of EGFL8 led us to identify molecular signatures associated with the function of EGFL8 gene. The microarray results suggested that EGFL8 may be implicated in diverse cellular processes in cTECs (Fig. 13). A strong associatoin was found between EGFL8-associated genes and diverse physiological processes, including cell cycle, proliferation, growth, migration, and differentiation, as well as apoptosis, ROS generation, chemotaxis, and immune responses. Additionally, VEGF-A acts as a pivotal hub among genes connected with EGFL8. Therefore, the data obtained from the present study strongly suggests that EGFL8 functions as a regulator of various important physiologic processes in cTECs, and during angiogenesis. Further studies on the roles of the identified genes are necessary to understand the molecular mechanisms underlying EGFL8-mediated cell behavior.

Figure 13

Molecular targets of EGFL8 and their potential functions. EGFL8 may be involved in the regulation of immune responses, cell cycle, cell growth, differentiation, adhesion, migration, proliferation, and transcription regulation via modulation of the expression of diverse genes essential for cellular functions.

Funding

The present study was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MEST) (no. 2020R1A2C1004529).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YSL, DYL, YM and SY contributed to the conception and design of the study. YSL, DYL, HYK, YO and SH performed all experiments and verified the analytical data. YM contributed to the interpretation of the results. SY supervised the experiments in discussion with YSL, DYL, YO and SH. YSL, DYL and SY wrote the manuscript. YSL contributed to the revision of the manuscript. All authors discussed the final results and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

Not applicable.

References

1 

Hun M, Barsanti M, Wong K, Ramshaw J, Werkmeister J and Chidgey AP: Native thymic extracellular matrix improves in vivo thymic organoid T cell output, and drives in vitro thymic epithelial cell differentiation. Biomaterials. 118:1–15. 2017. View Article : Google Scholar

2 

Tajima A, Pradhan I, Trucco M and Fan Y: Restoration of thymus function with bioengineered thymus organoids. Curr Stem Cell Rep. 2:128–139. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Andrew D and Aspinall R: Age-Associated thymic atrophy is linked to a decline in IL-7 production. Exp Gerontol. 37:455–463. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Yoon S, Yoo YH, Kim BS and Kim JJ: Ultrastructural alterations of the cortical epithelial cells of the rat thymus after cyclophosphamide treatment. Histol Histopathol. 12:401–413. 1997.PubMed/NCBI

5 

Yoon S, Lee HW, Baek SY, Kim BS, Kim JB and Lee SA: upregulation of TrkA neurotrophin receptor expression in the thymic subcapsular, paraseptal, perivascular, and cortical epithelial cells during thymus regeneration. Histochem Cell Biol. 119:55–68. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Lee HW, Kim BS, Kim HJ, Lee CW, Yoo HJ, Kim JB and Yoon S: Upregulation of receptor activator of nuclear factor-kappaB ligand expression in the thymic subcapsular, paraseptal, perivascular, and medullary epithelial cells during thymus regeneration. Histochem Cell Biol. 123:491–500. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Lee HW, Kim SM, Shim NR, Bae SK, Jung IG, Kwak JY, Kim BS, Kim JB, Moon JO, Chung JS and Yoon S: Expression of nerve growth factor is upregulated in the rat thymic epithelial cells during thymus regeneration following acute thymic involution. Regul Pept. 141:86–95. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Park HJ, Kim MN, Kim JG, Bae YH, Bae MK, Wee HJ, Kim TW, Kim BS, Kim JB, Bae SK and Yoon S: Up-Regulation of VEGF expression by NGF that enhances reparative angiogenesis during thymic regeneration in adult rat. Biochim Biophys Acta. 1773:1462–1472. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Kim YM, Kim HK, Kim HJ, Lee HW, JU SA, Choi BK, Kwon BS, Kim BS, Kim JB, Lim YT and Yoon S: Expression of 4-1BB and 4-1BBL in thymocytes during thymus regeneration. Exp Mol Med. 41:896–911. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Awong G, LaMotte-Mohs R and Zúñiga-Pflücker JC: Key players for T-cell regeneration. Curr Opin Hematol. 17:327–332. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Boehm T and Swann JB: Thymus involution and regeneration: Two sides of the same coin? Nat Rev Immunol. 13:831–838. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Downing AK, Knott V, Werner JM, Cardy CM, Campbell ID and Handford PA: Solution structure of a pair of calcium-binding epidermal growth factor-like domains: Implications for the marfan syndrome and other genetic disorders. Cell. 85:597–605. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Hohenester E and Engel J: Domain structure and organisation in extracellular matrix proteins. Matrix Biol. 21:115–128. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Takahama Y: Journey through the thymus: Stromal guides for T-cell development and selection. Nat Rev Immunol. 6:127–135. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Koeppe JR, Beach MA, Baerga-Ortiz A, Kerns SJ and Komives EA: Mutations in the fourth EGF-like domain affect thrombomodulin-induced changes in the active site of thrombin. Biochemistry. 47:10933–10939. 2008. View Article : Google Scholar : PubMed/NCBI

16 

Singh AB and Harris RC: Autocrine, paracrine and juxtacrine signaling by EGFR ligands. Cell Signal. 17:1183–1193. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Chim SM, Tickner J, Chow ST, Kuek V, Guo B, Zhang G, Rosen V, Erber W and Xu J: Angiogenic factors in bone local environment. Cytokine Growth Factor Rev. 24:297–310. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Chim SM, Qin A, Tickner J, Pavlos N, Davey T, Wang H, Guo Y, Zheng MH and Xu J: EGFL6 promotes endothelial cell migration and angiogenesis through the activation of extracellular signal-regulated kinase. J Biol Chem. 286:22035–22046. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Fitch MJ, Campagnolo L, Kuhnert F and Stuhlmann H: Egfl7, a novel epidermal growth factor-domain gene expressed in endothelial cells. Dev Dyn. 230:316–324. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Wu F, Shirahata A, Sakuraba K, Kitamura Y, Goto T, Saito M, Ishibashi K, Kigawa G, Nemoto H, Sanada Y and Hibi K: Down-Regulation of EGFL8: A novel biomarker for advanced gastric cancer. Anticancer Res. 31:3377–3380. 2011.PubMed/NCBI

21 

Wu F, Shirahata A, Sakuraba K, Kitamura Y, Goto T, Saito M, Ishibashi K, Kigawa G, Nemoto H, Sanada Y and Hibi K: Down-Regulation of EGFL8: A novel prognostic biomarker for patients with colorectal cancer. Anticancer Res. 31:2249–2254. 2011.PubMed/NCBI

22 

Choi HJ, Yoon TD, Muhammad I, Jeong MH, Lee J, Baek SY, Kim BS and Yoon S: Regulatory role of mouse epidermal growth factor-like protein 8 in thymic epithelial cells. Biochem Biophys Res Commun. 425:250–255. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Subhan F, Yoon TD, Choi HJ, Muhammad I, Lee J, Hong C, Oh SO, Baek SY, Kim BS and Yoon S: Epidermal growth factor-like domain 8 inhibits the survival and proliferation of mouse thymocytes. Int J Mol Med. 32:952–958. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Faas SJ, Rothstein JL, Kreider BL, Rovera G and Knowles BB: Phenotypically diverse mouse thymic stromal cell lines which induce proliferation and differentiation of hematopoietic cells. Eur J Immunol. 23:1201–1214. 1993. View Article : Google Scholar : PubMed/NCBI

25 

Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U and Speed TP: Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 4:249–264. 2003. View Article : Google Scholar : PubMed/NCBI

26 

Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, et al: Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R802004. View Article : Google Scholar : PubMed/NCBI

27 

Eisen MB, Spellman PT, Brown PO and Botstein D: Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 95:14863–14868. 1998. View Article : Google Scholar : PubMed/NCBI

28 

Sherman BT, Huang da W, Tan Q, Guo Y, Bour S, Liu D, Stephens R, Baseler MW, Lane HC and Lempicki RA: DAVID Knowledgebase: A gene-centered database integrating heterogeneous gene annotation resources to facilitate high-throughput gene functional analysis. BMC Bioinformatics. 8:4262007. View Article : Google Scholar : PubMed/NCBI

29 

Yuryev A, Mulyukov Z, Kotelnikova E, Maslov S, Egorov S, Nikitin A, Daraselia N and Mazo I: Automatic pathway building in biological association networks. BMC Bioinformatics. 7:1712006. View Article : Google Scholar : PubMed/NCBI

30 

Shakib S, Desanti GE, Jenkinson WE, Parnell SM, Jenkinson EJ and Anderson G: Checkpoints in the development of thymic cortical epithelial cells. J Immunol. 182:130–137. 2009. View Article : Google Scholar

31 

Suzuki I, Martin S, Boursalian TE, Beers C and Fink PJ: Fas ligand costimulates the in vivo proliferation of CD81+ T Cells. Immunol. 165:5537–5543. 2000. View Article : Google Scholar

32 

Rethi B, Vivar N, Sammicheli S, Fluur C, Ruffin N, Atlas A, Rajnavolgyi E and Chiodi F: Priming of T cells to fas-mediated proliferative signals by interleukin-7. Blood. 112:1195–1204. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Geretti E, Shimizu A and Klagsbrun M: Neuropilin structure governs VEGF and semaphorin binding and regulates angiogenesis. Angiogenesis. 11:31–39. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Sakurai A, Doçi CL and Gutkind JS: Semaphorin signaling in angiogenesis, lymphangiogenesis and cancer. Cell Res. 22:23–32. 2012. View Article : Google Scholar :

35 

Takahashi K, Ishida M, Hirokawa K and Takahashi H: Expression of the semaphorins sema 3D and sema 3F in the developing parathyroid and thymus. Dev Dyn. 237:1699–1708. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Mine T, Harada K, Matsumoto T, Yamana H, Shirouzu K, Itoh K and Yamada A: CDw108 expression during T-cell development. Tissue Antigens. 55:429–436. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Corbel C, Lemarchandel V, Thomas-Vaslin V, Pelus AS, Agboton C and Roméo PH: Neuropilin 1 and CD25 co-regulation during early murine thymic differentiation. Dev Comp Immunol. 31:1082–1094. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Olson TS and Ley K: Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol. 283:R7–R28. 2002. View Article : Google Scholar : PubMed/NCBI

39 

Ying S, O'Connor B, Ratoff J, Meng Q, Mallett K, Cousins D, Robinson D, Zhang G, Zhao J, Lee TH and Corrigan C: Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity. J Immunol. 174:8183–8190. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Heydtmann M, Lalor PF, Eksteen JA, Hübscher SG, Briskin M and Adams DH: CXC chemokine ligand 16 promotes integrin-mediated adhesion of liver-infiltrating lymphocytes to cholangiocytes and hepatocytes within the inflamed human liver1. Immunol. 174:1055–1062. 2005. View Article : Google Scholar

41 

Cowan JE, Baik S, McCarthy NI, Parnell SM, White AJ, Jenkinson WE and Anderson G: Aire controls the recirculation of murine Foxp3+ regulatory T-cells back to the thymus. Eur J Immunol. 48:844–854. 2018. View Article : Google Scholar :

42 

Rivino L, Gruarin P, Häringer B, Steinfelder S, Lozza L, Steckel B, Weick A, Sugliano E, Jarrossay D, Kühl AA, et al: CCR6 is expressed on an IL-10-producing, autoreactive memory T cell population with context-dependent regulatory function. J Exp Med. 207:565–577. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Balamayooran G, Batra S, Cai S, Mei J, Worthen GS, Penn AL and Jeyaseelan S: Role of CXCL5 in leukocyte recruitment to the lungs during secondhand smoke exposure. Am J Respir Cell Mol Biol. 47:104–111. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Yan Q, Jiang L, Liu M, Yu D, Zhang Y, Li Y, Fang S, Li Y, Zhu YH, Yuan YF and Guan XY: ANGPTL1 interacts with integrin α1β1 to suppress HCC angiogenesis and metastasis by inhibiting jAK2/STAT3 signaling. Cancer Res. 77:5831–5845. 2017. View Article : Google Scholar : PubMed/NCBI

45 

Leng L, Metz CN, Fang Y, Xu J, Donnelly S, Baugh J, Delohery T, Chen Y, Mitchell RA and Bucala R: MIF signal transduction initiated by binding to CD74. J Exp Med. 197:1467–1476. 2003. View Article : Google Scholar : PubMed/NCBI

46 

Abu El-Asrar AM, Ahmad A, Siddiquei MM, De Zutter A, Allegaert E, Gikandi PW, De Hertogh G, Van Damme J, Opdenakker G and Struyf S: The proinflammatory and proangiogenic macrophage migration inhibitory factor is a potential regulator in proliferative diabetic retinopathy. Front Immunol. 10:27522019. View Article : Google Scholar : PubMed/NCBI

47 

Shibata A, Nagaya T, Imai T, Funahashi H, Nakao A and Seo H: Inhibition of NF-kappaB activity decreases the VEGF mRNA expression in MDA-MB-231 breast cancer cells. Breast Cancer Res Treat. 73:237–243. 2002. View Article : Google Scholar : PubMed/NCBI

48 

Laursen LS, Overgaard MT, Søe R, Boldt HB, Sottrup-jensen L, Giudice LC, Conover CA and Oxvig C: Pregnancy-Associated plasma protein-A (PAPP-A) cleaves insulin-like growth factor binding protein (IGFBP)-5 independent of IGF: Implications for the mechanism of IGFBP-4 proteolysis by PAPP-A. FEBS Lett. 504:36–40. 2001. View Article : Google Scholar : PubMed/NCBI

49 

Vacca A, Di Marcotullio L, Giannini G, Farina M, Scarpa S, Stoppacciaro A, Calce A, Maroder M, Frati L, Screpanti I and Gulino A: Thrombospondin-1 is a mediator of the neurotypic differentiation induced by EGF in thymic epithelial cells. Exp Cell Res. 248:79–86. 1999. View Article : Google Scholar : PubMed/NCBI

50 

Otero DC, Baker DP and David M: IRF7-Dependent IFN-β production in response to RANKL promotes medullary thymic epithelial cell development. J Immunol. 190:3289–3298. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Chinoy MR, Graybill MM, Miller SA, Lang CM and Kauffman GL: Angiopoietin-1 and VEGF in vascular development and angiogenesis in hypoplastic lungs. Am J Physiol Lung Cell Mol Physiol. 283:L60–L66. 2002. View Article : Google Scholar : PubMed/NCBI

52 

Fagiani E1, Lorentz P, Kopfstein L and Christofori G: Angiopoietin-1 and -2 exert antagonistic functions in tumor angiogenesis, yet both induce lymphangiogenesis. Cancer Res. 71:5717–5727. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lim YS, Lee D, Kim H, Ok Y, Hwang S, Moon Y and Yoon S: Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks. Int J Mol Med 47: 4, 2021.
APA
Lim, Y.S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., & Yoon, S. (2021). Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks. International Journal of Molecular Medicine, 47, 4. https://doi.org/10.3892/ijmm.2020.4837
MLA
Lim, Y. S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., Yoon, S."Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks". International Journal of Molecular Medicine 47.3 (2021): 4.
Chicago
Lim, Y. S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., Yoon, S."Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks". International Journal of Molecular Medicine 47, no. 3 (2021): 4. https://doi.org/10.3892/ijmm.2020.4837
Copy and paste a formatted citation
x
Spandidos Publications style
Lim YS, Lee D, Kim H, Ok Y, Hwang S, Moon Y and Yoon S: Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks. Int J Mol Med 47: 4, 2021.
APA
Lim, Y.S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., & Yoon, S. (2021). Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks. International Journal of Molecular Medicine, 47, 4. https://doi.org/10.3892/ijmm.2020.4837
MLA
Lim, Y. S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., Yoon, S."Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks". International Journal of Molecular Medicine 47.3 (2021): 4.
Chicago
Lim, Y. S., Lee, D., Kim, H., Ok, Y., Hwang, S., Moon, Y., Yoon, S."Descriptive and functional characterization of epidermal growth factor‑like domain 8 in mouse cortical thymic epithelial cells by integrated analysis of gene expression signatures and networks". International Journal of Molecular Medicine 47, no. 3 (2021): 4. https://doi.org/10.3892/ijmm.2020.4837
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team